<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2180-8-110</ui>
   <ji>1471-2180</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Molecular analysis of the emergence of pandemic <it>Vibrio parahaemolyticus</it></p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Boyd</snm>
               <fnm>E Fidelma</fnm>
               <insr iid="I1"/>
               <email>fboyd@udel.edu</email>
            </au>
            <au id="A2">
               <snm>Cohen</snm>
               <mnm>Luisa V</mnm>
               <fnm>Ana</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>alcohen@student.ucc.ie</email>
            </au>
            <au id="A3">
               <snm>Naughton</snm>
               <mi>M</mi>
               <fnm>Lynn</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>l.m.naughton@student.ucc.ie</email>
            </au>
            <au id="A4">
               <snm>Ussery</snm>
               <mi>W</mi>
               <fnm>David</fnm>
               <insr iid="I3"/>
               <email>dave@cbs.dtu.dk</email>
            </au>
            <au id="A5">
               <snm>Binnewies</snm>
               <mi>T</mi>
               <fnm>Tim</fnm>
               <insr iid="I3"/>
               <email>tim@cbs.dtu.dk</email>
            </au>
            <au id="A6">
               <snm>Stine</snm>
               <fnm>O Colin</fnm>
               <insr iid="I4"/>
               <email>ostin001@umaryland.edu</email>
            </au>
            <au id="A7">
               <snm>Parent</snm>
               <mi>A</mi>
               <fnm>Michelle</fnm>
               <insr iid="I1"/>
               <insr iid="I5"/>
               <email>mparent@udel.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Microbiology, UCC, National University of Ireland-Cork, Ireland</p>
            </ins>
            <ins id="I3">
               <p>Center for Biological Sequence Analysis, BioCentrum, Technical University of Denmark, DK-2800 Kgs, Lyngby, Denmark</p>
            </ins>
            <ins id="I4">
               <p>Department of Epidemiology and Preventive Medicine, University of Maryland School of Medicine, Baltimore, MD 21201, USA</p>
            </ins>
            <ins id="I5">
               <p>Department of Medical Technology, University of Delaware, Newark, DE 19716, USA</p>
            </ins>
         </insg>
         <source>BMC Microbiology</source>
         <issn>1471-2180</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>110</fpage>
         <url>http://www.biomedcentral.com/1471-2180/8/110</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18590559</pubid>
               <pubid idtype="doi">10.1186/1471-2180-8-110</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>28</day>
               <month>1</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>30</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>30</day>
               <month>6</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Boyd et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p><it>Vibrio parahaemolyticus </it>is abundant in the aquatic environment particularly in warmer waters and is the leading cause of seafood borne gastroenteritis worldwide. Prior to 1995, numerous <it>V. parahaemolyticus </it>serogroups were associated with disease, however, in that year an O3:K6 serogroup emerged in Southeast Asia causing large outbreaks and rapid hospitalizations. This new highly virulent strain is now globally disseminated.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We performed a four-way BLAST analysis on the genome sequence of <it>V. parahaemolyticus </it>RIMD2210633, an O3:K6 isolate from Japan recovered in 1996, versus the genomes of four published <it>Vibrio </it>species and constructed genome BLAST atlases. We identified 24 regions, gaps in the genome atlas, of greater than 10 kb that were unique to RIMD2210633. These 24 regions included an integron, f237 phage, 2 type III secretion systems (T3SS), a type VI secretion system (T6SS) and 7 <it>Vibrio parahaemolyticus </it>genomic islands (VPaI-1 to VPaI-7). Comparative genomic analysis of our fifth genome, <it>V. parahaemolyticus </it>AQ3810, an O3:K6 isolate recovered in 1983, identified four regions unique to each <it>V. parahaemolyticus </it>strain. Interestingly, AQ3810 did not encode 8 of the 24 regions unique to RMID, including a T6SS, which suggests an additional virulence mechanism in RIMD2210633. The distribution of only the VPaI regions was highly variable among a collection of 42 isolates and phylogenetic analysis of these isolates show that these regions are confined to a pathogenic clade.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Our data show that there is considerable genomic flux in this species and that the new highly virulent clone arose from an O3:K6 isolate that acquired at least seven novel regions, which included both a T3SS and a T6SS.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Vibrio parahaemolyticus </it>is a Gram-negative halophilic, aerobic bacterium that is distributed in marine and estuarine environments worldwide <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. In the 1950s, Fujino demonstrated that <it>V. parahaemolyticus </it>was the etiological agent responsible for a gastroenteritis outbreak in Osaka, Japan. Presently, in Taiwan, Japan and other South East Asian countries, <it>V. parahaemolyticus </it>cause over half of all food poisoning outbreaks of bacterial origin <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Baross and Liston in the late 1960s identified <it>V. parahaemolyticus </it>in seawater, sediments and shellfish in the United States <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. Today, <it>V. parahaemolyticus </it>is the leading cause of seafood-associated bacterial gastroenteritis in the United States. <it>V. parahaemolyticus </it>can also cause serious wound infections resulting in necrotizing fasciitis when wounds are exposed to <it>V. parahaemolyticus </it>contaminated water <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>. Although less common, <it>V. parahaemolyticus </it>can cause fatal septicemia in immune compromised hosts <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Most isolates of <it>V. parahaemolyticus </it>are non-pathogenic and only a small number can cause infections in humans <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Clinical isolates of <it>V. parahaemolyticus </it>produce beta type hemolysis on blood agar (Wagatsuma agar) called the Kanagawa-phenomenon (KP), which is linked to the production of a thermostable direct hemolysin (TDH) <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. TDH damages eukaryotic cells by acting as a pore forming toxin that alters the ion balance of cells <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The presence of the <it>tdh </it>gene, which encodes TDH is often used as a diagnostic tool to identify pathogenic isolates of <it>V. parahaemolyticus</it>. Five sequence variants of <it>tdh </it>(named <it>tdh1 </it>to <it>tdh5</it>) have been identified, however only <it>tdh2 </it>appears to have a high-level of transcription <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. In the 1980s, several cases of gastroenteritis caused by hemolytic KP-negative TDH-negative <it>V. parahaemolyticus </it>isolates were reported <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. These isolates contained a TDH-related hemolysin (TRH) encoded by <it>trh</it>, which showed 69% sequence similarity with <it>tdh </it><abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. TDH and TRH are considered the main virulence factors of <it>V. parahaemolyticus </it>and strains can contain either TDH or TRH or both <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Although isolates that do not contain <it>tdh </it>or those that have a deletion in <it>tdh </it>are still cytotoxic to cells. Hence, the overall mechanism involved in the organism's pathogenesis remains unclear.</p>
         <p>Analysis of the complete genome sequence of <it>V. parahaemolyticus </it>RIMD2210633, a clinical isolate recovered in Japan in 1996, identified a type III secretion system (T3SS) on each chromosome designated T3SS-1 and T3SS-2 <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Subsequently, the functional significance of both T3SSs was determined using deletion mutants <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. The T3SS-1 deletion mutants had significantly decreased cytotoxic activity compared with that of the wild type <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. The T3SS-2 deletion mutants showed diminished intestinal fluid accumulation, in an enterotoxicity assay using the rabbit ileal loop test, whereas T3SS-1 mutants were similar to the wild type <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. In addition, a number of effector proteins for these T3SSs have been identified <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. T3SS-1 is present in both clinical and environmental isolates and has a percent G+C content similar to the rest of the genome indicating that this region is ancestral to the species <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Henke and Bassler <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> found that unlike other T3SSs in pathogenic <it>E. coli</it>, which are activated by quorum sensing, T3SS-1 in <it>V. parahaemolyticus </it>is repressed at high cell densities.</p>
         <p>Associated with T3SS-2 encoded on chromosome 2 are Tdh1 and Tdh2, as well as a cytotoxic necrotizing factor, an exoenzyme T, and at least five transposases <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The presence of transposases and a G+C content of 40% (less than the overall genome), suggests that T3SS-2 may be a integrative element similar to pathogenicity islands identified in pathogenic <it>E. coli, S. enterica</it>, and <it>V. cholerae</it>, which we named <it>Vibrio parahaemolyticus </it>island-7 (VPaI-7) <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B26">26</abbr></abbrgrp>. T3SS-2 is present predominantly in the <it>V. parahaemolyticus </it>O3:K6 highly virulent strains recovered after 1995, whereas most clinical isolates recovered before 1995 do not encode T3SS-2 indicating that the region is not essential for virulence, but may enhance virulence when present <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>.</p>
         <p>Serotyping of <it>V. parahaemolyticus </it>isolates has identified more than 13 O antigen groups and 71 K antigen types <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Up until 1995, <it>V. parahaemolyticus </it>associated gastroenteritis was caused by many different serogroups, although in some geographic regions specific serogroups predominated. For example, in the United States a predominance of the O4 serogroup among clinical isolates was apparent <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. In 1995, an outbreak of <it>V. parahaemolyticus </it>infections occurred in Calcutta, India, which caused rapid hospitalization of those infected and were caused by a single serotype, a new O3:K6 highly virulent strain <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. Since 1995, a global dissemination of this <it>V. parahaemolyticus </it>new highly virulent strain is evident since it has now been isolated throughout Asia, America, Africa, and Europe <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B29">29</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. For example, in 1998, the new highly virulent strain was responsible for a large outbreak of gastroenteritis in Galveston Bay, Texas <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Later on that year, the highly virulent strain was responsible for large gastroenteritis outbreaks in Long Island Sound-Connecticut, New York, and New Jersey <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. In 2005, the highly virulent strain caused a major outbreak in Chile with over 1,000 cases <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Non-O3:K6 pathogenic isolates recovered since 1995, including O4:K68, O1:KUT, and O1:K25 serotypes, have been shown to be closely related to the new highly virulent O3:K6 strain based on molecular typing schemes and phylogenetic approaches <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>.</p>
         <p>Previously, it was thought that <it>V. parahaemolyticus </it>was confined to tropical climates, however recent studies report the recovery of O3:K6 isolates from the water in Southern Chile and Alaska, that up until now were considered too cold to support the growth of this organism <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp>. These recent discoveries suggest a change in the organism's ability to adapt and survive in colder environments. Indeed the ability of <it>V. parahaemolyticus </it>to survive and proliferates in its environmental niches, in shellfish and in the human intestine may have resulted from the acquisition of regions encoding novel traits which are differentially regulated in different niches. Additionally, the spread of the organism is another indication of global warming, which is likely to play a role in increasing <it>V. parahaemolyticus </it>distribution and occurrence.</p>
         <p>First, we used a two step genomic approach to elucidate the genomic changes that may have resulted in the emergence of the new highly virulent O3:K6 and related strains. We performed <it>in silico </it>whole genome comparisons of <it>V. parahaemolyticus </it>RIMD2210633 versus the genome sequences of <it>V. cholerae </it>N16961, <it>V. vulnificus </it>YJ016 and CMCP6, and <it>V. fischeri </it>ES114. We constructed genome BLAST atlases of each species to determine regions unique to <it>V. parahaemolyticus</it>. We uncovered 24 regions greater than 10 kb that were unique to RIMD2210633 and absent from the other <it>Vibrio </it>species examined. These included functionally distinct regions such as the class 1 integron, f237-like phages, <it>Vibrio parahaemolyticus </it>genomic island regions (VPaI-1 to VPaI-7), a lipopolysaccaride (LPS)/capsule polysaccharide (CPS) region, two osmotic stress response clusters, two T3SSs and a T6SS. Next, we compared the RIMD2210633 genome sequence to that of AQ3810, an O3:K6 strain isolated in 1983, to elucidate the steps involved in the emergence of the globally disseminated O3:K6 highly virulent strain. This analysis identified several regions unique to one isolate or the other. Molecular analysis of the distribution of regions unique to RIMD2210633 among 42 natural isolates revealed that only regions encoding integrase or transposase genes (7 island regions) were variably present. We reconstructed the phylogeny of the 42 isolates based on multilocus sequence analysis, and mapped the distribution of the 7 island regions, which showed that these regions were acquired by the new O3:K6 highly virulent strain and predominant in one clade.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Comparative genome analysis of <it>V. parahaemolyticus </it>RIMD2210633 versus <it>V. cholerae </it>N16961, V. vulnificus YJ016 and CMCP6, and <it>V. fischeri </it>ES114</p>
            </st>
            <p>Systematic BLAST analysis was carried out for each of the ORFs of <it>V. parahaemolyticus </it>RIMD2210633 compared with each of the ORFs from the genome sequences of <it>V. cholerae </it>N16961, <it>V. vulnificus </it>YJ016 and CMCP6, and <it>V. fischeri </it>ES114. This four-way BLAST analysis was used to construct genome BLAST atlases of chromosome 1 and 2 of the four <it>Vibrio </it>species with <it>V. parahaemolyticus </it>RIMD2210633 as a reference (Fig. <figr fid="F1">1</figr>). The four outer circles of solid color represent conserved proteins of the BLASTed genomes for both chromosome 1 and 2. The outer most circle represents the <it>V. fischeri </it>ES114 genome (purple circle), the next two circles represents <it>V. vulnificus </it>YJ016 and CMCP6 (navy and green circles), followed by the fourth circle (brown circle), which represents <it>V. cholerae </it>N16961. The innermost circles show DNA structure features, repeat sequences and base composition properties of the reference <it>V. parahaemolyticus </it>RIMD2210633 (Fig. <figr fid="F1">1</figr>). It is of interest to note that chromosome 1 shows a higher level of overall conservation among the species examined than chromosome 2 indicating that a lot of species specific genes lie on chromosome 2. There are approximately 44 gap regions (greater than 1 kb) on chromosome 1 and 29 gap regions (greater than 1 kb) on chromosome 2, common to all four outer circles and these gaps represent regions of the <it>V. parahaemolyticus </it>RIMD2210633 chromosomes that are unique being absent from all other isolates examined. Differences in these regions in their DNA structural features such as intrinsic curvature, stacking energy and position preference correlate with some of the gap regions and represent phages, integrons and genomic islands, that is signatures of foreign DNA acquired by horizontal transfer (Fig. <figr fid="F1">1</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Genome BLAST Atlas of <it>V. parahaemolyticus </it>RIMD2210633 as reference strain (inner most circle) versus <it>V. fischeri </it>ES114 (outer most circle purple), <it>V. vulnificus </it>strains YJ016 and CMCP6 (2nd navy and 3rd green circles) and <it>V. cholerae </it>N16961 (4th circle brown) for chromosome 1 (a) and chromosome 2 (b) <abbrgrp><abbr bid="B60">60</abbr></abbrgrp></p>
               </caption>
               <text>
                  <p><b>Genome BLAST Atlas of <it>V. parahaemolyticus </it>RIMD2210633 as reference strain (inner most circle) versus <it>V. fischeri </it>ES114 (outer most circle purple), <it>V. vulnificus </it>strains YJ016 and CMCP6 (2nd navy and 3rd green circles) and <it>V. cholerae </it>N16961 (4th circle brown) for chromosome 1 (a) and chromosome 2 (b)</b><abbrgrp><abbr bid="B60"><b>60</b></abbr></abbrgrp><b>.</b> The gaps or holes in the outer four circles represent regions present in <it>V. parahaemolyticus </it>strain RIMD2210633 that are absent from the other three species. The innermost circles show DNA structure features, DNA intrinsic curvature (circle 5), DNA stacking energy (circle 6), DNA position preference (circle 7), positive and negative coding strands are indicated by dark blue and red circle. Global direct and global inverted repeats are represented by circles 9 and 10, respectively and the two inner most circles represent GC shew and AT content, respectively.</p>
               </text>
               <graphic file="1471-2180-8-110-1"/>
            </fig>
            <p>Of the 73 gap regions, our analysis uncovered 24 regions greater than 10 kb that are present in RIMD2210633 and absent from the other species examined, that is the gap regions in the four outer circles in Figure <figr fid="F1">1</figr> (Table <tblr tid="T1">1</tblr>). Of the 24 regions identified, 11 regions encoded an integrase or transposase, 9 regions had aberrant GC content (45 &#177; 3%), 7 regions of which had lower G+C content compared to the rest of the genome suggesting that these regions were acquired by horizontal gene transfer (Table <tblr tid="T1">1</tblr>). The 24 regions included 14 previously identified: lipopolysaccharide and capsule polysaccharide gene clusters, a class 1 integron, 2 f237 phage regions, 2 osmotic stress response gene clusters, 2 T3SSs, and the <it>Vibrio parahaemolyticus </it>island (VPaI) regions (Table <tblr tid="T1">1</tblr>) <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B26">26</abbr><abbr bid="B47">47</abbr></abbrgrp>. The 10 additional regions unique to <it>V. parahaemolyticus </it>RIMD2210633 included 2 regions encoded on chromosome 1 and 8 regions encoded on chromosome 2 (Table <tblr tid="T1">1</tblr>). On chromosome 1, region VP0081 to VP0092 encodes mainly hypothetical proteins of unknown function; VP0081 encodes a homologue of a hyper osmotic shock protection protein. Region VP1386 to VP1420 encodes hemo utilization/adhesion proteins, OmpA, a ClpA/B type protease, a BfdA homologue, a putative IcmF-related protein and related type VI secretion system (T6SS) proteins (VP1401 to VP1409), which is predicted to be involved in intracellular trafficking, secretion, and vesicular transport in other Gram-negative pathogens. On chromosome 2, region VPA0434 to VPA0458 encodes a large number of homologues of genes involved in degradation processes. Region VPA887 to VPA0914 encode proteins that show homology to phage f237 on chromosome 1. Within region VPA0950 to VPA0962 are homologues of biofilm associated proteins among others. Region VPA0989 to VPA0999 contains homologues of a number of peptidase, lipase and amylase genes, and region VPA1440 to VPA1444 encode a type I secretion system (Table <tblr tid="T1">1</tblr>). Region VPA1503 to VPA1513 contained a type 1 pilin homologue similar to Pap pilin identified in <it>Burkholderia pseudomallie, Pseudomonas spp </it>and <it>Yersinia </it>spp. Region VPA1559 to VPA1583 encodes a number of proteins with a possible role in antibiotic resistance and region VPA1652 to VPA1679 contains a ferric uptake system.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Chromosomal regions unique to <it>V. parahaemolyticus </it>strains RIMD2210633 and AQ3810</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>ORFs</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Region type</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Size</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>% GC</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Int</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>AQ3810</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reference</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Chromosome I</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0081 &#8211; VP0092</p>
                     </c>
                     <c ca="left">
                        <p>NK</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>48</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0218 &#8211; VP0234</p>
                     </c>
                     <c ca="left">
                        <p>LPS</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c ca="left">
                        <p>40</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0380 &#8211; VP0403</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-1</p>
                     </c>
                     <c ca="left">
                        <p>24</p>
                     </c>
                     <c ca="left">
                        <p>42</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0634 &#8211; VP0643</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-2</p>
                     </c>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="left">
                        <p>45</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1071 &#8211; VP1095</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-3</p>
                     </c>
                     <c ca="left">
                        <p>32</p>
                     </c>
                     <c ca="left">
                        <p>42</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Partial</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1386 &#8211; VP1420</p>
                     </c>
                     <c ca="left">
                        <p>T6SS</p>
                     </c>
                     <c ca="left">
                        <p>57</p>
                     </c>
                     <c ca="left">
                        <p>43</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1549 &#8211; VP1590</p>
                     </c>
                     <c ca="left">
                        <p>phage f237</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B33">33</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1658 &#8211; VP1702</p>
                     </c>
                     <c ca="left">
                        <p>T3SS-1</p>
                     </c>
                     <c ca="left">
                        <p>35</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1719 &#8211; VP1728</p>
                     </c>
                     <c ca="left">
                        <p>Osmotolerance</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c ca="left">
                        <p>-</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B47">47</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1787 &#8211; VP1865</p>
                     </c>
                     <c ca="left">
                        <p>Integron class-1</p>
                     </c>
                     <c ca="left">
                        <p>48</p>
                     </c>
                     <c ca="left">
                        <p>40</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP2131 &#8211; VP2144</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-4</p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>39</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP2900 &#8211; VP2910</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-5</p>
                     </c>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="left">
                        <p>38</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Chromosome II</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0434 &#8211; VPA0458</p>
                     </c>
                     <c ca="left">
                        <p>Degradative</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Partial</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0887 &#8211; VPA0914</p>
                     </c>
                     <c ca="left">
                        <p>phage f237-like</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0950 &#8211; VPA0962</p>
                     </c>
                     <c ca="left">
                        <p>Biofilm</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0989 &#8211; VPA0999</p>
                     </c>
                     <c ca="left">
                        <p>Gametolysin</p>
                     </c>
                     <c ca="left">
                        <p>18</p>
                     </c>
                     <c ca="left">
                        <p>45</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1102 &#8211; VPA1115</p>
                     </c>
                     <c ca="left">
                        <p>Osmotolerance</p>
                     </c>
                     <c ca="left">
                        <p>17</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B47">47</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1253 &#8211; VPA1270</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-6</p>
                     </c>
                     <c ca="left">
                        <p>27</p>
                     </c>
                     <c ca="left">
                        <p>43</p>
                     </c>
                     <c ca="left">
                        <p>Int</p>
                     </c>
                     <c ca="left">
                        <p>Absent</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1312 &#8211; VPA1395</p>
                     </c>
                     <c ca="left">
                        <p>VPaI-7 (T3SS-2)</p>
                     </c>
                     <c ca="left">
                        <p>81</p>
                     </c>
                     <c ca="left">
                        <p>39</p>
                     </c>
                     <c ca="left">
                        <p>Tnp</p>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B26">26</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1403 &#8211; VPA1412</p>
                     </c>
                     <c ca="left">
                        <p>CPS</p>
                     </c>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1440 &#8211; VPA1444</p>
                     </c>
                     <c ca="left">
                        <p>Type I secretion</p>
                     </c>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>47</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1503 &#8211; VPA1521</p>
                     </c>
                     <c ca="left">
                        <p>Type I pilus</p>
                     </c>
                     <c ca="left">
                        <p>20</p>
                     </c>
                     <c ca="left">
                        <p>45</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1559 &#8211; VPA1583</p>
                     </c>
                     <c ca="left">
                        <p>Multidrug efflux</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                     <c ca="left">
                        <p>46</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1652 &#8211; VPA1679</p>
                     </c>
                     <c ca="left">
                        <p>Ferric uptake</p>
                     </c>
                     <c ca="left">
                        <p>25</p>
                     </c>
                     <c ca="left">
                        <p>50</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Present</p>
                     </c>
                     <c ca="left">
                        <p>This study</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>We also constructed genome BLAST atlases of all 28 genomes available for members of the family <it>Vibrionaceae </it>in the database, this included eight additional species of the <it>Vibrionaceae </it>family. <it>V. parahaemolyticus </it>RIMD2210633 as reference strain (inner most circle) versus <it>V. parahaemolyticus </it>AQ3810, <it>V. cholerae </it>1587, AM-19226, MAK757, MO10, MZO-2, MZO-3, B33, NCTC8457, RC385, O395, V51, V52, 623&#8211;39, and 2740&#8211;80, <it>V. harveyi </it>ATCC BAA116, <it>V. alginolyticus </it>12G01, <it>Vibrio </it>sp. Ex25, <it>V. vulnificus </it>CMCP6 and YJ016, <it>V. splendidus </it>12B01, <it>Vibrio </it>sp. MED222, <it>V. fischeri </it>ES114, <it>V. salmonicida </it>LF1238, <it>V. angustum </it>S14, <it>P. profundum </it>SS9 and 3TCK for chromosome 1 (a) and chromosome 2 (b), in which each gap region can be zoomed in on to examine in detail (see Additional file <supplr sid="S1">1</supplr> &amp;<supplr sid="S2">2</supplr>) <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Fig. S1.</b>  Genome BLAST Atlas of <it>V. parahaemolyticus</it> RIMD2210633 as reference strain (inner most circle) versus 27 genomes of members of the family <it>Vibrionaceae</it> for chromosome 1. <it>V. parahaemolyticus</it> RIMD2210633 as reference strain (inner most circle) versus <it>V. parahaemolyticus</it> AQ3810, <it>V. cholerae</it> 1587, AM-19226, MAK757, MO10, MZO-2, MZO-3, B33, NCTC8457, RC385, O395, V51, V52, 623-39, and 2740-80, <it>V. harveyi</it> ATCCBAA116, <it>V. alginolyticus</it> 12G01, <it>Vibrio</it> sp. Ex25, <it>V. vulnificus</it> CMCP6 and YJ016, <it>V. splendidus</it> 12B01, <it>Vibrio</it> sp. MED222, <it>V. fischeri</it> ES114, <it>V. salmonicida</it> LF1238, <it>V. angustum</it> S14, <it>P. profundum</it> SS9 and 3TCK for chromosome 1.  The gaps or holes in the outer four circles represent regions present in <it>V. parahaemolyticus</it> strain RIMD2210633 that are absent from the other species.  The innermost circles show DNA structure features, DNA stacking energy, DNA position preference, positive and negative coding strands are indicated by dark blue and red circle. Global direct and global inverted repeats are represented and the two inner most circles represent GC shew and AT content, respectively.</p>
               </text>
               <file name="1471-2180-8-110-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Fig. S2.</b>  Genome BLAST Atlas of <it>V. parahaemolyticus</it> RIMD2210633 as reference strain (inner most circle) versus 27 genomes of members of the family <it>Vibrionaceae</it> for chromosome 2. <it>V. parahaemolyticus</it> RIMD2210633 as reference strain (inner most circle) versus <it>V. parahaemolyticus</it> AQ3810, <it>V. cholerae</it> 1587, AM-19226, MAK757, MO10, MZO-2, MZO-3, B33, NCTC8457, RC385, O395, V51, V52, 623-39, and 2740-80, <it>V. harveyi</it> ATCCBAA116, <it>V. alginolyticus</it> 12G01, <it>Vibrio</it> sp. Ex25, <it>V. vulnificus</it> CMCP6 and YJ016, <it>V. splendidus</it> 12B01, <it>Vibrio</it> sp. MED222, <it>V. fischeri</it> ES114, <it>V. salmonicida</it> LF1238, <it>V. angustum</it> S14, <it>P. profundum</it> SS9 and 3TCK for chromosome 2.  The gaps or holes in the outer four circles represent regions present in <it>V. parahaemolyticus</it> strain RIMD2210633 that are absent from the other species.  The innermost circles show DNA structure features, DNA stacking energy, DNA position preference, positive and negative coding strands are indicated by dark blue and red circle. Global direct and global inverted repeats are represented and the two inner most circles represent GC shew and AT content, respectively.</p>
               </text>
               <file name="1471-2180-8-110-S2.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Most of the 24 gap regions remained unique to <it>V. parahaemolyticus</it>, exceptions were noted (see Additional file <supplr sid="S1">1</supplr> and <supplr sid="S2">2</supplr>). For example, on chromosome 1 region VP0081 to VP0092 is present in <it>V. alginolyticus </it>12G01 and <it>Vibrio </it>sp. Ex25, the osmotolerance gene clusters are partially present in <it>V. alginolyticus </it>12G01, <it>V. harveyi </it>ATCC BAA116 and <it>Vibrio </it>sp. Ex25, and the T3SS-1 and T6SS (VP1388 to VP1414) are present in <it>V. alginolyticus, V. harveyi </it>and <it>Vibrio </it>sp. Ex25 (see Additional file <supplr sid="S1">1</supplr> and <supplr sid="S2">2</supplr>). On chromosome 2, region VPA0950 to VPA0962 was present in <it>Vibrio </it>sp. Ex25, homology to VPaI-7 within the T3SS-2 region (VPA1332 to VPA1355 and VPA1358 to VPA1370) is present in <it>V. cholerae </it>strains 1587, AM-19226, V51 and 623&#8211;39. Region VPA1440 to VPA1442 is present in <it>Vibrio </it>sp. Ex25. Region VPA1503 to VPA1521, which encodes a type I pilin is present in <it>V. alginolyticus, V. harveyi </it>and <it>Vibrio </it>sp. Ex25 (see Additional file <supplr sid="S1">1</supplr> and <supplr sid="S2">2</supplr>).</p>
         </sec>
         <sec>
            <st>
               <p>Genome sequence of <it>V. parahaemolyticus </it>AQ3810</p>
            </st>
            <p>The previously published <it>V. parahaemolyticus </it>genome sequence is from RIMD2210633 a <it>tdh </it>positive, <it>trh </it>and urease negative O3:K6 clinical isolate of the highly virulent clone recovered in Japan in 1996. In order to unravel events at the genome level that may have lead to the emergence and dissemination of the new highly virulent strain, we sequenced the genome of AQ3810, a <it>tdh </it>positive, <it>trh </it>and urease negative O3:K6 isolate recovered in Japan in 1983 for comparison. The complete genome sequence of AQ3810 is 5.8 Mb and 5509 proteins have been annotated within its genome compared with the 5.2 Mb genome of RIMD2210633, which has 4832 annotated proteins. There is extensive sequence homology between the two sequences, however genomic differences were noted. As had been found within other <it>Vibrio </it>species, the gene capture system, the -integron encoded in RIMD2210633 and AQ3810 do not share any significant sequence similarity.</p>
            <p>We examined the genome of AQ3810 for the presence of the 24 regions identified as unique to RIMD2210633 from our species comparisons (Table <tblr tid="T1">1</tblr>). Of the 24 regions, 8 regions were absent from AQ3810, 5 genomic islands (VPa-1, VPaI-2, VPaI-4, VPaI-5 and VPaI-6), ORFs VP1386 to VP1420, which encodes T6SS, the class 1 integron, and phage f237 encoded on chromosome 1 (Table <tblr tid="T1">1</tblr>). These data confirm our previous result that VPaI-1, VPaI-4, VPaI-5 and VPaI-6 are unique to the new highly virulent strain recovered after 1995 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. For example, two of the missing regions, VPaI-1 and VPaI-4, integrate at a tRNA-met (VP0404.1) and tRNA-ser locus (VP2130.1), respectively in RIMD2210633, however, in AQ3810, both of these tRNA sites are empty (see Additional file <supplr sid="S3">3</supplr>). The other two missing regions VPaI-5 and VPaI-6 regions are located between core chromosomal ORFs VP2889 and VP2911, and VPA1252 and VPA1271, respectively in RIMD2210633, while in AQ3810, the homologues of these genes are contiguous indicating that these sites are empty (see Additional file <supplr sid="S3">3</supplr>).</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p><b>Fig. S3.</b>  Linear comparison of <it>V. parahaemolyticus</it> RIMD2210633 and AQ3810 created using ACT (Artemis Comparison Tool) at the insertion sites of (A) VPaI-1 and VPaI-4, and (B) VPaI-5 and VPaI-6.  A homologous block of genomic sequence (BLASTN matches) is indicated by red lines between the chromosomal regions examined.  The location of the genomic islands (GIs) identified in RIMD2210633 are illustrated above, and in AQ3810 below the genome comparison.  Horizontal arrows represent annotated genes, striped arrows represent integrases, and the direction of the arrow indicates gene orientation.</p>
               </text>
               <file name="1471-2180-8-110-S3.ppt">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Two VPaIs were rearranged. One, the VPaI-2 region (VP0634 to VP0643), is present at the tmRNA gene (<it>ssrA</it>) in RIMD2210633, a gene that encodes both tRNA and mRNA properties. In AQ3810, at this same locus, the first three genes of this region are present (VP0634 to VP0636), which encode homologues of a nitrilase/cyanide hydratase, OmpA and LysR, but the remaining genes are replaced by a novel region encoding an integrase (see Additional file <supplr sid="S4">4</supplr>). A second island region, VPaI-3 (VP1071 to VP1095) present at a second tRNA-ser locus (VP1070.1) in both RIMD2210633 and AQ3810 has 21 genes in common (ORFs VP1074 to VP1095) and 6 genes, two novel integrases and four hypothetical proteins, are adjacent to the tRNA-ser locus in AQ3810 (see Additional file <supplr sid="S4">4</supplr>).</p>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p><b>Fig. S4.</b>  Linear comparison of <it>V. parahaemolyticus</it> strain RIMD2210633 and strain AQ3810 created using ACT [59] at the insertion sites of (A) VPaI-2 and VPaI-3, and (B) VPaI-9 and  VPaI-10.  A homologous block of genomic sequence (BLASTN matches) is indicated by red and blue lines between the chromosomes; blue lines indicate chromosomal inversion events.  The location of <it>Vibrio parahaemolyticus</it> islands (VPaIs) identified is illustrated above for RIMD2210633 and below for AQ3810 the region examined. Horizontal arrows represent annotated genes, striped arrows represent integrases, and the direction of the arrow indicates gene orientation.</p>
               </text>
               <file name="1471-2180-8-110-S4.ppt">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Two additional regions named VPaI-8 and VPaI-9 were identified in AQ3810 (see Additional file <supplr sid="S4">4</supplr>). VPaI-8 is a 17 kb region located between homologues of VP3057 and VP3058 and contains ORFs A79_5175 to A79_5191, which encode a number of hypothetical proteins, homologues of SMF and KAP proteins, and two integrases separated by a single ORF (see Additional file <supplr sid="S4">4</supplr>). VPaI-9 is a 22 kb region integrated between homologues of VP0006 and VP0007. VPaI-9 encodes an integrase, an excisionase, a helicase and a type I restriction modification system.</p>
            <p>ORFs VP1386 to VP1420 are absent from AQ3810. This regions encodes T6SS (ORFs VP1401 to VP1409) and a range of proteins that could be translocated by this system; hemo utilization/adhesion proteins, OmpA, a ClpA/B type protease, a BfdA homologue, a putative IcmF-related protein. This suggests the presence of an additional virulence mechanism in the highly virulent O3:K6 clone. T6SSs have been identified in a range of Gram-negative pathogens including pathogenic <it>V. cholerae </it>and in that species T6SS translocates a bacterial host protein into host cells that cross link actin <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Distribution of VPaI-2, VPaI-3 and VPaI-7</p>
            </st>
            <p>Previously, we examined the distribution of VPaI-1, VPaI-4, VPaI-5 and VPaI-6 among a worldwide collection of <it>V. parahaemolyticus </it>isolates and found that these regions are unique to 24 isolates of the highly virulent O3:K6 clone <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. We determined the distribution of VPaI-2, VPaI-3 and VPaI-7 using primer pairs described in Table <tblr tid="T2">2</tblr>. Of the 42 <it>V. parahaemolyticus </it>isolates examined by PCR assays using two primer pairs encompassingVPaI-2, 27 isolates gave positive PCR bands. These isolates were recovered post-1995 and include the 24 isolates that were previously shown to contain VPaI-1, VPaI-4 to -6 (Fig. <figr fid="F2">2</figr>). VPaI-2 was also present in isolates UCMV586 and 1324, O8:K22 and O4:K6 isolates recovered after 1995, and ATCC43996, an O3:K4 clinical isolate from recovered in the UK in 1970 (Fig. <figr fid="F2">2</figr>). The presence of VPaI-2 in ATCC43996 indicates that this region was present in isolates before 1995, prior to its acquisition by the new highly virulent strain. VPaI-2 encodes an integrase, a resolvase, hypothetical proteins, a ribonuclease HI, an aminohydrolase, transcriptional regulators and a lipase.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers used in this study</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer Designation</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer sequence 5' &#8211; 3'</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Ta (&#176;C)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Product size (bp)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>VPaI-2</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0634F</p>
                     </c>
                     <c ca="left">
                        <p>GGGGGAAATAAATGTCTGAAGG</p>
                     </c>
                     <c ca="left">
                        <p>52.1</p>
                     </c>
                     <c ca="left">
                        <p>1363</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0634R</p>
                     </c>
                     <c ca="left">
                        <p>AACACGCCAAGACTCTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0637F</p>
                     </c>
                     <c ca="left">
                        <p>GGAATAACTCAGAGCTTCG</p>
                     </c>
                     <c ca="left">
                        <p>52.8</p>
                     </c>
                     <c ca="left">
                        <p>1848</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0640R</p>
                     </c>
                     <c ca="left">
                        <p>TAGGCAGTCGTAATTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0643F</p>
                     </c>
                     <c ca="left">
                        <p>ATACGCCTGATTGCTTC</p>
                     </c>
                     <c ca="left">
                        <p>52.0</p>
                     </c>
                     <c ca="left">
                        <p>1558</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0643R</p>
                     </c>
                     <c ca="left">
                        <p>TGGTACTATCAACGCCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0644F</p>
                     </c>
                     <c ca="left">
                        <p>CGTGCTTTTTCTCTTGC</p>
                     </c>
                     <c ca="left">
                        <p>51.1</p>
                     </c>
                     <c ca="left">
                        <p>970</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0644R</p>
                     </c>
                     <c ca="left">
                        <p>CCATATTGCTAGTTAGCTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>VPaI-3</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1069F</p>
                     </c>
                     <c ca="left">
                        <p>TAGGGTCGGTGGTGTACTTG</p>
                     </c>
                     <c ca="left">
                        <p>52.8</p>
                     </c>
                     <c ca="left">
                        <p>2041</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1069R</p>
                     </c>
                     <c ca="left">
                        <p>GACTCCACTATTGGTTTA GC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1072F</p>
                     </c>
                     <c ca="left">
                        <p>AGAGTCAGAGGAAAGGGAGG</p>
                     </c>
                     <c ca="left">
                        <p>50.3</p>
                     </c>
                     <c ca="left">
                        <p>2275</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1073R</p>
                     </c>
                     <c ca="left">
                        <p>GTAAATGTTGTGGGTGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1079F</p>
                     </c>
                     <c ca="left">
                        <p>CTGTCTTCATGCCTTTG</p>
                     </c>
                     <c ca="left">
                        <p>51.0</p>
                     </c>
                     <c ca="left">
                        <p>1691</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1079R</p>
                     </c>
                     <c ca="left">
                        <p>CGCCATTGCTAAACGTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1083F</p>
                     </c>
                     <c ca="left">
                        <p>CTTACTTATTGGAGGCTGG</p>
                     </c>
                     <c ca="left">
                        <p>52.1</p>
                     </c>
                     <c ca="left">
                        <p>2127</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1083R</p>
                     </c>
                     <c ca="left">
                        <p>GGTGGGTATAAAGGTAACG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1095F</p>
                     </c>
                     <c ca="left">
                        <p>TCTGGTTCGGTATTTGG</p>
                     </c>
                     <c ca="left">
                        <p>52.7</p>
                     </c>
                     <c ca="left">
                        <p>1166</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1096R</p>
                     </c>
                     <c ca="left">
                        <p>CGCAGCATTTCTTGAAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>VPaI-7</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1308F</p>
                     </c>
                     <c ca="left">
                        <p>TTAGAACGCATGAGCACCG</p>
                     </c>
                     <c ca="left">
                        <p>53.1</p>
                     </c>
                     <c ca="left">
                        <p>1844</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1309R</p>
                     </c>
                     <c ca="left">
                        <p>CCACCAAAGTGTTTGTGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1312F</p>
                     </c>
                     <c ca="left">
                        <p>CTACTATCATCACGACGTG</p>
                     </c>
                     <c ca="left">
                        <p>49.4</p>
                     </c>
                     <c ca="left">
                        <p>1487</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1314R</p>
                     </c>
                     <c ca="left">
                        <p>CGTGCTTATAGCCAGAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1317F</p>
                     </c>
                     <c ca="left">
                        <p>GACAGACAGAGATACGCTG</p>
                     </c>
                     <c ca="left">
                        <p>50.9</p>
                     </c>
                     <c ca="left">
                        <p>1366</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1320R</p>
                     </c>
                     <c ca="left">
                        <p>TTCAGAGGTGTCGCACTTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1321F</p>
                     </c>
                     <c ca="left">
                        <p>CGTGGTGGTTAGTGAATC</p>
                     </c>
                     <c ca="left">
                        <p>49.1</p>
                     </c>
                     <c ca="left">
                        <p>886</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1321R</p>
                     </c>
                     <c ca="left">
                        <p>AGAGTTGGTTTCGCAGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1321F</p>
                     </c>
                     <c ca="left">
                        <p>GACCACTATATTGTTCTCCG</p>
                     </c>
                     <c ca="left">
                        <p>49.4</p>
                     </c>
                     <c ca="left">
                        <p>1480</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1323R</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGGGATAAATAGGGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1331F</p>
                     </c>
                     <c ca="left">
                        <p>CCAATAATCACCCTCCG</p>
                     </c>
                     <c ca="left">
                        <p>49.9</p>
                     </c>
                     <c ca="left">
                        <p>1857</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1334R</p>
                     </c>
                     <c ca="left">
                        <p>CTCAGGGATAAATAGGGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1340F</p>
                     </c>
                     <c ca="left">
                        <p>GTCCTTGATTACACCATTGG</p>
                     </c>
                     <c ca="left">
                        <p>51.8</p>
                     </c>
                     <c ca="left">
                        <p>1618</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1343R</p>
                     </c>
                     <c ca="left">
                        <p>GCACGTAACATCTAAGTTCGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1350F</p>
                     </c>
                     <c ca="left">
                        <p>TGCATCGTCATTTCTCC</p>
                     </c>
                     <c ca="left">
                        <p>50.4</p>
                     </c>
                     <c ca="left">
                        <p>2630</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1354R</p>
                     </c>
                     <c ca="left">
                        <p>CGTAGATTTCATGGCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1363F</p>
                     </c>
                     <c ca="left">
                        <p>TTTCACTAATGCTGCGG</p>
                     </c>
                     <c ca="left">
                        <p>51.1</p>
                     </c>
                     <c ca="left">
                        <p>2308</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1365R</p>
                     </c>
                     <c ca="left">
                        <p>GGTCAATATGGCACTATGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1380F</p>
                     </c>
                     <c ca="left">
                        <p>TTAGGGGTGTTATGCCG</p>
                     </c>
                     <c ca="left">
                        <p>48.5</p>
                     </c>
                     <c ca="left">
                        <p>816</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1380R</p>
                     </c>
                     <c ca="left">
                        <p>TTACTGTCTCTGTTGCAGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1390F</p>
                     </c>
                     <c ca="left">
                        <p>CCACAACACAAACTGTCC</p>
                     </c>
                     <c ca="left">
                        <p>50.9</p>
                     </c>
                     <c ca="left">
                        <p>2606</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1393R</p>
                     </c>
                     <c ca="left">
                        <p>AATCCAAGGGGAGTGAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1394F</p>
                     </c>
                     <c ca="left">
                        <p>AACGCCGAATTAACCGC</p>
                     </c>
                     <c ca="left">
                        <p>53.2</p>
                     </c>
                     <c ca="left">
                        <p>2356</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1395R</p>
                     </c>
                     <c ca="left">
                        <p>TCACCCCAATGTACCGTCTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1397F</p>
                     </c>
                     <c ca="left">
                        <p>GCGGAGCTGTAATGAAATG</p>
                     </c>
                     <c ca="left">
                        <p>52.9</p>
                     </c>
                     <c ca="left">
                        <p>793</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1398R</p>
                     </c>
                     <c ca="left">
                        <p>CAACCAACGTATTGTAGCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1400F</p>
                     </c>
                     <c ca="left">
                        <p>ATAGGTCTGTGTAACCCG</p>
                     </c>
                     <c ca="left">
                        <p>52.3</p>
                     </c>
                     <c ca="left">
                        <p>1964</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1401R</p>
                     </c>
                     <c ca="left">
                        <p>GGTAAAGCTGCGATGAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0085F</p>
                     </c>
                     <c ca="left">
                        <p>TGCTCGCTGCTATCTAC</p>
                     </c>
                     <c ca="left">
                        <p>53.0</p>
                     </c>
                     <c ca="left">
                        <p>1160</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0085R</p>
                     </c>
                     <c ca="left">
                        <p>CGTTAAATACGCCAGTTGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0220F</p>
                     </c>
                     <c ca="left">
                        <p>CCCTCAAGTGATTGATCC</p>
                     </c>
                     <c ca="left">
                        <p>53.0</p>
                     </c>
                     <c ca="left">
                        <p>1878</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP0220R</p>
                     </c>
                     <c ca="left">
                        <p>AAGATAGCCCCTTGTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1399F</p>
                     </c>
                     <c ca="left">
                        <p>CATCTCTTGCTCTTGGAG</p>
                     </c>
                     <c ca="left">
                        <p>51.0</p>
                     </c>
                     <c ca="left">
                        <p>1312</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1400R</p>
                     </c>
                     <c ca="left">
                        <p>TGAGGTCTACAATGAGTCAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1415F</p>
                     </c>
                     <c ca="left">
                        <p>CGCAATTAAAGGCAGTACG</p>
                     </c>
                     <c ca="left">
                        <p>51.0</p>
                     </c>
                     <c ca="left">
                        <p>2274</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1416R</p>
                     </c>
                     <c ca="left">
                        <p>GACTGAATAAGAGTGCTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1556F</p>
                     </c>
                     <c ca="left">
                        <p>TCCCGATTGTAAGTTGC</p>
                     </c>
                     <c ca="left">
                        <p>53.0</p>
                     </c>
                     <c ca="left">
                        <p>1957</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VP1558R</p>
                     </c>
                     <c ca="left">
                        <p>AGCTAATGCGAATGAGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0446F</p>
                     </c>
                     <c ca="left">
                        <p>ACGTTCTTTTGGGATGG</p>
                     </c>
                     <c ca="left">
                        <p>53.0</p>
                     </c>
                     <c ca="left">
                        <p>2376</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0447R</p>
                     </c>
                     <c ca="left">
                        <p>ACCGAAGCCTTAACACG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0450F</p>
                     </c>
                     <c ca="left">
                        <p>AATGCGAAAGAAGGCGATAC</p>
                     </c>
                     <c ca="left">
                        <p>60.0</p>
                     </c>
                     <c ca="left">
                        <p>1337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0450R</p>
                     </c>
                     <c ca="left">
                        <p>TGCGCTTGTAGATGAGTTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0891F</p>
                     </c>
                     <c ca="left">
                        <p>GTCGCTCTTTATGTTGC</p>
                     </c>
                     <c ca="left">
                        <p>50.5</p>
                     </c>
                     <c ca="left">
                        <p>615</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0891R</p>
                     </c>
                     <c ca="left">
                        <p>GAAGCCTGTATCAACTGTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0894F</p>
                     </c>
                     <c ca="left">
                        <p>TAATGGTCGATGCACTG</p>
                     </c>
                     <c ca="left">
                        <p>54.0</p>
                     </c>
                     <c ca="left">
                        <p>1215</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0894R</p>
                     </c>
                     <c ca="left">
                        <p>GGATGAGCAAGTCAGTAGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0952F</p>
                     </c>
                     <c ca="left">
                        <p>CGAGTGATCCAGTTTTACAC</p>
                     </c>
                     <c ca="left">
                        <p>52.0</p>
                     </c>
                     <c ca="left">
                        <p>2720</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0953R</p>
                     </c>
                     <c ca="left">
                        <p>AACTACCAGCTAGAAGTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0992F</p>
                     </c>
                     <c ca="left">
                        <p>CCGACATAAAGGGATACTC</p>
                     </c>
                     <c ca="left">
                        <p>52.0</p>
                     </c>
                     <c ca="left">
                        <p>1926</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA0992R</p>
                     </c>
                     <c ca="left">
                        <p>GAAGAAGCACTTGCTCTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1443F</p>
                     </c>
                     <c ca="left">
                        <p>CAATCAGCAGCCAGTCGTTA</p>
                     </c>
                     <c ca="left">
                        <p>60.0</p>
                     </c>
                     <c ca="left">
                        <p>1233</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1443R</p>
                     </c>
                     <c ca="left">
                        <p>CCGGATGTCAAACGGTACTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1503F</p>
                     </c>
                     <c ca="left">
                        <p>GTTCGACAATGGCATGTGAG</p>
                     </c>
                     <c ca="left">
                        <p>60.0</p>
                     </c>
                     <c ca="left">
                        <p>801</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1503R</p>
                     </c>
                     <c ca="left">
                        <p>CGCCAGTATCGACATCACTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1655F</p>
                     </c>
                     <c ca="left">
                        <p>CCGTTTTGCTGATGCTACTG</p>
                     </c>
                     <c ca="left">
                        <p>60.0</p>
                     </c>
                     <c ca="left">
                        <p>816</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPA1655R</p>
                     </c>
                     <c ca="left">
                        <p>ATGACCACAGTTCCGGAGAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPGyrBF</p>
                     </c>
                     <c ca="left">
                        <p>GTA CTG AAG GGT CTG GAT GC</p>
                     </c>
                     <c ca="left">
                        <p>54.6</p>
                     </c>
                     <c ca="left">
                        <p>742</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPGyrBR</p>
                     </c>
                     <c ca="left">
                        <p>ACT GCA TTG CCA CTT CTA CC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPmdhF</p>
                     </c>
                     <c ca="left">
                        <p>TGAAAGTAGCCGTTATTGG</p>
                     </c>
                     <c ca="left">
                        <p>54.0</p>
                     </c>
                     <c ca="left">
                        <p>901</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPmdhR</p>
                     </c>
                     <c ca="left">
                        <p>CCATTTAGCGTTTCTAGCATTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPGroEL1F</p>
                     </c>
                     <c ca="left">
                        <p>TTTCGGTGCTCCAACCATC</p>
                     </c>
                     <c ca="left">
                        <p>55.4</p>
                     </c>
                     <c ca="left">
                        <p>737</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>VPGroEL1R</p>
                     </c>
                     <c ca="left">
                        <p>GCATTGCTTTACGACGGTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Evolutionary relationships of <it>V. parahaemolyticus </it>isolates based on the concatenated housekeeping gene tree</p>
               </caption>
               <text>
                  <p><b>Evolutionary relationships of <it>V. parahaemolyticus </it>isolates based on the concatenated housekeeping gene tree.</b> Phylogenetic trees were constructed using the neighbor-joining method based on the based on Kimura 2-parameter distance using MEGA-3. The plus and minus signs represent the presence and absence of VPaIs among our collection of isolates.</p>
               </text>
               <graphic file="1471-2180-8-110-2"/>
            </fig>
            <p>Molecular analysis of the distribution of VPaI-3 found that the region is present in 25 <it>V. parahaemolyticus </it>isolates, which included the same set of isolates that contain VPaI-1, VPaI-2, and VPaI-4 to VPaI-6 (O3:K6 and related isolates recovered after 1995) (Fig. <figr fid="F2">2</figr>). One exception was noted, KE10462, an O3:K6 isolate recovered in Japan in 1986. In addition, in two O3:K6 pre-1995 isolates, KE9967 and U-5474, the VPaI-3 region was found to be partially present, suggesting that this region is unstable and has been deleted from these isolates. VPaI-3 contains several transcriptional regulators, hypothetical proteins and a methyl accepting chemotaxis protein.</p>
            <p>VPaI-7, an 81 kb region present on chromosome 2, encodes T3SS-2, two copies of the <it>tdh </it>gene, a cytotoxic necrotizing factor, an exoenzyme T gene and five transposase genes <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. T3SS-2 in <it>V. parahaemolyticus </it>showed similarity to a T3SS present in several pathogenic <it>V. cholerae </it>non-O1 and non-O139 isolates <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B51">51</abbr></abbrgrp>. To determine the distribution of VPaI-7, we used 12 primer pairs spanning the 81 kb region (Table <tblr tid="T2">2</tblr>). Of the 42 <it>V. parahaemolyticus </it>isolates examined, 30 isolates were found to contain the entire VPaI-7 region. Similar to the VPaI-2 and VPaI-3 regions, the 30 VPaI-7-positive isolates included all 24 highly virulent isolates as well as 3 O3:K6 strains isolated pre-1995, strains KE9967, U-5474, and ATCC43996 (Fig. <figr fid="F2">2</figr>). The region was present in three O4 serogroup isolates, 1324, an O4:K6, and two Spanish isolates, 30824 and 428/00 (Fig. <figr fid="F2">2</figr>). Although, T3SS-2 was previously reported to be present only in the highly virulent strain, this appears not to be the case as others have found <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. This region was partially present in 6 isolates (Fig. <figr fid="F2">2</figr>). A primer pair designed within VPA1308/VPA1309, and a primer pair within and VPA1400/VPA1401 all gave a positive PCR product with all strains examined indicating that these genes represent core chromosomal flanking genes.</p>
            <p>We examined 11 additional regions that were unique to <it>V. parahaemolyticus </it>for their distribution among our collection of isolates, all 11 regions were present in all the highly virulent isolates, in fact 3 regions were present in all strains examined (see Additional file <supplr sid="S5">5</supplr>). Five regions were absent from 1 to 3 isolates, which included the region that encodes T6SS that is absent from two pre-1995 O3:K6 strains. Three regions were absent from five isolates (see Additional file <supplr sid="S5">5</supplr>).</p>
            <suppl id="S5">
               <title>
                  <p>Additional file 5</p>
               </title>
               <text>
                  <p><b>Table S1.</b> PCR assays of the distribution of 11 regions unique to <it>V. parahaemolyticus</it>.</p>
               </text>
               <file name="1471-2180-8-110-S5.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>Evolutionary genetic relationships</p>
            </st>
            <p>To understand the evolutionary significance of the distribution of the VPaI regions among our collection of isolates, a phylogenetic frame work was constructed by multilocus sequence (MLS) analysis of an initial analysis of three housekeeping genes. MLS analysis was demonstrated in numerous studies to be a powerful method to both discriminate and determine the phylogenetic relationships among bacterial isolates including <it>Vibrio </it>species <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. We found similar to others that <it>V. parahaemolyticus </it>isolates are highly related sharing substantial sequence similarity at the three loci we examined <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B42">42</abbr></abbrgrp> (Fig. <figr fid="F2">2</figr>). Within the 1854 bps examined among the 42 isolates, there were a total of 39 polymorphic sites of which 21 sites were phylogenetically informative and 12 sequence types (ST) were found. For the purposes of this study, a phylogenetic tree was constructed by the neighbor-joining method using Kimura 2-parameter, which clustered the strains into two closely related but distinct groups named A and B (Fig. <figr fid="F2">2</figr>). The first group contains all highly virulent isolates whereas group B is comprised of mainly environmental isolates recovered in Spain in the early 2000s. Within group A are 25 isolates that are identical at all three loci examined; these isolates include 22 O3:K6 isolates with worldwide distribution recovered pre-1995 and post-1995, and 3 O1 serogroup isolates (O1:K25 and O1:KUT) recovered post-1995. O3:K6 and O1:K25 isolates recovered post-1995, and O3:K6 isolates recovered pre-1995 shared identical sequence profiles (Fig. <figr fid="F2">2</figr>). These data support the hypothesis that O1:K25 and O1:KUT serogroups arose from the O3:K6 highly virulent strain by acquisition of novel O and K antigens similar to the emergence of the pathogenic <it>V. cholerae </it>O139 serogroup strain from an O1 El Tor isolate. Acquisition of novel O and K antigens would be evolutionary advantageous since it may play a role in host immune avoidance in <it>V. parahaemolyticus </it>infection. Clustering with these O3:K6, O1:K25, O1:KUT isolates are four identical O4 serogroup isolates and KE10464, a divergent O3:K6 pre-1995 (Fig. <figr fid="F2">2</figr>). Thus, it appears that acquisition of novel O antigens is frequent in this species and more recent data suggests this is an ongoing event <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Also found within group A are several divergent O3:K6 pre-1995 and post-1995 isolates, and a single divergent O4:K8 post-1995, 1324 (Fig. <figr fid="F2">2</figr>). Group B consists of 5 isolates, with various serotype designations but all were recovered in Spain post-1995 (Fig. <figr fid="F2">2</figr>). Three of the strains were recovered from mollusks and sea sediment, and two strains 30824 and 428/00, which shared an identical ST, were from clinical sources. Overall, the phylogenetic tree constructed from concatenated sequences of three housekeeping genes indicates that pathogenic <it>V. parahaemolyticus </it>isolates are highly homologous as others have previously shown <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>.</p>
            <p>We mapped the distribution of each of the VPaI genomic islands onto the phylogenetic tree to elucidate the possible steps involved in the emergence of the globally distributed <it>V. parahaemolyticus </it>new highly virulent strain. We found that similar to VPaI-1, VPaI-4, VPaI-5 and VPaI-6, VPaI-2 and VPaI-3 are predominately present among the highly virulent isolates recovered after 1995 with only one exception noted for VPaI-2, strain ATCC43996 recovered in the UK in 1970, an O3:K4 serogroup (Fig. <figr fid="F2">2</figr>). The VPaI-3 region was present in two pre-1995 O3:K6 isolates, KE9967 and U5474 that have an identical sequence type, and in KE10462, which shows an identical sequence type to five additional pre-1995 and 16 post-1995 O3:K6 isolates. KE10462 also appears to have contained the VPaI-7 regions since it is partially present in this isolate (Fig. <figr fid="F2">2</figr>). KE10462 has been shown to be positive for group specific PCR (GS-PCR), which is based on the <it>toxRS </it>nucleotide sequence, that has previously been shown to differentiate post-1995 pandemic strains from non-pandemic and pre-1995 isolates <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B39">39</abbr></abbrgrp>.</p>
            <p>In conclusion, the most parsimonious scenario for the evolution of the new highly virulent O3:K6 clone suggests that a pre-1995 O3:K6 strain obtained regions VPaI-1 to VPI-7, and a T6SS encoded within ORFs VP1386&#8211;VP1420, this secretion systems along with T3SS-2 may explain the highly virulent nature of the O3:K6 virulent clone. It appears that <it>V. parahaemolyticus </it>isolates have the ability to acquire large regions of DNA and that this is an ongoing process among pathogenic isolates. For example, the O1 and K antigens, which are encoded in the same genomic region, are undergoing frequent change among closely related strains and this may be a mechanism to avoid the host immune system.</p>
            <p>The possible origins of the <it>V. parahaemolyticus </it>variable regions appear to be quite diverse. Blast analysis of the VPaI-1 encoded proteins found 7 ORFs highly homologous to a 22 Kb island present in <it>V. cholerae </it>strain 623&#8211;39 at the same tRNA-met insertion site, whereas a similar analysis of VPaI-3 showed high sequence similarity to a region in <it>V. harveyi </it>HY01 (AIQ_705 to AIQ_762). VPaI-2 encoded several ORFs with high similarity to ORFs identified in <it>Vibrio </it>sp Ex25. Most of VPaI-5 showed homology to ORFs from <it>Shewanella woodyi </it>and <it>Shewanella sp</it>, and similarly several ORFs of VPaI-6 were homologous to a region in <it>Shewanella </it>sp ANA-3. The T3SS-2 region encoded on island VPaI-2 is most closely related to a T3SS recently identified in <it>V. cholerae </it>V51, a non-O1 serogroup isolate <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. Region VP1386 to VP1420, which encodes a T6SS as well as a Rhs element, showed extensive homology to a region in <it>V. harveyi </it>ATCC BAA-1116.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bacterial isolates</p>
            </st>
            <p>A total of 42 <it>V. parahaemolyticus </it>isolates were examined in this study as previously described <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. The 42 isolates were temporally (1970 to 2003) and geographically widespread (Asia, Europe and South America) and encompassed 10 different serotypes. All <it>V. parahaemolyticus </it>isolates were grown in Luria-Bertani broth (LB) supplemented with 3% NaCl and stored at -70&#176;C in LB broth with 20% (v/v) glycerol.</p>
         </sec>
         <sec>
            <st>
               <p>Comparative bioinformatics analysis</p>
            </st>
            <p>We performed four-way BLAST analysis of <it>V. parahaemolyticus </it>RIMD2210633, an O3:K6 isolated in 1996, versus <it>V. vulnificus </it>YJ016, <it>V. vulnificus </it>CMCP6, <it>V. cholerae </it>N16961 and <it>V. fischeri </it>ES114 to identify regions that were unique to <it>V. parahaemolyticus</it>. Complete nucleotide sequences and annotations for the <it>V. parahaemolyticus </it>RIMD2210633, <it>V. vulnificus </it>YJ016, <it>V. vulnificus </it>CMCP6, <it>V. cholerae </it>N16961 and <it>V. fischeri </it>ES114 were retrieved and downloaded from NCBI <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B57">57</abbr><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr></abbrgrp>. These were used to construct a genome atlas of the complete genome sequence of all five isolates. The genome atlas plot maps DNA structure features, repeats, and base composition properties of <it>V. parahaemolyticus </it>as well as each gene present in RIMD2210633, and their homologues in all four additional species oriented at the <it>ori</it><abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. In addition, we constructed a zoomable genome atlas of the complete genome sequences of all 27 members of the family <it>Vibrionaceae </it>available in the database. This data can be interactively examined for chromosome 1 and for chromosome 2 on the web <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. We compared the genome of <it>V. parahaemolyticus </it>RIMD2210633 to the genome of <it>V. parahaemolyticus </it>AQ3810, an O3:K6 isolated in 1983, using the Artemis comparison tool (ACT) program <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Molecular analysis</p>
            </st>
            <p>Chromosomal DNA was extracted from each <it>V. parahaemolyticus </it>isolate using the G-nome DNA isolation kit from Bio 101. To determine the distribution of regions unique to <it>V. parahaemolyticus </it>among our collection of 41 isolates, PCR assays were performed. Primer pairs were designed to target within the regions of interest as well as flanking the regions (Table <tblr tid="T2">2</tblr>). PCR was performed in a 25 &#956;l reaction mixture with the following cycles: an initial denaturation step at 96&#176;C for 3 min followed by 30 cycles of denaturation at 94&#176;C for 30s, 30s of primer pair annealing at the respective temperature, an extension step at 72&#176;C for 1&#8211;4 min (depending on expected PCR product size). PCR primers to amplify three chromosomal housekeeping genes, gyrase subunit B (<it>gyr</it>B, VP0014), malate dehydrogenase (<it>mdh</it>, VP0325), and chaperonin (<it>groEL</it>-1, VP2851), were designed based on the sequence of <it>V. parahaemolyticus </it>RIMD2210633 (Table <tblr tid="T1">1</tblr>). The housekeeping genes were PCR amplified from chromosomal DNA isolated from all <it>V. parahaemolyticus </it>isolates and PCR products were purified using Jetquick PCR purification Kit (GENOMED). The <it>mdh, gyrB </it>and <it>groEL-1 </it>sequences were determined by MWG-Biotech based on the dye deoxy terminator method and the reaction products were separated and detected on an ABI PRISM 3100 genetic analyzer.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic analysis</p>
            </st>
            <p>The multiple sequence alignment program ClustalW was used to align nucleotide sequences for each housekeeping gene <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. Rates of synonymous substitutions/synonymous site (K<sub><it>S</it></sub>) were calculated by the methods of Nei and Gojobori and Nei and Lin <abbrgrp><abbr bid="B63">63</abbr><abbr bid="B64">64</abbr></abbrgrp>. To analyze the evolutionary relationships among <it>V. parahaemolyticus </it>isolates, the concatenated sequence of all three housekeeping genes was used to construct a Neighbour-Joining phylogenetic tree based on Kimura 2-parameter distance using MEGA-3 <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Nucleotide sequence accession no</p>
            </st>
            <p>The sequences of <it>mdh, gyrB </it>and <it>groEL-1 </it>were submitted to GenBank and given the accession numbers GenBank <ext-link ext-link-type="gen" ext-link-id="EU629305">EU629305</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU629345">EU629345</ext-link>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>T3SS: type III secretion systems; T6SS: type VI secretion system; VPaI: <it>Vibrio parahaemolyticus </it>genomic islands; TDH: thermostable direct hemolysin; KP: Kanagawa-phenomenon; TRH: TDH-related hemolysin; LPS: lipopolysaccaride; CPS: capsule polysaccharide (CPS).</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>ALC and LMN performed bacteriological, genetic and phylogenetic studies, helped with the experimental design and drafted the manuscript, OCS was involved in the genome sequencing, annotation and drafted the manuscript, TTB and DWU performed genome BLAST atlas analysis. MAP was involved in the experimental design and drafted the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We would like to thank those who kindly provided us with the <it>V. parahaemolyticus </it>strains used in this study. Special thanks to G. Balakrish Nair for his advice and AQ3810 and to John Heidelberg for sequencing AQ3810. This study was supported in part by the University of Delaware Research Foundation (UDRF2007-2008), the Department of Biological Sciences, University of Delaware, Newark, DE and Science Foundation Ireland graduate fellowships to ALC and LMN.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Vibrio parahaemolyticus and related halophilic Vibrios.</p>
            </title>
            <aug>
               <au>
                  <snm>Joseph</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Colwell</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Kaper</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>Crit Rev Microbiol</source>
            <pubdate>1982</pubdate>
            <volume>10</volume>
            <issue>1</issue>
            <fpage>77</fpage>
            <lpage>124</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.3109/10408418209113506</pubid>
                  <pubid idtype="pmpid">6756788</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Food-borne disease outbreaks due to bacteria in Taiwan, 1986 to 1995</p>
            </title>
            <aug>
               <au>
                  <snm>Pan</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>TK</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Chien</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Horng</snm>
                  <fnm>CB</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>35</volume>
            <issue>5</issue>
            <fpage>1260</fpage>
            <lpage>1262</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">232742</pubid>
                  <pubid idtype="pmpid" link="fulltext">9114420</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants.</p>
            </title>
            <aug>
               <au>
                  <snm>Nair</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Ramamurthy</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bhattacharya</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Dutta</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Takeda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sack</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Clin Microbiol Rev</source>
            <pubdate>2007</pubdate>
            <volume>20</volume>
            <fpage>39</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1797631</pubid>
                  <pubid idtype="pmpid" link="fulltext">17223622</pubid>
                  <pubid idtype="doi">10.1128/CMR.00025-06</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Isolation of vibrio parahaemolyticus from the Northwest Pacific</p>
            </title>
            <aug>
               <au>
                  <snm>Baross</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Liston</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1968</pubdate>
            <volume>217</volume>
            <issue>5135</issue>
            <fpage>1263</fpage>
            <lpage>1264</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/2171263a0</pubid>
                  <pubid idtype="pmpid">5643107</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Occurrence of Vibrio parahaemolyticus and related hemolytic vibrios in marine environments of Washington State</p>
            </title>
            <aug>
               <au>
                  <snm>Baross</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Liston</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Appl Microbiol</source>
            <pubdate>1970</pubdate>
            <volume>20</volume>
            <issue>2</issue>
            <fpage>179</fpage>
            <lpage>186</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">376896</pubid>
                  <pubid idtype="pmpid">4921057</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Vibrio parahaemolyticus infections in the United States, 1973-1998</p>
            </title>
            <aug>
               <au>
                  <snm>Daniels</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>MacKinnon</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bishop</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Altekruse</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ray</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Hammond</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bean</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Griffin</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Slutsker</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2000</pubdate>
            <volume>181</volume>
            <issue>5</issue>
            <fpage>1661</fpage>
            <lpage>1666</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/315459</pubid>
                  <pubid idtype="pmpid" link="fulltext">10823766</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Emergence of a new Vibrio parahaemolyticus serotype in raw oysters: A prevention quandary</p>
            </title>
            <aug>
               <au>
                  <snm>Daniels</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Ray</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Easton</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Marano</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kahn</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>McShan</snm>
                  <fnm>AL</fnm>
                  <suf>2nd</suf>
               </au>
               <au>
                  <snm>Del Rosario</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kingsley</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Puhr</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Angulo</snm>
                  <fnm>FJ</fnm>
               </au>
            </aug>
            <source>Jama</source>
            <pubdate>2000</pubdate>
            <volume>284</volume>
            <issue>12</issue>
            <fpage>1541</fpage>
            <lpage>1545</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1001/jama.284.12.1541</pubid>
                  <pubid idtype="pmpid" link="fulltext">11000648</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Vibrio vulnificus and V. parahaemolyticus necrotising fasciitis in fishermen visiting an estuarine tropical northern Australian location</p>
            </title>
            <aug>
               <au>
                  <snm>Ralph</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Currie</snm>
                  <fnm>BJ</fnm>
               </au>
            </aug>
            <source>J Infect</source>
            <pubdate>2007</pubdate>
            <volume>54</volume>
            <issue>3</issue>
            <fpage>e111</fpage>
            <lpage>4</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jinf.2006.06.015</pubid>
                  <pubid idtype="pmpid" link="fulltext">16890991</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Nucleotide sequence of the thermostable direct hemolysin gene of Vibrio parahaemolyticus</p>
            </title>
            <aug>
               <au>
                  <snm>Nishibuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kaper</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1985</pubdate>
            <volume>162</volume>
            <issue>2</issue>
            <fpage>558</fpage>
            <lpage>564</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">218884</pubid>
                  <pubid idtype="pmpid" link="fulltext">3988703</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Contribution of the tdh1 gene of Kanagawa phenomenon-positive Vibrio parahaemolyticus to production of extracellular thermostable direct hemolysin</p>
            </title>
            <aug>
               <au>
                  <snm>Nishibuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kumagai</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kaper</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>Microb Pathog</source>
            <pubdate>1991</pubdate>
            <volume>11</volume>
            <issue>6</issue>
            <fpage>453</fpage>
            <lpage>460</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0882-4010(91)90042-9</pubid>
                  <pubid idtype="pmpid">1795634</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Enterotoxigenicity of Vibrio parahaemolyticus with and without genes encoding thermostable direct hemolysin</p>
            </title>
            <aug>
               <au>
                  <snm>Nishibuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fasano</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Kaper</snm>
                  <fnm>JB</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1992</pubdate>
            <volume>60</volume>
            <fpage>3539</fpage>
         