Forty six isolates were obtained after anaerobic culture of the vaginal fluid from the 8 women in the cloning part of the study. Twenty nine isolates, belonging to the species Bacteroides ureolyticus, Enterococcus faecalis, Lactobacillus crispatus, L. jensenii, L. gasseri, L. vaginalis, Peptoniphilus sp., Prevotella bivia, Streptococcus anginosus group and S. mitis group were identified by tDNA-PCR using a library containing tDNA-PCR fingerprints of well-identified strains. Six isolates belonging to the species Aerococcus christensenii, Anaerococcus tetradius, Anaerococcus vaginalis, Lactobacillus iners, Mobiluncus mulieris and Peptostreptococcus anaerobius were identified by sequencing because they produced a tDNA pattern that initially was not present in the database. These species were characterized by a specific tDNA-PCR pattern that allowed unambiguous identification after the new patterns were added to the database. In summary, 40 of 46 isolates (87.0%) were correctly identified by tDNA-PCR to the species level, including the species within the L. acidophilus complex. Of the six isolates that could not be identified, one isolate, with a sequence that was 99% identical to that of a Peptostreptococcus sp. strain (CCUG 42997, AJ277208), could not be identified unambiguously by tDNA-PCR because its pattern was identical to that of P. micros, one isolate – that was identified by sequencing as Atopobium vaginae – did not yield a tDNA-pattern and another four isolates (8.7%) were tDNA-PCR negative and also 16S PCR negative.

The ARDRA pattern of 854 clones was analysed and enabled to establish the relative frequency of the different species present (Table 1). For 130 clones, belonging to 33 ARDRA types, on average 447 bp of the 5' end of the 16S rRNA gene was sequenced. In case of grade I vaginal smears, the most predominant species were L. crispatus and L. gasseri. Smaller numbers of L. jensenii and L. vaginalis were also present. All females with grade I smears (W1-W3) were colonized by two Lactobacillus species. W2 (age 34) and W3 (age 38) were colonized by Lactobacillus species only, with one species – respectively L. gasseri and L. crispatus – represented by more than 99% of the clones. In the vaginal fluid of W1 (age 51) the most abundant species were L. crispatus (66.1%), L. gasseri (18.6%) and Fusobacterium nucleatum (6.5%). An additional 8 species were found in low numbers, six only by cloning and one only by culture. Three of these species, representing 5.6% of the clones, showed less than 98% similarity with previously published sequences. Culture results coincided largely with cloning for the grade I samples, except for the non Lactobacillus species of W1 of which only two were cultured.

For the two grade II smears (W4 and W5) cloning revealed four species, A. vaginae (resp. 1.5% and 41.6%), L. iners (resp. 84.1% and 1.4%), a P. bivia-like species (resp. 7.3% and 22.2%) and Sneathia sanguinegens (both 1.4%), that were present in both samples. P. bivia was also present in both grade II microflora but it was found by culture only. Several other species were found by cloning only in either W4 or W5. For example, [Leptotrichia amnionii] was found only in W5. G. vaginalis and Peptostreptococcus anaerobius were found respectively in W4 and W5 by culture only and two species, Anaerococcus vaginalis and Enterococcus faecalis, were found by both cloning and culture in the microflora of W5.

Two women (W6 and W7) with a grade III vaginal smear were colonized predominantly by A. vaginae (resp. 36.0 and 80.5%), L. iners (absent and 12.4%), G. vaginalis (absent and 4.1%), M. mulieris (5.6 and 3.0%) and a Prevotella buccalis-like species (31.2% and absent), according to cloning. As for grade II samples, there was limited correspondence with culture. For W6, an A. vaginae-like organism was cultured, but the sequence of this isolate showed less than 98% similarity to the sequence of the clones. Furthermore, a large number of colonies of G. vaginalis and Peptoniphilus sp. were present after anaerobic culture but no clones were obtained.

The most abundant species obtained by cloning the third grade III vaginal sample (W8) were Peptostreptococcus anaerobius (68.6%)(also cultured), Peptoniphilus sp. (14.3%) and an unidentified Streptococcus sp. (8.6%)(also cultured).

Of the 38 species, 18 were discovered by cloning only, 5 by culture only, and 8 by both cloning and culture. Three species were shown by both culture and cloning in some samples, but only by culture in the remaining samples, another three species were shown by both cloning and culture in some samples, but only by cloning in the remaining samples and one species was found once by culture only and once by cloning only. The presence of all four grade I Lactobacillus sp. was shown in grade I samples by both cloning and culture, whereas L. iners was found only in three non-grade I samples, in all three by cloning – even abundantly in W4, but only in W7 by culture. G. vaginalis was cultured three times, but was found by cloning only once. A. vaginae was shown in four samples by cloning, but cultured only once. The P. bivia-like species and P. buccalis-like species were found in respectively two and three samples by cloning but not by culture.

Of the 38 species that were distinguished by culture and cloning in this study, only 76.3% demonstrated more than 98% identity with previously known bacterial species (Table 1). Five of the eight vaginal samples contained previously unidentified species.

Anaerobic culture of the microflora of W6 revealed an Atopobium species that showed only 97.6% similarity with previously reported A. vaginae sequences (see below).

Two presumptively novel species within the genus Prevotella were found. For W4 and W5 (grade II), respectively 7.3% and 22.2% of the clones had 91% similarity with a P. bivia sequence. For W1 (grade I), W5 and W6 (grade III), respectively 1.6%, 22.2% and 31.2% of the clones showed 96.6% similarity with a P. buccalis sequence. Respectively 2.9% and 0.8% of the clones of W4 (grade II) and W6 (grade III) were identical and had only 86% similarity with an uncultured termite Actinobacteridae bacterium (accession number AB089070).

Sixteen A. vaginae sequences are present in GenBank, one from a clinical isolate 18, one from the type strain 19 and 14 from cloned 16S rDNA fragments (Zhou, unpublished) (Figure 1). Another 17 sequences were obtained in this study, one from an isolate from patient W6, two from isolates from other patients (BVS38 and PB9) and 14 from clones from four different patients, i.e. W4 (grade II), W5 (II), W6 (III) and W7 (III) (Figure 1).

The sequence of all 7 clones from W5 was different from that of all other isolates and from the clones and the Genbank sequences, except from one Genbank clone sequence (AY269023). The sequence of all clones from the three other patients and from the two isolates from samples BVS38 and PB9 were identical to the previously published clinical isolate 18 and the type strain 19. The sequence of the cultured isolate from patient W6 was somewhat intermediate between both above sequences, although the sequence of the clones of the same patient were identical to that of the type strain. Specific amplification with both the ato167f primer and the ato154f primer gave positive signals for the vaginal sample of W6, indicating that indeed both types of sequence were present.

To substantiate the results obtained by cloning, an additional series of 142 vaginal samples obtained by swab from healthy pregnant (n = 115) and non-pregnant (n = 27) women, attending our out-patient clinic, were selected for culture and for PCR with 16S rRNA gene based primers specific for A. vaginae and G. vaginalis (Table 2). Of the 150 subjects in total, 38 (of which 5 non-pregnant) presented with non-grade I microflora, of which 26 were assigned grade II, 9 grade III and 3 grade IV.

After amplification with the ato167f A. vaginae primer set, respectively 19.6% of grade I, 34.6% of grade II, 77.8% of grade III and 0.0% of grade IV samples showed an amplicon (Table 2). Of the 37 samples that showed an amplicon after amplification with the ato167f primer only 23 were positive after amplification with ato154f. A. vaginae was cultured only three times from these 150 samples.

The number of positive samples for G. vaginalis specific PCR varied depending on the primer set that was used. The difference was greatest for grade I samples, with respectively 4.5% of grade I samples that were positive after amplification with the G_OY primer set and 28.6% with the G_Z primer set (Table 2).

Comparative ROC analysis of the four indicators (ato154f, ato167f, G_Z, and G_OY respectively) in discriminating normal and disturbed vaginal microflora showed that the overall discriminative value of qualitative PCR-based detection of A. vaginae or G. vaginalis as such is actually rather low with AUCs of 0.627 (95%CI: 0.544–0.704), 0.625 (95%CI: 0.543–0.703), 0.633 (95%CI: 0.551–0.711), and 0.675 (95%CI: 0.594–0.749).

Detection of the simultaneous presence of A. vaginae (ato167f) and G. vaginalis (G_OY) in a vaginal swab specimen with the purpose of assessing true bacterial vaginosis (grade III) had an accuracy of 87.8% (AUC = 0.878, 95%CI = 0.714, 1.041, p < 0.001), a sensitivity of 0.78 (95%CI = 0.40, 0.96), a specificity of 0.98 (95%CI = 0.91, 1.00), a positive predictive value of 0.78 (95%CI = 0.40, 0.96), and a negative predictive value of 0.98 (95%CI = 0.91, 1.00). When the co-existence of A. vaginae (ato167f) and G. vaginalis was assessed using the G_Z-primer set, the overall performance of the assay was significantly lower.

For a total of 150 healthy women of reproductive age, attending our out-patient clinic, of which 115 were pregnant, the health condition with regard to the composition of the vaginal bacterial community was assessed microscopically after Gram stain, according to the criteria of Hay and Ison 17 and vaginal samples were taken. Briefly, specimens were considered grade I (normal) when only Lactobacillus morphotypes were present, grade II (intermediate) when both Lactobacillus and other morphotypes were present, grade III (BV) when only non Lactobacillus morphotypes were seen and grade IV when only Gram positive cocci were seen.

Sampling was carried out as follows. After placement of a non-lubrificated speculum two sterile cotton swabs were inserted into the vaginal vault. The swabs were rotated against the vaginal wall at the midportion of the vault and were carefully removed to prevent contamination with the vulva and introitus microflora. One swab was returned to a sterile tube (dry swab) (Copan, Brescia, Italy), for the purpose of DNA-extraction. The other swab was placed into Amies transport medium (Nuova Aptaca, Canelli, Italy) and was used for making a smear for the purpose of grading according to the Hay and Ison criteria 17 and for anaerobic culture. Both swabs were processed in the microbiology laboratory within 4 h.

Based on smear results, eight non-pregnant women (mean age 41.4 years, range 28–51 years) from the studied population, attending our out-patient clinic for a routine gynaecological visit, were selected for cloning of the 16S rRNA genes present in the vaginal microflora. The culture results are reported only for these eight women.

To substantiate the results obtained by cloning and culture, PCR with species specific primers for A. vaginae and G. vaginalis and culture were carried out for the complete population.

For eight non-pregnant women, the swab on Amies transport medium was streaked onto tryptic soy agar supplemented with 5% sheep blood (Becton Dickinson, Franklin Lakes, NJ) and incubated anaerobically at 37°C upon arrival at the microbiology laboratory. After 4 days of incubation, all the isolates with different colony morphology were selected for identification. DNA was extracted by simple alkaline lysis: one colony was suspended in 20 μl of 0.25% sodium dodecyl sulfate-0.05 N NaOH, heated at 95°C for 15 min and diluted with 180 μl of distilled water. tDNA-PCR and capillary electrophoresis were carried out as described previously 411. The species to which each isolate belonged was determined by comparing the tDNA-PCR fingerprint obtained from each isolate with a library of tDNA-PCR fingerprints obtained from reference strains, using an in-house software program 11. The library of tDNA-PCR fingerprints and the software are available on request.

For DNA extraction from the dry vaginal swabs, the QIAamp DNA mini kit (Qiagen, Hilden, Germany) was used according to the manufacturer's recommendations, with minor modifications. The dry swab specimen from each patient was swirled for 15 s in 400 μl of lysis buffer (20 mM Tris-HCl, pH 8.0; 2 mM EDTA; 1.2% Triton). Fifty units of mutanolysin (25 U/μl) (Sigma, Bornem, Belgium) were added and the samples were incubated for 30 min at 37°C. After the addition of 20 μl Proteinase K (20 mg/ml) and 200 μl AL buffer (Qiagen), samples were incubated for 30 min at 56°C. Next, 200 μl of ethanol was added and DNA was purified by adding the lysate to the Qiagen columns as described by the manufacturer. Finally, the total bacterial DNA was eluted with 100 μl of AE buffer (Qiagen). DNA-extracts were stored at -20°C and were used for the purpose of cloning experiments and species specific PCR.

To amplify the 5' part of the bacterial 16S rRNA genes by PCR, primers 10f (5' AGTTTGATCCTGGCTCAG) and 534r (5' ATTACCGCGGCTGCTGG) 37, which target the domain Bacteria, were used. It should be noted that the forward primer contains mismatches for G. vaginalis at positions 1 (A/G), 5 (T/C) and 9 (C/T). A 50 μl PCR mixture contained 0.1 μM of each primer, 25 μl of Promega master mix (Promega, Madison, WI), 5 μl of DNA extract and distilled water. Thermal cycling consisted of an initial denaturation of 5 min at 94°C, followed by three cycles of 1 min at 94°C, 2 min at 50°C and 1 min at 72°C, followed by 35 cycles of 20 sec at 94°C, 1 min at 50°C and 1 min 72°C, with a final extension of 10 min at 72°C, and cooling to 10°C. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen). Cloning was done using the Qiagen PCR Cloning Kit (UA-cloning, Qiagen), whereby the purified amplicons were ligated into the pDrive cloning vector and transformed into Qiagen EZ Competent E. coli Cells, as specified by the manufacturer.

From each sample, 100 to 200 ampicillin-resistant transformants, recognizable as white colonies on Luria-Bertani (LB) agar containing IPTG (Roche, Basel, Switzerland), X-Gal (Roche) and 100 μg ampicillin/ml after overnight incubation at 37°C, were selected for further analysis. Single colonies were picked from the agar plates and transferred with sterile tips to the wells of a 96 well plate filled with LB Broth supplemented with 100 μg ampicillin/ml and incubated for 3 h. To avoid sequencing of all clones, the 16S rRNA gene inserts were differentiated initially from each other by means of Amplified rDNA Restriction Analysis (ARDRA)38. One μl of bacterial culture was added to a final volume of 20 μl PCR mix, containing 0.2 μM of two plasmid-targeted primers, QF (5'TACGTATCGGATCCAGAATTC) and QR (5'CGAGAAGCTTGTCGACGAATT), 10 μl of Promega master mix and distilled water. The position of primers QF and QR was chosen as such that their distance towards the insert was the same in order to result in the same ARDRA pattern regardless the orientation of the insert in the cloning vector. Cycling conditions were the same as described above for the 16S rRNA gene. Ten microliter of the amplified products were digested with 10 U of the restriction endonuclease BstUI in the appropriate enzyme buffer and incubated for 3 h at 60°C. The DNA restriction fragments were separated in a 2.5% agarose electrophoresis gel, containing 2% Methaphor (FMC Bioproducts, Rockland, ME) and 0.5% MP agarose (Roche, Basel, Switzerland) in the presence of ethidium bromide (50 ng/ml). The gels were photographed and the obtained ARDRA fingerprints were compared visually. For each ARDRA type, the 16S rRNA gene insert of at least one representative clone was sequenced, thus minimizing the number of sequence reactions that had to be carried out.

For 8 healthy women, the 16S rRNA gene was amplified and sequenced from selected clones and from cultured isolates that could not be identified by tDNA-PCR, using primers 10f and 534r, as described above. For the clones, 1 μl of the QF-QR amplified PCR product was diluted 1000 times with distilled water and re-amplification of the 16S rRNA gene was done with the primers 10f and 534r. For the cultured isolates, a 5 μl aliquot of the alkaline lysate was added to a 50 μl PCR mixture. The amplification products were then purified with the Qiaquick PCR purification kit, according to the manufacturer's instructions. Sequencing was done using the ABI Big Dye cycle sequencing reaction kit with AmpliTaq FS DNA polymerase (Applied Biosystems, Foster City, CA.) with primer 534r. Sequencing reaction products were analyzed on an ABI 310 genetic analyzer (Applied Biosystems). Inspection of the electropherograms was done with Chromas http://www.technelysium.com.au/chromas14x.html and with the BioEdit package 39. Comparison of the sequences of the inserts and isolates to the 16S rRNA gene sequences in GenBank was done using the BLAST software 40. Clones or isolates with DNA sequences sharing more than 98% identity with known sequences were assigned to that phylotype.

G. vaginalis species-specific primers as designed by Zariffard et al. (G_Z)26 and Obata-Yasuoka et al. (G_OY) 25 were used. Briefly, a 20 μl PCR mixture contained respectively 0.05 and 0.4 μM primers, 10 μl of Promega master mix (Promega, Madison, WI), 2 μl of Qiagen DNA-extract of the samples and distilled water. Thermal cycling with G_Z primers consisted of an initial denaturation of 10 min at 94°C, followed by 50 cycles of 5 s at 94°C, 45 s at 55°C and 45 s at 72°C, and a final extension of 10 min at 72°C. Thermal cycling with the G_OY primers was performed by an initial denaturation of 1 min at 94°C was followed by 40 cycles of 1 min at 94°C, 1 min at 60°C and 1 min at 70°C and a final extension of 7 min at 72°C. During the first ten cycles the annealing temperature was lowered by 0.5°C per cycle. Five microliter of the amplified product of each PCR was visualized on a 2% agarose gel.

Two primer sets that allowed amplification of the 16S rRNA gene of A. vaginae and that lacked homology with non-target bacteria as determined by searching the Gene Bank database using BLAST software 40, were designed. The selected primers, ato167f 5' (GCGAATATGGGAAAGCTCCG), ato154f 5' (ATATTTGTCGCATGGCGAAT) and ato587r 5' (GAGCGGATAGGGGTTGAGC), were analysed for secondary structures using NetPrimer (Premier Biosoft International, Palo Alto, CA). A 20 μl PCR mixture contained 0.2 μM of primers (respectively ato167f or ato154f and ato587r), 10 μl of Promega master mix (Promega, Madison, WI), 2 μl of Qiagen DNA-extract of the samples and distilled water. Thermal cycling consisted of an initial denaturation of 5 min at 94°C, followed by three cycles of 1 min at 94°C, 2 min at 58°C and 1 min at 72°C, followed by 35 cycles of 20 sec at 94°C, 1 min at 58°C and 1 min 72°C, with a final extension of 10 min at 72°C, and cooling to 10°C. Five microliter of the amplified product was visualized on a 2% agarose gel. The primers amplified a DNA-fragment of respectively 420 and 433 basepairs from A. vaginae and showed no cross reactivity to other organisms, including A. rimae (data not presented).

To assess the relative accuracy of PCR-based detection of G. vaginalis or A. vaginae, we applied comparative receiver-operating-characteristic (ROC) analysis under the non-parametric assumption and compared the accuracies of the isolated markers (amplification with ato154f, ato167f, G_OY and G_Z) in allocating subjects to a particular Gram stain category (grades I to IV).

Subsequently, we compared the accuracy of PCR-based combined detection of G. vaginalis (using the two different primer sets designated G_Zand G_OY) and A. vaginae (using ato167f) to assess the vaginal microflora status (according to Gram stain category) by non-parametric ROC-analysis.

Accuracy in these analyses is expressed as the area-under-the-curve (AUC) in the ROC-plot, the 95% confidence interval (CI) to the AUC, and the p-value to the 95% CI. We also calculated the estimated sensitivity, specificity, positive and negative predictive values (PPV and NPV) and the 95% confidence intervals to these measures. Statistical significance was accepted at the α = 0.05-level.

Analyses were carried out using the statistical software packages EpiCalc2000 v.1.02 and SPSS v.11.0.

Out of 156 16S rRNA gene sequences, obtained from 26 isolates and from 130 clones, two sequences of A. vaginae (-like) species and 23 sequences of uncultured bacterium clones were submitted to GenBank and were assigned accession no. AJ585206 to AJ585213 and no. AJ619698 to AJ619714.