The region encompassing the ssb gene, which is flanked by DR0098, the ribosomal protein S6 gene and DR0101, the ribosomal protein S18 gene, was PCR amplified from genomic DNA and sequenced (Fig. 1). The genomic DNA was derived from the Deinococcus radiodurans R1 type strain obtained directly from the ATCC (ATCC 13939). The ssb gene was also independently cloned into two different cloning vectors and re-sequenced. In each case, the sequence revealed two additional guanine nucleotides that are not present in the sequence deposited in the database of the National Center for Biotechnology Information (NCBI) (Fig. 1) 4. (The original submitted sequence has accession #AE000513. The current sequence has accession #NC_001263 and is identical to the original). With the corrections reported here, a contiguous ORF that encodes a complete ssb protein is revealed. A recognizable D. radiodurans ribosomal binding site (AAGGAG) exists at an optimal 8 nucleotides upstream of the initiation codon (Fig. 1) 8910. The corrected ssb sequence has been deposited with GenBank, accession number AY293617. The predicted D. radiodurans SSB protein is the largest bacterial SSB polypeptide identified to date (301 amino acids, including the initiating methionine), exceeding in length the T. thermophilus VK1 SSB by 35 amino acid residues.

The presence of a contiguous open reading frame encompassing the regions designated DR0099 and DR0100 was confirmed by PCR amplification of this region from genomic DNA, and cloning it into an E. coli expression vector. Excellent inducible expression of a protein of the predicted size was obtained from the pEAW328 vector (see Methods) (Fig. 2). This protein was purified and confirmed to be D. radiodurans SSB protein by N-terminal sequencing of the first nine amino acids (ARGMNHVYL). As expected, the N-terminal methionine residue was absent in the D. radiodurans SSB protein purified from E. coli. The calculated molecular weight of the purified D. radiodurans SSB protein monomer (300 amino acids without the initiating methionine) is 32,591. We estimate that the D. radiodurans SSB protein purified as described here is more than 99% homogeneous. Additionally, the purified D. radiodurans SSB protein was free of detectable DNA endo- and exonucleases.

The protein sequence predicted for D. radiodurans SSB protein shares 43% identity and 58% similarity with the T. thermophilus HB-8 SSB protein, 43% identity and 58% similarity with the T. thermophilus VK-1 SSB protein and 44% identity and 61% similarity with the T. aquaticus YT-1 SSB protein (Fig 3A and 3B). The N-terminal segment of the D. radiodurans SSB protein shares 38% identity and 49% similarity with the E. coli SSB protein. The C-terminal segment of the D. radiodurans SSB protein shares 39% identity and 64% similarity with the E. coli SSB protein.

Virtually all bacterial SSB proteins identified to date contain only one oligonucleotide/oligosaccharide-binding (OB) fold per monomer and function as homotetramers 1112. The very recently characterized T. thermophilus and T. aquaticus SSB proteins have broken that pattern, and contain 2 OB folds per monomer 711 and function as homodimers 7. In the formation of homodimers, T. thermophilus and T. aquaticus SSB proteins maintain the bacterial trend of 4 OB folds per SSB protein oligomer. The D. radiodurans SSB protein gene structure is quite similar to that of the T. thermophilus and T. aquaticus ssb gene structures and is predicted to contain two OB folds. The high similarity of the D. radiodurans SSB protein sequence to the Thermus SSB proteins (Fig 3) suggested that the D. radiodurans SSB protein would also form a homodimer. This prediction was confirmed (see below). The structure of the D. radiodurans SSB protein is consistent with and reinforces the close phylogenetic relationship between Deinococcus and bacteria of the Thermus group of extremophiles 2456.

Native molecular weight approximation by gel filtration analysis (Fig 4) and sedimentation equilibrium experiments confirmed our prediction that D. radiodurans SSB protein exists as a homodimer. In the gel filtration analysis, D. radiodurans SSB protein displayed a fractional retention (K_av) on a Sephacryl S-200 column of 0.21. E. coli SSB protein, ran for comparison, displayed a K_av of 0.18. Using a standard molecular weight curve generated for the column, these values correspond to 85 kDa and 101 kDa respectively. The native molecular weight approximation for D. radiodurans SSB protein is 2.6 times the molecular weight of a D. radiodurans SSB monomer (32.6 kDa), or 1.3 times that predicted for a D. radiodurans SSB homodimer (65 kDa). The native molecular weight approximation for E. coli SSB protein under these conditions is 5.4 times that of the molecular weight of an E. coli SSB monomer (18.8 kDa), or 1.3 times that of an E. coli SSB homotetramer (75 kDa). E. coli SSB protein is known to form a homotetramer in solution 1314. Given the aberrant chromatographic behavior of the native E. coli SSB homotetramer, the apparently similar behavior of the native D. radiodurans SSB is most consistent with a homodimer. Due to the high sequence identity and similarity of the OB folds between E. coli SSB protein and D. radiodurans SSB protein, we anticipate that the proteins will have similar properties. In the experiment of Fig. 4, both proteins chromatograph with an apparent mass corresponding to 1.3 times that of their calculated molecular weight, assuming the D. radiodurans SSB is a homodimer and the E. coli SSB is a homotetramer.

The sedimentation equilibrium data were best described as a single species. There was no evidence for multiple species and modeling attempts using associations or simple mixtures did not yield physically realistic parameters for some fitting variables. The results of global fitting of the all data at absorbance less than 2 gave a molecular weight of 63,300 ± 70, in excellent agreement with the value of 65,183 for a dimer based on the sequence. In fact an increase in the calculated partial specific volume of only 0.008 would yield perfect agreement.

Since sedimentation equilibrium shows the protein to be a homogeneous population of dimers, the results from column chromatography would suggest that the shape of the molecule deviates from that of the globular standards.

The C-terminus of SSB has special functional significance. Although the length and the sequence of the C-terminal regions (the region extending past the OB fold(s)) is variable across bacterial species, the last 10 amino acids at the C-terminus are highly acidic and well conserved across bacterial species 3. An acidic C-terminus is also seen in the D. radiodurans SSB protein C-terminal tail (Fig 3). Studies of E. coli SSB C-terminal truncation mutants have indicated that the last 10 amino acids of E. coli SSB protein is essential for cell survival and is probably involved in protein-protein interactions 15. This may be of functional significance to the D. radiodurans SSB. As a homodimer, SSB_Dr contains 4 OB folds, similar to the E. coli SSB homotetramer. However, the same D. radiodurans SSB homodimer contains only two C-terminal regions whereas the E. coli SSB homotetramer contains four.

In vitro analyses of the E. coli SSB protein showed that the C-terminal third of the protein is not needed for tetramer formation or DNA binding and that the last 10 amino acids, containing the highly conserved acidic region, actually weakens the binding of E. coli SSB homotetramer to nucleic acids 15. The authors of this study conclude that the amino acid sequence contained between the OB fold and the highly acidic 10 amino acid tail acts purely as a spacer to shield the negative charges of the C-terminus from the bound DNA on the SSB protein 15. In support of this idea, a crystal structure of E. coli SSB protein, in the absence of DNA, suggests that the C-terminal region (the region not involved in the OB fold) protrudes from the tetramer and that each of the four C-terminal regions take on different conformations 16.

We speculate that the acidic terminus of the D. radiodurans SSB protein is also important for in vivo protein-protein interactions, but that there may be some interesting functional differences reflecting the reduced number of C-terminal regions in the D. radiodurans SSB oligomer compared to that of E. coli and other bacterial SSB oligomers. Further studies involving the D. radiodurans SSB C-terminus will help to further understand the role of the spacer and acidic tail regions of bacterial SSB proteins.

Single-stranded DNA binding proteins, in general, help stimulate recombinase promoted in vitro DNA strand exchange reactions. The E. coli system has been most intensely studied and E. coli SSB protein has been shown to have both pre-synaptic and post-synaptic roles in E. coli RecA protein-promoted DNA strand exchange reactions 1718. The addition of E. coli SSB during the presynaptic formation of RecA filaments helps to remove ssDNA secondary structure, allowing formation of contiguous RecA filaments 17. Post-synaptically, E. coli SSB facilitates the recombination reaction by binding the displaced ssDNA and preventing the reversal of the strand exchange reaction 18.

The SSB proteins from different organisms have frequently been interchanged and found to stimulate the reactions of recombinases from other organisms 192021. These observations suggest that there is little species-specific protein-protein interaction. The E. coli SSB protein greatly stimulates the D. radiodurans RecA protein-promoted DNA strand exchange reaction 22, and in fact an SSB protein is required to observe significant reaction. We have now found that the D. radiodurans SSB protein stimulates the DNA strand exchange reactions promoted by both RecA_Dr and the E. coli RecA_Ec (Fig. 5). In the reactions promoted by both D. radiodurans RecA protein (Fig 5 Panels A, B and C) and the E. coli RecA protein (Figure 5 Panel D), less than half as much D. radiodurans SSB protein was needed to generate a yield of nicked circular product equal to that seen in the reactions with E. coli SSB under the same conditions. The reduced requirement for the D. radiodurans SSB is again consistent with the formation of a D. radiodurans SSB homodimer (Fig 5). Since the D. radiodurans SSB forms a homodimer (with 4 total OB folds) and E. coli SSB forms a homotetramer (with 4 total OB folds), the concentration of SSB_Dr should be multiplied by a factor of 2 to provide an SSB_Dr-SSB_Ec comparison that reflects equal numbers of OB folds (see dashed line in Fig. 5, panels C and D).

Note that the maximum product generation is slightly different for the D. radiodurans and E. coli RecA protein-promoted reactions. The optimal conditions are slightly different for the two recombinases, and the conditions used in these reactions were those optimal for the E. coli RecA protein.

The Deinococcus radiodurans R1 type strain was obtained directly from the American Type Culture Collection (ATCC 13939).

Genomic DNA was purified from Deinococcus radiodurans R1 type strain cells using the following protocol. TGY media (5% tryptone, 3% yeast extract, 1% glucose) was used in a 5 mL overnight 30°C culture growth. The cells were pelleted and resuspended in 2 mL suspension buffer (10 mM Tris-HCl (pH 8.0), 1 mM Na-EDTA, 0.35 M sucrose). Lysozyme (2 mg) was added and the suspension was incubated for 4 hours at 37°C. Lysis buffer (3 ml; 100 mM Tris-HCl (pH 8.0), 0.3 M NaCl, 20 mM EDTA, and 2% (w/v) SDS, with 2% (v/v) β-mercaptoethanol added just before use) was added to lyse the cells. The suspension was extracted with equal volumes of TE saturated phenol once, then once with 25:24:1 phenol/chloroform/isoamyl alcohol and then once with 24:1 chloroform/isoamyl alcohol. The non-aqueous layer was removed, and the DNA was ethanol precipitated. The dry DNA pellet was dissolved in 200 μl TE, and 1 μl was used in subsequent PCR amplifications.

The sequence of the ssb gene was checked in three independent analyses using different PCR primers and sequencing primers. In a direct approach, primers starting in the flanking DR0098 ribosomal protein S6 gene (5' CATCAAGGCTTCGGGCAAC 3') and the DR0101 ribosomal protein S18 gene (5' TTGCGTTCGCCGCTGTTTCC 3') were used to PCR amplify the ssb gene and flanking regions. Sequencing primers were used to directly sequence this PCR fragment with a 2–4-fold coverage. In addition to this direct approach, the ssb gene was independently PCR amplified and inserted into two separate plasmids, pRAD1 (obtained as a gift from Mary E. Lidstrom) 9 and pET21A (Novagen) and sequenced from these plasmids. The first clone, with the ssb gene inserted between the XhoI and HindIII cloning sites of vector pRAD1, used the PCR forward primer containing the XhoI site (underlined) (5' CTACCG

CTCGAG

AAGCTT

CATATG

GAATTC

Standard BLAST pair wise analysis (Blosum62 matrix at default settings) of the protein sequences was used to calculate percent identity and similarity values between proteins. ClustalX was used to generate the multiple sequence alignments.

As described above, the D. radiodurans ssb gene PCR product was inserted into the EcoRI and the NdeI cloning sites of pET21A (Novagen) to yield construct pEAW328. The ssb gene in this construct did not contain a histidine tag or any modification that would lead to a translation product that would differ from that encoded by the chromosomal D. radiodurans ssb gene. Construct pEAW328 was transformed into BL21 Codon Plus (DE3) (Stratagene) E. coli cells. These cells were grown in LB broth in the presence of 100 μg/ml of ampicillin and 25 μg/ml of chloramphenicol at 35°C to an optical density at 600 nm of 0.8. The cells were then induced with 0.4 mM IPTG and grown at 35°C for three more hours before harvest. Harvested cells were resuspended in Buffer A (25 mM Tris-HCl, pH 8.3, 12% w/v glycerol, 0.5 mM EDTA) with the buffer addition corresponding to five times the cell volume. Lysozyme was added to a final concentration of 0.2 mg/ml. Cells were stirred at 4°C for 1 hour and then sonicated on ice. All subsequent purification steps were performed at 4°C. Cell debris and insoluble material were removed by 3 successive 20 min centrifugations at 38,000 g with insoluble material being removed between centrifugations. Solid NaCl was then dissolved in the supernatant to a concentration of 0.18 M NaCl. DNA and proteins were precipitated by drop-by-drop addition of 10% (w/v) polyethylenimine, pH 7.5, with constant stirring to a final concentration of 0.4% (w/v) polyethylenimine. The solution was stirred for 15–60 minutes and then centrifuged for 15 min at 10,000 g. The SSB protein remained in the pellet at this point and was eluted from the pellet with Buffer B (25 mM Tris-HCl, pH 8.3, 0.4 M NaCl, 12% w/v glycerol, 0.5 mM EDTA, 1 mM β-mercaptoethanol) in a volume equal to the volume initially used to resuspend the cells. The polyethylenimine pellet was broken up and resuspended using a plastic spatula and then a glass homogenizer or small mortar and pestle. This suspension was stirred for 30 min and then centrifuged for 15 min at 10,000 g. The SSB was found in the supernatant. Solid Ammonium Sulfate was slowly added to the supernatant while stirring over the course of 30 minutes to a 30% saturation of the solution. This solution was allowed to continue stirring for approximately 3 hours and the precipitated proteins, including much of the SSB, were collected by centrifugation at 10,000 g for 20 min. The Ammonium Sulfate pellet was dissolved in TGE Buffer (50 mM Tris-HCl, pH 8.3, 20% w/v glycerol, 1 mM EDTA, 1 mM β-mercaptoethanol) with gentle stirring at a volume ~65% of the initial volume used to resuspend the cells. The resuspended solution was centrifuged for 20 min at 30,000 g to remove non-dissolved proteins. The supernatant was dialyzed against TGE Buffer. Following dialysis, the solution was cleared of precipitate by a 5 min centrifugation at 3,800 g and the supernatant was dialyzed against P (20 mM) buffer (20 mM potassium phosphate, pH 7.5, 10% (w/v) glycerol, 0.1 mM EDTA, 1 mM β-mercaptoethanol). Again the solution was cleared by centrifugation following dialysis. A hydroxyapatite column (Bio-Rad) was pre-equilibrated with P (20 mM). EDTA was not used in buffers applied to the column other than the EDTA contained in the load volume. The hydroxyapatite bed volume used and found adequate was 110% of the initial volume used to resuspend the cells. The dialyzed protein was loaded on the column and eluted over a 10 column volume linear gradient going from Buffer P (20 mM) to Buffer P (152 mM, i.e. 152 mM potassium phosphate, pH 7.5, 10% (w/v) glycerol, 1 mM β-mercaptoethanol). The SSB completed elution approximately half way through the linear gradient. Fractions containing mostly SSB and some very minor degradation bands by SDS-PAGE were pooled and dialyzed against TGE Buffer. The dialyzed protein was then loaded onto a DEAE Sepharose (Amersham Pharmacia Biotech) column (bed volume of 110% of the initial volume used to resuspend the cells was found adequate) and eluted in a 10 column volume linear gradient of TGE Buffer going from 0.0 M NaCl to 0.3 M NaCl. Degraded protein eluted before the pure SSB protein eluted. Elution was complete at about half way through the gradient. Fractions containing pure SSB protein were pooled and dialyzed into storage buffer (20 mM Tris-HCl, pH 8.3, 0.5 M NaCl, 50% (w/v) glycerol, 1 mM EDTA, 1 mM β-mercaptoethanol), aliquotted, snap frozen in liquid nitrogen, and stored at -80°C.

The extinction coefficient for the D. radiodurans SSB protein was determined as described previously 2324. Eleven determinations at three different concentrations of D. radiodurans SSB protein gave an average extinction coefficient of ε₂₈₀ = (4.1 ± 0.2) × 10⁴ M^-1cm^-1. The N-terminal sequence analysis was performed by the Protein and Nucleic Acid Chemistry Laboratories, Department of Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, Mo., without the laboratory personnel knowing the identity of the protein.

The native molecular weight of D. radiodurans SSB was approximated by gel filtration FPLC. A Sephacryl S-200 HR column (31.4 cm × 1.0 cm) was used at a flow rate of 0.05 ml/min. The buffer in all experiments was 50 mM Tris-HCl, pH 7.5, 100 mM KCl, as recommended by Sigma for the protein standards. Chromatography was performed at 4°C while A₂₈₀ was measured. The column was calibrated using Sigma Gel Filtration Molecular Weight Markers: blue dextran (2,000 kDa), beta-amylase (200 kDa), alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa), carbonic anhydrase (29 kDa), and cytochrome c (12.4 kDa). The standards were loaded independently at the concentrations recommended by Sigma in 100 μl sample volumes. Approximately 70 μg of E. coli SSB protein (18.8 kDa per monomer) and 200 μg of D. radiodurans SSB protein (32.6 kDa per monomer) were independently loaded on the column in 100 μl sample volumes. Standards and SSB loads were dissolved or dialyzed respectively into the recommended buffer plus 5% (w/v) glycerol. The elution volume of blue dextran determined the void volume (V_o), and the total volume (V_t) was determined by volume measurements of the column before packing and measurement of the column tubing used. The peak elution volumes (V_e) were calculated from the chromatogram and fractional retentions, K_av, were calculated using the equation: K_av = (V_e - V_o)/(V_t - V_o). A standard curve was determined by plotting the K_av of the protein standards against the log₁₀M_r of the standards. The native molecular weight of D. radiodurans SSB protein was approximated by comparing its K_av value to the standard curve. The native molecular weight of E. coli SSB protein was determined for comparison in like manner. E. coli SSB protein was purified as previously described 25, and an extinction coefficient of 2.38 × 10⁴ M^-1cm^-1 was used to calculate the concentration of E. coli SSB.

To prepare samples for sedimentation equilibrium a 1 mL D. radiodurans SSB 157 μM protein sample (in 35 mM Tris-HCl (pH 7.7), 25% w/v glycerol, 300 mM NaCl, 1 mM EDTA, 0.5 mM β-mercaptoethanol, 1 mM EDTA buffer) was dialyzed for 1 hour at 4°C against 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA dialysis buffer, and then again against 2 L of fresh dialysis buffer overnight at 4°C. The protein concentration of the resulting sample was 80.4 μM. The final dialysate was used to dilute aliquots of this stock to concentrations of 4.67 μM, 12.4 μM and 20.4 μM.

100 μL of each sample was placed in 12 mm double-sector charcoal-filled Epon centerpieces with about 105 μL of the final dialysate as reference. Centrifugation was performed at 4°C in a Beckman model XL-A analytical ultracentrifuge. The protein gradients were recorded at 280 nm every 2–3 hours until they became superimposable. Data were collected at six speeds (5200, 8200, 11000, 14000, 16500, 18500 rpm). With the various speeds and starting concentrations, absorbance in the gradients ranged from ~0 to >2.8, which corresponds to ~0 to >60 μM protein. Baseline absorbances were measured for each sample after high speed depletion and was less than 0.03 in all cases and was subtracted prior to curvefittings. The partial specific volume was calculated from the composition as 0.722 mL/gm. The dialysate density was measured as 1.007518 gm/mL at 4°C using an Anton Paar DMA5000 density meter.

The data from the three samples at six speeds were globally tested against models of a single species, two noninteracting species and two species in equilibrium. Programs for analysis were written in Igor Pro (Wavemetrics Inc., Lake Oswego, OR) by Darrell R. McCaslin.