<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2180-3-23</ui>
   <ji>1471-2180</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Diversity in coding tandem repeats in related <it>Neisseria </it>spp.</p>
         </title>
         <aug>
            <au id="A1" ce="yes">
               <snm>Jordan</snm>
               <fnm>Philip</fnm>
               <insr iid="I1"/>
               <email>philip.jordan@pathology.oxford.ac.uk</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Snyder</snm>
               <mi>AS</mi>
               <fnm>Lori</fnm>
               <insr iid="I1"/>
               <email>lori.snyder@pathology.oxford.ac.uk</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Saunders</snm>
               <mi>J</mi>
               <fnm>Nigel</fnm>
               <insr iid="I1"/>
               <email>nigel.saunders@pathology.oxford.ac.uk</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Bacterial Pathogenesis and Functional Genomics Group, The Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford. OX1 3RE, UK</p>
            </ins>
         </insg>
         <source>BMC Microbiology</source>
         <issn>1471-2180</issn>
         <pubdate>2003</pubdate>
         <volume>3</volume>
         <issue>1</issue>
         <fpage>23</fpage>
         <url>http://www.biomedcentral.com/1471-2180/3/23</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">14611665</pubid>
               <pubid idtype="doi">10.1186/1471-2180-3-23</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>06</day>
               <month>8</month>
               <year>2003</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>12</day>
               <month>11</month>
               <year>2003</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>12</day>
               <month>11</month>
               <year>2003</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2003</year>
         <collab>Jordan et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Tandem repeats contained within coding regions can mediate phase variation when the repeated units change the reading frame of the coding sequence in a copy number dependent manner. Coding tandem repeats are those which do not alter the reading frame with copy number, and the changes in copy number of these repeats may then potentially alter the function or antigenicity of the protein encoded. Three complete neisserial genomes were analyzed and compared to identify coding tandem repeats where the number of copies of the repeat will have some structural consequence for the protein. This is the first study to address coding tandem repeats that may affect protein structures using comparative genomics, combined with a population survey to investigate which show interstrain variability.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>A total of 28 genes were identified. Of these, 22 contain coding tandem repeats that vary in copy number between the three sequenced strains, three strain specific genes were included for investigation on the basis of having >90% identity between repeated units, and three genes with repeated elements of >250 bp were included although no length variations were seen in the genomes. Amplification, and sequencing of repeats showing altered copy number, of these 28 coding tandem repeat containing regions, from a set of largely unrelated strains, revealed further repeat length variation in several cases.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Eighteen genes were identified which have variation in repeat copy number between strains of the same species, twelve of which show greater diversity in repeat copy number than is present in the sequenced genomes. In some cases, this may reflect a mechanism for the generation of antigenic variation, as previously described in other species. However, some of the genes identified encode proteins with cytoplasmic functions, including sugar metabolism, DNA repair, and protein production, in which repeat length variation may have other functions. Coding tandem repeats appear to represent a largely unexplored mechanism of generating diversity in the <it>Neisseria </it>spp.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Variable copy number tandem repeats have been observed in a number of prokaryotic genomes <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. These are adjacent sequences that are directly repeated, the repeated units of which may be identical or partially degenerate. Coding tandem repeats are those tandem repeats that are completely contained within a coding sequence and are composed of repeated units in which copy number will not disrupt the reading frame. Therefore, all coding tandem repeats have repeated units composed of 3 bp or multiples of 3 bp. These are distinct from intergenic repeats and from repeats such as those that mediate phase variation. There are many examples in which variation in copy number within coding tandem repeats has been shown to affect virulence and alter the ability of antibodies to bind to bacterial antigens. In <it>Streptococcus agalactiae</it>, there is a reduction in copies of a coding tandem repeat within the &#945; C-protein from the same strain isolated from mother and neonate <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. The proteins with deleted repeat units are no longer recognised by anti-&#945; C-protein antibodies, and repeat deletion escape mutants can be generated with enhanced pathogenicity in immune mice <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. These repeats share similarity with other streptococcal sequences in the Rib and Esp proteins, which also vary in the length of coding tandem repeats between strains <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Tandem repeated structures in the group A streptococcal M proteins, which are extensively studied virulence determinants, vary in length due to intragenic homologous recombination events <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Size variation in surface proteins Lmp1 and Lmp3 of <it>Mycoplasma hominis </it>has been correlated to tandem repeats at the C-terminal end of the proteins and contributes to immune evasion through antigenic variation <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. In <it>Mycoplasma hyorhinis</it>, immune escape variants of the Vlp proteins are generated through intragenic recombination between the C-terminal coding tandem repeat region in homologues <it>vlpA</it>, <it>vlpB</it>, and <it>vlpC </it><abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Also, there is evidence that repeat epitopes can influence the overall antigenicity of proteins, as well as the availability of epitopes. For example, addition of tandem repeats in the PAc protein of <it>Streptococcus mutans</it>, which normally contains three long repeated regions, induces higher antibody production than the native peptide <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
         <p>In the <it>Neisseria </it>spp., variable copy number coding tandem repeats have been observed previously only in PilQ <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, and DcaC <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, while different copy numbers of a coding tandem repeat have been reported separately for Lip / H.8 <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. Although the functional consequences of these variations have yet to be determined, this is a potentially important mechanism of adaptation available to these species. A comprehensive analysis to identify genes in which potentially functional variation of this type occurs has not previously been performed in the <it>Neisseria </it>or any other bacterial species. In this study, comparisons of the complete genomes of <it>N. gonorrhoeae </it>strain FA1090, and <it>N. meningitidis </it>strains MC58 and Z2491 were conducted to identify all coding tandem repeats, and to identify which of these varied in copy number between the sequenced strains. Upon its availability, the <it>N. meningitidis </it>strain FAM18 genome sequence was added to this analysis. The coding tandem repeats were further investigated in a small diverse collection of strains, to extend the genome-based observations, and to determine which genes are likely to be undergoing functional variation of this type. A range of genes with potentially functionally important diversity in repeat encoded structures was identified.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Coding regions identified as containing coding tandem repeats</p>
            </st>
            <p>The three available complete neisserial genome sequences <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> were compared to identify genes containing coding tandem repeats associated with variation in the copy number of the repeated units. Each tandem repeat was evaluated to determine whether the entirety of the repeat is located within the predicted coding sequence and that it does not alter the reading frame. Tandem repeats that did not meet these criteria are not coding tandem repeats and as such were not investigated. Twenty-two genes were identified (Table <tblr tid="T3">3</tblr>), including: <it>pilQ </it><abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, and <it>dcaC </it><abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, in which diversity in the coding tandem repeats were reported previously, and Lip / H.8 antigen <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>, in which these two publications report different copy numbers of the coding tandem repeat in the single gene addressed. In addition, 2 genes only present in <it>N. gonorrhoeae </it>strain FA1090 (TR23, XNG0938 &amp; TR25, XNG0481) and 1 gene only present in <it>N. meningitidis </it>strain MC58 (TR24, NMB1848) were included for further investigation, each having >90% identity between the repeated units (Table <tblr tid="T3">3</tblr>). Although these could not be assessed for differences in copy number of the coding tandem repeats between the genome sequenced strains, it was felt that due to the high degree of identity between the repeated units they should be further investigated to determine if diversity exists. A further 3 genes (TR26-TR28) were included on the basis of tandem repeats composed of repeated units of greater than 250 bp, although the copy numbers for these did not differ between the sequenced strains (Table <tblr tid="T3">3</tblr>). Although outside the primary criteria of this study, the unusually long nature of the coding tandem repeated units lead to the inclusion of these three genes for investigation here, to assess if diversity in copy number in such repeats exists. The repeated elements within the coding tandem repeats in the selected candidate genes ranged in size from 6 bp to 273 bp (Table <tblr tid="T4">4</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p><it>Neisseria </it>spp. strains used in this study.</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>Strain set for tandem repeat PCRs</p>
                     </c>
                     <c ca="left">
                        <p>Strain identifier used in Table <tblr tid="T4">4</tblr></p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup B strain MC58</p>
                     </c>
                     <c ca="left">
                        <p>MC58</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup B strain 44/76</p>
                     </c>
                     <c ca="left">
                        <p>44/76</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup B strain NGE30</p>
                     </c>
                     <c ca="left">
                        <p>NGE30</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup B strain BZ133</p>
                     </c>
                     <c ca="left">
                        <p>BZ133</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup A strain 92001</p>
                     </c>
                     <c ca="left">
                        <p>92001</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup C strain 94/155</p>
                     </c>
                     <c ca="left">
                        <p>94/155</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. meningitidis </it>serogroup W135 strain A22</p>
                     </c>
                     <c ca="left">
                        <p>A22</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. lactamica </it>strain L18</p>
                     </c>
                     <c ca="left">
                        <p>L18</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. lactamica </it>strain L12</p>
                     </c>
                     <c ca="left">
                        <p>L12</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. lactamica </it>strain L22</p>
                     </c>
                     <c ca="left">
                        <p>L22</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain FA19</p>
                     </c>
                     <c ca="left">
                        <p>FA19</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 26034</p>
                     </c>
                     <c ca="left">
                        <p>26034</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Strain set for <it>N. gonorrhoeae</it>-specific genes</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain FA1090</p>
                     </c>
                     <c ca="left">
                        <p>FA1090</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain MS11</p>
                     </c>
                     <c ca="left">
                        <p>MS11</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain FA19</p>
                     </c>
                     <c ca="left">
                        <p>FA19</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain F62</p>
                     </c>
                     <c ca="left">
                        <p>F62</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 25534</p>
                     </c>
                     <c ca="left">
                        <p>25534</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 28539</p>
                     </c>
                     <c ca="left">
                        <p>28539</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 26034</p>
                     </c>
                     <c ca="left">
                        <p>26593</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 26241</p>
                     </c>
                     <c ca="left">
                        <p>26241</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 27921</p>
                     </c>
                     <c ca="left">
                        <p>27921</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 29528</p>
                     </c>
                     <c ca="left">
                        <p>29528</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 28516</p>
                     </c>
                     <c ca="left">
                        <p>28516</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>N. gonorrhoeae </it>strain 27806</p>
                     </c>
                     <c ca="left">
                        <p>27806</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primer pairs used in this study.</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Tandem repeat</p>
                     </c>
                     <c ca="left">
                        <p>Forward primer (5'-3')</p>
                     </c>
                     <c ca="left">
                        <p>Reverse primer (5'-3')</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR1</p>
                     </c>
                     <c ca="left">
                        <p>GGTCGCTGGATACGCTGC</p>
                     </c>
                     <c ca="left">
                        <p>CGGTAGCCCAAGCCTGCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR2</p>
                     </c>
                     <c ca="left">
                        <p>TGCCGGCAGCAAAGTGTCC</p>
                     </c>
                     <c ca="left">
                        <p>GCCCGTTCCAAACGACCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR3</p>
                     </c>
                     <c ca="left">
                        <p>AGCGGCAGCGGACTGCC</p>
                     </c>
                     <c ca="left">
                        <p>GTGTGCCTGCCGTGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR4</p>
                     </c>
                     <c ca="left">
                        <p>CAAACCGGCAGTTTGGGCG</p>
                     </c>
                     <c ca="left">
                        <p>ATGGGAAATGCGGCTGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR4v2</p>
                     </c>
                     <c ca="left">
                        <p>TGCTCAGCAGCCGCGAGC</p>
                     </c>
                     <c ca="left">
                        <p>GGATGAAGCGGTTGTTGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR5</p>
                     </c>
                     <c ca="left">
                        <p>CAGCCGTGCGCGTCTGG</p>
                     </c>
                     <c ca="left">
                        <p>TTGGCTGATGTCGGGCTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR5v2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CGGGGCGCGATGTTGACG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR6</p>
                     </c>
                     <c ca="left">
                        <p>AACGCCATGCCGTCGAGC</p>
                     </c>
                     <c ca="left">
                        <p>GCCCGCGATGATGTGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR7</p>
                     </c>
                     <c ca="left">
                        <p>CGAAGCGACCAAAGGCATCC</p>
                     </c>
                     <c ca="left">
                        <p>GGGTCATATTCGCCGTGGTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR8</p>
                     </c>
                     <c ca="left">
                        <p>CGGTGAAACCGTTGTTGCCG</p>
                     </c>
                     <c ca="left">
                        <p>TCACGGCCGGAACCTTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR9</p>
                     </c>
                     <c ca="left">
                        <p>CCGCCTACATCCTGTTCGG</p>
                     </c>
                     <c ca="left">
                        <p>AAAGCCGGCGATGATGCGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR10</p>
                     </c>
                     <c ca="left">
                        <p>GCGCCGAAAGTTTGGGACG</p>
                     </c>
                     <c ca="left">
                        <p>GCTTCGCCTTGTTCCACGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR11</p>
                     </c>
                     <c ca="left">
                        <p>CGCTGCCACCAATGATGTCG</p>
                     </c>
                     <c ca="left">
                        <p>TCGTAGCGGCGACTTCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR12</p>
                     </c>
                     <c ca="left">
                        <p>GTAGAAGAAGTCGGCGAGGC</p>
                     </c>
                     <c ca="left">
                        <p>ATCGCCGTATTGCACGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR13</p>
                     </c>
                     <c ca="left">
                        <p>CAGCCGATTGATGGAACACG</p>
                     </c>
                     <c ca="left">
                        <p>GCCTGAAAATCTTCAGGCGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR14</p>
                     </c>
                     <c ca="left">
                        <p>TTGCCGCTCTGTTGGGCG</p>
                     </c>
                     <c ca="left">
                        <p>TGCCCGTATGCGGTCAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR14v2</p>
                     </c>
                     <c ca="left">
                        <p>CTGTTGGGCGGTTGCGCC</p>
                     </c>
                     <c ca="left">
                        <p>CCGCGTTTGACCCTGCTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR15</p>
                     </c>
                     <c ca="left">
                        <p>GCGCATTCTAACACAACCGC</p>
                     </c>
                     <c ca="left">
                        <p>AGGAAGGGAATCTGATGCCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR16</p>
                     </c>
                     <c ca="left">
                        <p>GCATACCGCCAGAACGGC</p>
                     </c>
                     <c ca="left">
                        <p>ATACGGCCCGGAACGTCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR17</p>
                     </c>
                     <c ca="left">
                        <p>AACACGCAAACGCGGACGC</p>
                     </c>
                     <c ca="left">
                        <p>TGCGGCACGGCAGGTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR18</p>
                     </c>
                     <c ca="left">
                        <p>CAGCAGCCAAATGCCCGC</p>
                     </c>
                     <c ca="left">
                        <p>TGCTGCGGCAGGTTTGGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR19a</p>
                     </c>
                     <c ca="left">
                        <p>GCGCCCGAACCGCAACC</p>
                     </c>
                     <c ca="left">
                        <p>GTTTTTCCGCCGGTTTCGGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR19b</p>
                     </c>
                     <c ca="left">
                        <p>AACGGGGCGCGGAGAAGG</p>
                     </c>
                     <c ca="left">
                        <p>GCCCGGAGAAACCAAAACGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR20</p>
                     </c>
                     <c ca="left">
                        <p>Investigated previously <abbrgrp><abbr bid="B15">15</abbr></abbrgrp></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR21</p>
                     </c>
                     <c ca="left">
                        <p>GTCGCGTAGAATGCGGCG</p>
                     </c>
                     <c ca="left">
                        <p>GGAGCCTGCTCCACAACG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR22</p>
                     </c>
                     <c ca="left">
                        <p>GCCGCCGCATTGCTGGC</p>
                     </c>
                     <c ca="left">
                        <p>GCCCTGCTGTTGTGCGGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR23</p>
                     </c>
                     <c ca="left">
                        <p>ATCCTGCCGCCGCCTGC</p>
                     </c>
                     <c ca="left">
                        <p>GATGACCGCGGCATCAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR24</p>
                     </c>
                     <c ca="left">
                        <p>GTGCTTTTCGGGCAAGTGCC</p>
                     </c>
                     <c ca="left">
                        <p>CACCAATCCTACACCGTTCCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR25</p>
                     </c>
                     <c ca="left">
                        <p>CGCCCGAAGGGTTTACCG</p>
                     </c>
                     <c ca="left">
                        <p>GACACGCCGTCAATGACGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR26</p>
                     </c>
                     <c ca="left">
                        <p>GTTTCAGGGCGAGTTTGCCG</p>
                     </c>
                     <c ca="left">
                        <p>CTCGCTGTGCAGCTGCGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR27</p>
                     </c>
                     <c ca="left">
                        <p>GGGTGAAGAACGCAAAGCCC</p>
                     </c>
                     <c ca="left">
                        <p>GAGTTCAGTGCTTCGCGGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR28</p>
                     </c>
                     <c ca="left">
                        <p>GATTGGATACGCGGCAACCG</p>
                     </c>
                     <c ca="left">
                        <p>ATACGGCGGCAAGCTCCG</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>These 28 genes were assessed using PCR in 11 neisserial strains to identify additional diversity in coding tandem repeat copy numbers. These 11 strains were chosen on the basis of previously observed diversity in repeat copy numbers of <it>dcaC </it><abbrgrp><abbr bid="B15">15</abbr></abbrgrp>, and included 6 <it>N. meningitidis</it>, 3 <it>N. lactamica</it>, and 2 <it>N. gonorrhoeae </it>strains (Table <tblr tid="T1">1</tblr>). <it>N. meningitidis </it>strain MC58 was used as a positive and size control in the PCR. The previous <it>dcaC </it>study revealed no variability in tandem copy number between the <it>N. gonorrhoeae </it>strains studied. For the 2 gonococcus specific genes, 11 <it>N. gonorrhoeae </it>strains were analyzed, using strain FA1090 as a positive and size control.</p>
            <p>Primers were designed flanking the tandem repeats such that PCR product size could be used to determine the number of copies of the coding tandem repeated unit. In the case of TR19 (<it>tonB</it>), the gene contains 2 tandem repeats, which were addressed separately (TR19a and TR19b). In the case of TR5 (<it>pilQ</it>) a compound tandem repeat is present, such that the 5' 24 bp of the 66 bp tandem repeat is then repeated itself as a 24 bp tandem repeat immediately following the 66 bp repeat (Figure <figr fid="F1">1</figr>). Therefore, TR5 was evaluated by sequencing in all strains. Additional sequencing was done for all of the products where the size of the PCR product suggested that the length of the tandemly repeated region might differ from the sequenced strains. In all, over 200 sequencing reactions were conducted to ascertain the sequence of the coding tandem repeat containing region(s) of the 28 coding sequences.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Two consecutive tandem repeat elements exist in pilQ (TR5)</p>
               </caption>
               <text>
                  <p><b>Two consecutive tandem repeat elements exist in pilQ (TR5). </b>The first repeated unit is 66 bp. The first 24 bp of this 66 bp repeat is homologous to the second repeated unit of 24 bp. Both repeats in this compound coding tandem repeat are present in different lengths in the strains.</p>
               </text>
               <graphic file="1471-2180-3-23-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Observed differences between coding repeat lengths</p>
            </st>
            <p>Of the 28 genes containing coding tandem repeats, 6 were found to have differences in the number of coding tandem repeats that appear to divide along species lines in the limited strain collection used (Table <tblr tid="T4">4</tblr>; TR9, TR14, TR17, TR18, TR19, TR21). There was no length variation in one of the two <it>N. gonorrhoeae </it>specific genes (Table <tblr tid="T4">4</tblr>; TR25), nor in the three additional genes included in the study based on the length of the repeat (>250 bp) (Table <tblr tid="T4">4</tblr>; TR26, TR27, TR28), suggesting that these long repeats are comparatively stable. Six of the genes displayed no additional length differences to that seen in the sequenced strains (<tblr tid="T4">4</tblr>; TR1, TR3, TR6, TR7, TR12, TR16). Each of these had relatively few copies of the repeat (1 or 2, 2 or 3, or 1 or 3), whereas those which show additional variation to that seen in the genome sequence comparisons tended to have more copies of the repeated unit.</p>
            <p>Of the 28 genes selected as potentially containing length-varying coding tandem repeats, 12 were found to have additional differences in copy number between neisserial strains (Table <tblr tid="T4">4</tblr>; TR2, TR4, TR5, TR8, TR10, TR11, TR13, TR15, TR20, TR22, TR23, TR24). <it>dcaC </it>(TR20) was not further investigated, having previously been assessed in these strains <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Predicted and known surface proteins with coding repeat copy number variation suggesting antigenic variation</p>
            </st>
            <p>The presence of coding tandem repeats within the genes encoding surface proteins has been recognized in other species as a mechanism of antigenic variation mediated by changes in the number of repeats <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. In these cases, changes in the number of tandem repeat copies alters the protein epitopes and presumably offers some benefit to the organism through immune evasion. This process has not been directly demonstrated in the pathogenic <it>Neisseria </it>spp., nor has a detailed study of any bacterial genome been conducted in an attempt to identify the repertoire of coding tandem repeats within a strain. This is, therefore, the first report of its kind, and additionally includes data related to genomic comparisons, diverse strain analysis, and sequencing of new copy number difference in the identified coding tandem repeats.</p>
            <p>Several of the genes identified in this study are either known to be surface proteins, or are predicted to be surface exposed. Of the 28 genes investigated here, twelve of these are outer membrane proteins, or are predicted to be surface associated (TR1, TR4, TR5, TR7, TR11, TR13, TR14, TR15, TR16, TR20, TR21, TR26). For comparison, analysis of the complete genome of <it>N. meningitidis </it>strain MC58 <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> predicted 570 putative surface-exposed proteins out of 2158 annotated features <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Six of the 12 genes identified here contained tandem repeat copy numbers that differed from those of the sequence strains (TR4, TR5, TR11, TR13, TR15, TR20). Additionally, two genes are predicted to be cytoplasmic proteins, which are antigenic in other species (TR2 &amp; TR8). This does not necessarily mean these two CDSs encode surface proteins, which is why they are included in a separate section (<it>Cytoplasmic proteins with variable numbers of coding tandem repeats, which may also be antigenic surface proteins</it>), but likewise it is possible that these proteins are surface exposed. Overall, half of the genes identified that contain coding tandem repeats (14 of 28) may be surface exposed proteins.</p>
            <sec>
               <st>
                  <p>A potential vaccine candidate</p>
               </st>
               <p>NMB2001 (TR4), a protein with some homology with the p60 invasin from <it>Listeria monocytogenes </it><abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, has been identified as a potential vaccine candidate from the study based upon the genome sequencing project <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. It has been determined to be surface exposed and available for antibody binding. The presence of a tandem repeat was referred to in this paper, but length variation was not described. The 29 amino acid repeat encoded in this protein, which constitutes the majority of the N-terminal portion of the protein, is variable among both the <it>N. meningitidis </it>and <it>N. gonorrhoeae </it>strains tested (Table <tblr tid="T4">4</tblr>). It is possible that changes in the coding tandem repeat copy number may alter the antigenicity of the protein, which could complicate its use in any new vaccine.</p>
            </sec>
            <sec>
               <st>
                  <p>The compound tandem repeat of <it>pilQ</it></p>
               </st>
               <p>A compound tandem repeat was identified in <it>pilQ</it>, composed of a repeat of 66 bp followed by one of 24 bp, the latter being similar to the 5' 24 bp of the 66 bp repeat (Figure <figr fid="F1">1</figr>). These repeats have been described and studied previously, with a slightly different description of the repeat structure <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. PilQ forms a dodecameric pore in the neisserial outer membrane, through which the pilus extends from the periplasm to the extracellular space <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. It is not known how the changes in repeat numbers might affect the protein::protein interactions in the dodecamer, or where these repeats are located in the pore structure. Strain variability in this study is similar to that described previously, with one or two copies of the 66 bp repeat, and one to five copies of the 24 bp repeat, with a notable exception. In <it>N. meningitidis </it>strain FAM18, there are no complete copies of either the 66 bp or 24 bp repeats (Table <tblr tid="T4">4</tblr>). This is due to a deletion in the gene from 50 bp into what would be the first copy of the 66 bp repeat to 361 bp after the end of the tandem repeat containing region. This large deletion in <it>pilQ </it>generates a frame-shift mutation in this strain and deletes the site of annealing of the PCR primer TR5R, therefore TR5Rv2 was also designed. A large deletion (303 bp) which comprises a portion of a tandem repeat as well as non-repeated genic sequence is also seen in NMB2050 (TR26), although in this case the deletion does not generate a frame-shift. Deletions associated with the tandem repeats in <it>pilQ </it>have not previously been reported. If the compound tandem repeat containing portion of the PilQ protein represents exposed epitopes, then the variation in the tandem repeat structure may be involved in antigenic variation. It has also been suggested that changes in the repeat alter the assembly of pilin in the context of variations in PilE and/or PilC expression <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>Lipoproteins and putative lipoproteins</p>
               </st>
               <p>Annotated as a hypothetical protein in <it>N. meningitidis </it>strain MC58, TR11 (NMB1333), is predicted by PSORT to be an outer membrane or periplasmic protein. The NCBI Conserved Domain Search reveals that this CDS contains a sequence with homology to the Peptidase family M23/M37, which in addition to the eukaryotic proteins of the family, includes bacterial lipoproteins that have no peptidase activity. The most 5' of the two tandem repeat sequences present in the gene, a repeat composed of 9 copies of a 21 bp element, does not display inter-strain differences in length, although in <it>N. gonorrhoeae </it>strains FA1090 and FA19 copy 7 has 9 bp deleted. The second repeat within this gene is a 15 bp (5 amino acid) tandem repeat present in two, three, and four copies, differences in lengths being present within both the meningococcal and gonococcal strains. The C-terminus of this protein, 3' of these tandem repeats, contains the region with homology to bacterial lipoproteins.</p>
               <p>TR13 (NMB1468), is also predicted to be a lipoprotein. This CDS contains a 21 bp coding tandem repeat that is present in two, three, four, or seven copies in the strains studied (Table <tblr tid="T4">4</tblr>). This sequence has no significant homology to other sequences in the public databases. It is noteworthy that a number of the proteins encoded by CDSs containing coding tandem repeats are, or are predicted to be, lipoproteins (TR4, TR11, TR13, TR14, TR15, TR21). In addition to the potential to antigenically vary the protein sequence, and therefore the structure of these surface exposed molecules, the change in number of repeated units may also influence the lipid component of the protein, as has been suggested for Lip <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
            </sec>
            <sec>
               <st>
                  <p>The Lip repeat</p>
               </st>
               <p>Lip (TR15, also known as the H.8 antigen) is largely composed of a repeated 5 amino acid motif, and has been sequenced previously by two groups. The two reported sequences differ in the number of tandemly repeated sequences <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp>. Although variation of the number of these repeats between strains has not previously been addressed at the DNA-level in the literature, Lip is known to vary in gel mobility suggesting significant inter-strain differences in size <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>, and in the form of its lipid component <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. A virulence-associated lipoprotein, this protein was investigated in the 1980's as a vaccine target due to its antigenicity and capacity to generate an antibody response during disseminated gonococcal infections <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Changes in the M<sub>r </sub>of the protein correlate with serum-resistance and neutrophil enzyme-resistance <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>, although these changes were also demonstrated to effect the immunogenicity and/or antigenicity of gonococcal P.1 <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Lip can be present as a multimer, but this too is dependent on the M<sub>r </sub>of the monomer <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Here we demonstrate 7 different length variations in the tandem repeat that comprises most of the gene, in which only 69 bp (23 amino acids) coding for the gene are outside the tandem repeat. This is the first report in which the DNA repeat from the Lip encoding gene has been sequenced from different strains, demonstrating a high degree of diversity with copy numbers ranging from 10 to 18 copies. No PCR products were generated from the commensal <it>N. lactamica </it>strains, which is consistent with restriction of this gene to the pathogenic species <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. This protein has not been pursued recenty as a vaccine candidate, probably because antibodies directed against it were poorly bactericidal <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. A second gene within the genomes (NMB1533/NMA1733) contains repeated copies of the AAEAP Lip consensus sequence <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. The seven repeat copies in this 'azurin-like protein' do not vary between the sequenced strains and therefore it is not included under the criteria of this study. It should be noted that this second CDS has been mis-annotated in both published genomes as H.8, while the real Lip/H.8 antigen CDS (NMB1523/NMA1723) is annotated as a hypothetical protein and putative proline-rich repeat protein, respectively <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>.</p>
               <p>The major anaerobically induced outer membrane lipoprotein, AniA <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> (TR16, NMB1623), also contains tandem repeats with homology to the AAEAP conserved repeat in Lip and the 'azurin-like protein'. In this case there are two sets of tandem repeats, each at the extreme N- and C-terminus <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. AniA appears to be involved in serum resistance, although it is not expressed under aerobic conditions <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. The crystal structure of AniA would put these tandem repeats on exposed surfaces of the protein <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, although how they are orientated relative to the membrane is not known. Degeneration in the sequence 3' of the gene meant that conserved primers could not be designed flanking the second repeat, therefore it could not be evaluated by PCR in this study. There is some variability in the N-terminal repeat, with some <it>N. meningitidis </it>strains having 3 copies and others 2, but these are 12 bp repeats and those identified by genome comparison at the C-terminus are 6 bp repeats, therefore the differences are not in the complete 15 bp tandem repeat, as in Lip, but rather in the smaller subunits which make up the AAEAP repeat.</p>
               <p>One of the two genes identified as present only in <it>N. gonorrhoeae </it>strain FA1090 (TR25, XNG0481) also has a tandem repeat which is similar to the AAEAP repeat of Lip, the 'azurin-like protein', and AniA. In this case the repeat was identified by ETANDEM as being 30 bp. It is present in 3 copies, or 6 copies of the 15 bp repeat, in all of the gonococcal strains evaluated. This CDS is present in a gonococcal specific island composed of 58 genes. At one end are genes whose homology indicates a prophage, including a putative phage integrase, transcriptional regulator, phage repressor, and DNA helicase. At the other end of this region are <it>pemK </it>and <it>pemI</it>, which were identified on plasmid R100 and are involved in its maintainance <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Therefore this region has features of both an integrated bacteriophage and an integrated plasmid, with a CDS containing a tandem repeat similar to that seen in other neisserial genes in the middle.</p>
               <p>Of the genes evaluated, TR24 (NMB1848), was included in the study due to the high identity (97%) between repeat copies, although the gene itself was only found in <it>N. meningitidis </it>strain MC58. TR24 has more repeat copies than the two gonococcal genes also added to the study for this reason, the meningococcal gene having 15 copies of an 18 bp tandem repeat, rather than 3 copies in the two gonococcal genes (an 18 bp element in TR23, and a 30 bp element in TR25). Four length variants of this gene were identified, including differences between the closely related <it>N. meningitidis </it>strains MC58 and 44/76 (Table <tblr tid="T4">4</tblr>). This tandem repeated unit makes up most of the coding sequence of the gene, there being only 72 bp (24 amino acids) of coding sequence that is not within the tandem repeat. The composition of the majority of this gene by a varying number of coding tandem repeats is reminiscent of Lip, but the location and function of this gene product is not known.</p>
            </sec>
            <sec>
               <st>
                  <p>The conserved <it>dcaC </it>repeat</p>
               </st>
               <p>DcaC (TR20) is predicted to be an outer membrane protein of unknown function containing a 36 amino acid variable copy number tandem repeat, and has been described previously <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Although the gene as a whole has no homology to others in the public databases, homologues of the <it>dcaC </it>repeat are present in several hypothetical proteins. In <it>Magnetococcus </it>sp. MC-1 CDS Mmc10969 there are 14 copies of the repeat (NZ AAAN01000134); nine and ten in <it>E. coli </it>strain CFT073 CDSs c1269 and c5321, respectively <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>; four in <it>Chlorobium tepidum </it>strain TLS CDS CT0958 <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>; six in <it>Vogesella indigofera </it>strain ATCC19706 ORF1 (AF088857.1); five and three in <it>Haemophilus somnus </it>strain 129PT CDSs Hsom0164 (NZ AABG01000001) and Hsom1526 (NZ AABG01000013), respectively; and three in <it>Pasteurella multocida </it>strain PM70 CDS PM1611 <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Such conservation of repeat homology without overall homology of the proteins has not previously been reported. It appears, therefore, that the presence of a protein containing this repeat, and the variability in the copy number of this repeat, is conserved. In the <it>Neisseria </it>spp., the number of tandem repeats within the gene clearly increases the number of distinct hydrophobic regions within the protein (Figure <figr fid="F2">2</figr>).</p>
               <fig id="F2">
                  <title>
                     <p>Figure 2</p>
                  </title>
                  <caption>
                     <p>Hydrophobicity profiles of DcaC</p>
                  </caption>
                  <text>
                     <p><b>Hydrophobicity profiles of DcaC. </b>The number of coding tandem repeats present in DcaC influences the hydrophobicity profile. In <it>N. meningitidis </it>strain Z2491 there is one copy of the 36 amino acid repeat, while in <it>N. meningitidis </it>strain MC58 there are four copies. Generated using TopPredII, where the cutoff for certain transmembrane segments is 1, therefore no transmembrane domains are predicted.</p>
                  </text>
                  <graphic file="1471-2180-3-23-2"/>
               </fig>
            </sec>
            <sec>
               <st>
                  <p>The species-specific <it>rmpM </it>repeat</p>
               </st>
               <p>The shortest tandem repeat included in this study is 2 amino acids (6 bp) and is contained within RmpM (NMB0382, TR21). In this case, the presence of 6 copies of the repeat or 2 copies of the repeat appears to be linked with species, meningococci having the former and gonococci the latter. The presence of no PCR products in the <it>N. lactamica </it>strains is consistent with other work on this gene in the commensal <it>Neisseria </it>spp. <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>, which suggests that a homologue is only present in some strains.</p>
            </sec>
            <sec>
               <st>
                  <p>A potential adhesin</p>
               </st>
               <p>NMB0586 (TR7) is a putative adhesin that contains a 12 bp tandem repeat, which is actually a 2 amino acid repeat, the translation of the 12 bp repeat being HDHD. Although only 2 to 3 copies of this repeat were identified in this study, the product of this gene is predicted to be expressed on the outer membrane or periplasmic space. Most of the length of the predicted protein sequence shares homology to ABC transport periplasmic components/surface adhesins. The crystal structure for TroA, a periplasmic zinc-binding protein from <it>Treponema pallidum</it>, has been solved <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp> and the placement of the TR7 tandem repeat in the structure suggests that it may alter any substrate binding capacity this neisserial protein may have.</p>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Predicted and known cytoplasmic proteins in which altered coding tandem repeat copy number may alter function</p>
            </st>
            <p>The only one of the 28 genes found to contain no copies of the repeat in one of the strains was TR10, <it>mfd </it>(NMB1281), encoding transcription-repair coupling factor. While there are one to three copies of the 207 bp (69 amino acid) repeat in the pathogenic <it>Neisseria </it>spp., <it>N. lactamica </it>strain L12 has none of the 207 bp that make up the repeat, generating a far shorter protein. Unlike <it>pilQ </it>in <it>N. meningitidis </it>strain FAM18, only the repeats are absent in the <it>N. lactamica </it>strain L12 <it>mfd </it>gene, the remainder of the gene remaining intact. Helicase domains, which would be expected in this type of protein, can be found 3' of the repeated structure, and are unaffected by the number of tandem repeats present in the gene. Phase variation <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> and recombination <abbrgrp><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr></abbrgrp> are two characteristic features of the pathogenic <it>Neisseria </it>species. Mfd in other species has been linked with both DNA repair and recombination <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. A knock-out mutant has been investigated to determine whether it influences phase variation rates in <it>Haemophilus influenzae</it>, which found no difference between wild-type and mutant <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. However, the presence of diversity between neisserial species and strains in the length of a relatively long (69 amino acid) repeat within this protein may significantly affect its activity or interactions.</p>
            <p>The greatest variation in copy number is seen within the gene with one of the shortest tandem repeated units. TR22 (NMB0281) contains a 9 bp coding tandem repeat at the 5' end, present in 2, 5, 6, 7, 9, 11, 16, 19, and 26 copies (Table <tblr tid="T4">4</tblr>). The C-terminus of the protein has homology to a rotamase domain. These enzymes increase the rate of protein folding by catalyzing the interconversion of <it>cis</it>-proline and <it>trans</it>-proline. It is possible that the copy number of the coding tandem repeat influences the rate or substrate preference of this enzymatic reaction. Tandem repeats in glucansucrases have been previously identified near the active site of these enzymes in <it>Leuconostoc </it>and <it>Streptococcus </it>species where they may contribute to their function through substrate binding <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>.</p>
            <p>Within a gonococcus-specific region is a CDS (XNG0938; TR23) that has variable numbers of a 18 bp (6 amino acid) coding tandem repeat. The region that contains TR23 also contains 18 other genes not present in the meningococcal genomes including a divergently transcribed CDS with homology to a phage repressor protein. TR23 itself contains a region that is similar to the integrase core domain found in viral integrases and PSORT predicts this to be a cytoplasmic protein. The features of the genes in this region therefore suggest that this region is derived from a prophage.</p>
         </sec>
         <sec>
            <st>
               <p>Cytoplasmic proteins with variable numbers of coding tandem repeats, which may also be antigenic surface proteins</p>
            </st>
            <p>Two, three, and four copies of a 33 bp tandem repeat are found in <it>pgk </it>(TR2, NMB0010). This gene encodes phosphoglycerate kinase (EC 2.7.2.3), a cytoplasmic enzyme involved in the pathway converting glucose to pyruvate <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. This protein is conserved between prokaryotes and eukaryotes, and the crystal structures of both pig muscle <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> and <it>Thermotoga maritima </it>phosphoglycerate kinase have been determined <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. The repeated region in the <it>Neisseria </it>spp. phosphoglycerate kinase maps onto an exposed surface portion of the protein. It was recently reported that in group B streptococcus phosphoglycerate kinase is a surface protein and antibodies directed against it provide protection against infection <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. It is unclear at this time whether the neisserial protein is cytoplasmic, surface associated, or both, although it should be noted that group B streptococci and serogroup B <it>N. meningitidis </it>share capsule characteristics, and that the sugars for these may be a substrate for surface exposed phosphoglycerate kinase, in addition to its cytoplasmic role. Strains which varied in the copy number of tandem repeats were serogroup B <it>N. meningitidis </it>strains NGE30 (2 copies), BZ133 (2 copies), MC58 (3 copies) and 44/76 (4 copies). In contrast, neither the other serogroups of <it>N. meningitidis</it>, nor the <it>N. gonorrhoeae </it>strains, displayed any variability in tandem repeat copy number (Table <tblr tid="T4">4</tblr>).</p>
            <p>A second protein that functions in the cytoplasm has been identified in this study, SucB (TR8, NMB0956). This is the dihydrolipoamide succinyltransferase (E2o) of the 2-oxogluterate dehydrogenase complex, a component of the TCA cycle. Although the sequence of this gene in <it>E. coli </it>contains no repeats, the corresponding acetyltransferase component of the pyruvate dehydrogenase complex (E2p) does <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. In <it>Brucella melitensis </it>and <it>Coxiella burnetii</it>, the product of <it>sucB </it>is immunogenic; antibodies to SucB being present in the serum of infected sheep and Q fever patients, respectively <abbrgrp><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. While there is no evidence that SucB is a surface exposed protein in these species, is does raise the possibility that variation of the 30 bp repeat in the neisserial gene may alter the antigenicity of this protein. Alternatively, the changes in the protein due to the differing tandem repeat copy numbers may offer certain neisserial strains adaptive advantages through altered enzymic activity.</p>
         </sec>
         <sec>
            <st>
               <p>The range of mechanisms generating diversity in <it>Neisseria</it></p>
            </st>
            <p>Neisserial species have a number of different mechanisms by which they generate diversity. At the level of genic composition they are naturally transformable using a species-specific uptake sequence <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>, have the capacity to generate mosaic genes <abbrgrp><abbr bid="B57">57</abbr><abbr bid="B58">58</abbr></abbrgrp>, have a relatively highly panmictic population structure <abbrgrp><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr></abbrgrp>, and have genetic loci preferentially associated with strain-divergent genes within Minimal Mobile Elements <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>. At the level of phase variation they have many known and candidate switching genes <abbrgrp><abbr bid="B43">43</abbr><abbr bid="B62">62</abbr></abbrgrp>, and also have systems utilizing recombination to diversify specific genes such as <it>pilE </it><abbrgrp><abbr bid="B63">63</abbr></abbrgrp>. Each of these influences the dynamic way in which different strains interact with their hosts, and the flexibility with which a colonizing population can diversify and adapt to the differing and changing environments within a single host. Flexibility due to variation in the number of the coding tandem repeats in the genes highlighted in this paper, as reflected by differences in repeat copy number between strains and species, probably represent an additional mechanism by which these host-restricted pathogens can optimize their niche adaptation to their human hosts. Coding tandem repeats within the <it>Neisseria </it>spp. are likely to add an additional level of diversity generation within the already highly adaptable, dynamic, and variable neisserial population.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>Through alteration of the copy number of coding tandem repeats, the <it>Neisseria </it>spp. may have an additional mechanism of generation of diversity that has not previously been explored in detail. While the alteration of the copy number of coding tandem repeats has been recognized previously in three genes (<it>pilQ</it>, <it>dcaC</it>, <it>lip</it>), the functional consequence of these changes has not been addressed. This is the first report to identify all the sequenced neisserial genes that have coding tandem repeats and determine if these are present in variable copy number. From this assessment, it becomes apparent that this is potentially a mechanism for antigenic variation of surface proteins and / or for functional variation of cytoplasmic proteins.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Whole genome analysis to identify coding tandem repeats</p>
            </st>
            <p>The previously described whole genome analysis methodology <abbrgrp><abbr bid="B62">62</abbr><abbr bid="B64">64</abbr></abbrgrp> was applied, using the ACEDB graphical interface <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. The complete genome sequences of <it>N. meningitidis </it>serogroup B strain MC58 <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, <it>N. meningitidis </it>serogroup A strain Z2491 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, and <it>N. gonorrhoeae </it>strain FA1090 <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>(publicly available from 1997, downloaded November 2000 from <url>ftp://ftp.genome.ou.edu/pub/gono/gono-2k.fa</url>), were assessed. Direct tandem repeats were identified using ETANDEM for repeat components of up to 100 bp, due to the fact that it consumes computational cycles in a logarithmically expanding fashion with sequence length. EQUICKTANDEM does not have such heavy computational demands, and is used only for the identification of repeats between 100 and 1000 bp. Both programs are from the EMBOSS package <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>, and were used with standard parameter settings. Near the completion of this project the complete sequence of <it>N. meningitidis </it>serogroup C strain FAM18 became available from The Wellcome Trust Sanger Institute <url>ftp://ftp.sanger.ac.uk/pub/pathogens/nm/</url>, and the coding tandem repeat copy numbers of the 28 identified genes identified from the initial 3-way genome sequence comparison were similarly assessed.</p>
         </sec>
         <sec>
            <st>
               <p>Bacterial strains and growth conditions</p>
            </st>
            <p>The neisserial strains used are shown in Table <tblr tid="T1">1</tblr>. These strains were chosen based on the results obtained previously concerning copy number differences in the coding tandem repeat in <it>dcaC </it><abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. In addition to the information presented in that publication, further information on most of these strains can be obtained from the <it>Neisseria </it>Multi Locus Sequence Typing website <url>http://neisseria.mlst.net</url> developed by Dr Man-Suen Chan and sited at the University of Oxford. Strains were propagated on GC agar (Difco Laboratories) containing the Kellogg supplement and ferric nitrate <abbrgrp><abbr bid="B67">67</abbr></abbrgrp> at 37&#176;C under 5% (v/v) CO<sub>2</sub>.</p>
         </sec>
         <sec>
            <st>
               <p>PCR amplification and sequencing</p>
            </st>
            <p>Chromosomal DNA extractions were performed using the method of McAllister and Stephens <abbrgrp><abbr bid="B68">68</abbr></abbrgrp> or Ausubel <it>et al</it>. <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>. PCR from chromosomal DNA was performed using <aff id="AFF1">Invitrogen</aff><it>Taq </it>DNA Polymerase or Bioline Bio-X-Act polymerase according to the manufacturers' instructions using the primer pairs shown in Table <tblr tid="T2">2</tblr>. When necessary, secondary primers were designed to obtain PCR products and sequences, denoted v2 on Table <tblr tid="T2">2</tblr>. PCR products were resolved on the appropriate concentration of either SeaKem<sup>&#174; </sup>LE agarose gels (Flowgen) or MetaPhor<sup>&#174; </sup>agarose gels (Flowgen) containing 0.5 &#956;g/ml Ethidium Bromide (Sigma). PCR product size was determined using Quantity One<sup>&#174; </sup>Quantitation Software (BIORAD). Automated sequencing used ABI Prism<sup>&#174; </sup>BigDye&#8482; Terminator Cycle Sequencing version 2.0 or version 3.0 (Applied Biosystems), and was resolved on an ABI Prism<sup>&#174; </sup>3100 DNA Sequencer (Applied Biosystems).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genes containing coding tandem repeats with differing copy numbers.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Tandem repeat</p>
                     </c>
                     <c ca="left">
                        <p>NMA#*</p>
                     </c>
                     <c ca="left">
                        <p>NMB# &#8224;</p>
                     </c>
                     <c ca="left">
                        <p>XNG# &#8225;</p>
                     </c>
                     <c ca="left">
                        <p>Gene annotation &#167;</p>
                     </c>
                     <c ca="left">
                        <p>Repeats noted previously?</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR1</p>
                     </c>
                     <c ca="left">
                        <p>NMA0227</p>
                     </c>
                     <c ca="left">
                        <p>NMB2141</p>
                     </c>
                     <c ca="left">
                        <p>XNG1829</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR2</p>
                     </c>
                     <c ca="left">
                        <p>NMA0257</p>
                     </c>
                     <c ca="left">
                        <p>NMB0010</p>
                     </c>
                     <c ca="left">
                        <p>XNG1803</p>
                     </c>
                     <c ca="left">
                        <p>phosphoglycerate kinase (<it>pgk</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR3</p>
                     </c>
                     <c ca="left">
                        <p>NMA0338</p>
                     </c>
                     <c ca="left">
                        <p>NMB2092</p>
                     </c>
                     <c ca="left">
                        <p>XNG1869</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR4</p>
                     </c>
                     <c ca="left">
                        <p>NMA0440</p>
                     </c>
                     <c ca="left">
                        <p>NMB2001</p>
                     </c>
                     <c ca="left">
                        <p>XNG1095</p>
                     </c>
                     <c ca="left">
                        <p>conserved hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR5</p>
                     </c>
                     <c ca="left">
                        <p>NMA0650</p>
                     </c>
                     <c ca="left">
                        <p>NMB1812</p>
                     </c>
                     <c ca="left">
                        <p>XNG0088</p>
                     </c>
                     <c ca="left">
                        <p>PilQ protein (<it>pilQ</it>) ||</p>
                     </c>
                     <c ca="left">
                        <p>yes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR6</p>
                     </c>
                     <c ca="left">
                        <p>NMA0702</p>
                     </c>
                     <c ca="left">
                        <p>NMB0525</p>
                     </c>
                     <c ca="left">
                        <p>XNG0120</p>
                     </c>
                     <c ca="left">
                        <p>aluminium resistance protein, putative</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR7</p>
                     </c>
                     <c ca="left">
                        <p>NMA0789</p>
                     </c>
                     <c ca="left">
                        <p>NMB0586</p>
                     </c>
                     <c ca="left">
                        <p>XNG0151</p>
                     </c>
                     <c ca="left">
                        <p>adhesin, putative</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR8</p>
                     </c>
                     <c ca="left">
                        <p>NMA1150</p>
                     </c>
                     <c ca="left">
                        <p>NMB0956</p>
                     </c>
                     <c ca="left">
                        <p>XNG0849</p>
                     </c>
                     <c ca="left">
                        <p>SucB protein (<it>sucB</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR9</p>
                     </c>
                     <c ca="left">
                        <p>NMA1461</p>
                     </c>
                     <c ca="left">
                        <p>NMB1027</p>
                     </c>
                     <c ca="left">
                        <p>XNG0526</p>
                     </c>
                     <c ca="left">
                        <p>DnaJ protein, truncation (<it>dnaJ</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR10</p>
                     </c>
                     <c ca="left">
                        <p>NMA1491</p>
                     </c>
                     <c ca="left">
                        <p>NMB1281</p>
                     </c>
                     <c ca="left">
                        <p>XNG0596</p>
                     </c>
                     <c ca="left">
                        <p>transcription-repair coupling factor (<it>mfd</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR11</p>
                     </c>
                     <c ca="left">
                        <p>NMA1547</p>
                     </c>
                     <c ca="left">
                        <p>NMB1333</p>
                     </c>
                     <c ca="left">
                        <p>XNG0546</p>
                     </c>
                     <c ca="left">
                        <p>conserved hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR12</p>
                     </c>
                     <c ca="left">
                        <p>NMA1612</p>
                     </c>
                     <c ca="left">
                        <p>NMB1395</p>
                     </c>
                     <c ca="left">
                        <p>XNG0677</p>
                     </c>
                     <c ca="left">
                        <p>alcohol dehydrogenase, zinc-containing</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR13</p>
                     </c>
                     <c ca="left">
                        <p>NMA1680 &#182;</p>
                     </c>
                     <c ca="left">
                        <p>NMB1468</p>
                     </c>
                     <c ca="left">
                        <p>XNG0955</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR14</p>
                     </c>
                     <c ca="left">
                        <p>NMA1692</p>
                     </c>
                     <c ca="left">
                        <p>NMB1483</p>
                     </c>
                     <c ca="left">
                        <p>XNG0967</p>
                     </c>
                     <c ca="left">
                        <p>lipoprotein NlpD, putative</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR15</p>
                     </c>
                     <c ca="left">
                        <p>NMA1723</p>
                     </c>
                     <c ca="left">
                        <p>NMB1523</p>
                     </c>
                     <c ca="left">
                        <p>XNG0903</p>
                     </c>
                     <c ca="left">
                        <p>Lip (H.8 antigen) protein **</p>
                     </c>
                     <c ca="left">
                        <p>yes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR16</p>
                     </c>
                     <c ca="left">
                        <p>NMA1887</p>
                     </c>
                     <c ca="left">
                        <p>NMB1623</p>
                     </c>
                     <c ca="left">
                        <p>XNG1179</p>
                     </c>
                     <c ca="left">
                        <p>major anaerobically induced OMP (<it>aniA</it>) &#8224;&#8224;</p>
                     </c>
                     <c ca="left">
                        <p>yes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR17</p>
                     </c>
                     <c ca="left">
                        <p>NMA1897</p>
                     </c>
                     <c ca="left">
                        <p>NMB1643</p>
                     </c>
                     <c ca="left">
                        <p>XNG1189</p>
                     </c>
                     <c ca="left">
                        <p>translation initiation factor IF-2 (<it>infB</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR18</p>
                     </c>
                     <c ca="left">
                        <p>NMA1977</p>
                     </c>
                     <c ca="left">
                        <p>NMB1723</p>
                     </c>
                     <c ca="left">
                        <p>XNG1268</p>
                     </c>
                     <c ca="left">
                        <p>cytochrome c oxidase, subunit III (<it>fixP</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR19</p>
                     </c>
                     <c ca="left">
                        <p>NMA1985</p>
                     </c>
                     <c ca="left">
                        <p>NMB1730</p>
                     </c>
                     <c ca="left">
                        <p>XNG1276</p>
                     </c>
                     <c ca="left">
                        <p>TonB protein (<it>tonB</it>) &#8225;&#8225;</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR20</p>
                     </c>
                     <c ca="left">
                        <p>NMA2065</p>
                     </c>
                     <c ca="left">
                        <p>NMB0419</p>
                     </c>
                     <c ca="left">
                        <p>XNG1419</p>
                     </c>
                     <c ca="left">
                        <p>conserved hypothetical protein (<it>dcaC</it>) &#167;&#167;</p>
                     </c>
                     <c ca="left">
                        <p>yes</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR21</p>
                     </c>
                     <c ca="left">
                        <p>NMA2105</p>
                     </c>
                     <c ca="left">
                        <p>NMB0382</p>
                     </c>
                     <c ca="left">
                        <p>XNG1455</p>
                     </c>
                     <c ca="left">
                        <p>outer membrane protein class 4 (<it>rmpM</it>) || ||</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR22</p>
                     </c>
                     <c ca="left">
                        <p>NMA2206</p>
                     </c>
                     <c ca="left">
                        <p>NMB0281</p>
                     </c>
                     <c ca="left">
                        <p>XNG1595</p>
                     </c>
                     <c ca="left">
                        <p>peptidyl-prolyl cis-trans isomerase</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR23</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>XNG0938</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR24</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>NMB1848</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR25</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>&#182;&#182;</p>
                     </c>
                     <c ca="left">
                        <p>XNG0481</p>
                     </c>
                     <c ca="left">
                        <p>hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR26</p>
                     </c>
                     <c ca="left">
                        <p>NMA0386</p>
                     </c>
                     <c ca="left">
                        <p>NMB2050</p>
                     </c>
                     <c ca="left">
                        <p>XNG1916</p>
                     </c>
                     <c ca="left">
                        <p>conserved hypothetical protein</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR27</p>
                     </c>
                     <c ca="left">
                        <p>NMA1515</p>
                     </c>
                     <c ca="left">
                        <p>NMB1301</p>
                     </c>
                     <c ca="left">
                        <p>XNG0578</p>
                     </c>
                     <c ca="left">
                        <p>30S ribosomal protein S1 (<it>rpsA</it>)</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR28</p>
                     </c>
                     <c ca="left">
                        <p>NMA2213</p>
                     </c>
                     <c ca="left">
                        <p>NMB0274</p>
                     </c>
                     <c ca="left">
                        <p>XNG1602</p>
                     </c>
                     <c ca="left">
                        <p>DNA helicase RecQ (<it>recQ</it>) ***</p>
                     </c>
                     <c ca="left">
                        <p>no</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> &#8224; <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> &#8225; Locus numbers from our own annotation of <it>N. gonorrhoeae </it>strain FA1090 as used in <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. &#167; From <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> unless otherwise noted. || Gene annotation from <abbrgrp><abbr bid="B74">74</abbr></abbrgrp> &#182; NMA1680 is annotated on the reverse complement strand compared to NMB1468 and XNG0955. ** Gene annotations from <abbrgrp><abbr bid="B75">75</abbr></abbrgrp> and <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> &#8224;&#8224; OMP: outer membrane protein. Gene annotation from <abbrgrp><abbr bid="B33">33</abbr></abbrgrp> &#8225;&#8225; Gene annotation from <abbrgrp><abbr bid="B76">76</abbr></abbrgrp> &#167;&#167; Gene annotation from <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> || || Gene annotation from <abbrgrp><abbr bid="B77">77</abbr></abbrgrp> &#182;&#182; Corresponding gene is not present in this strain. *** Gene annotation from <abbrgrp><abbr bid="B78">78</abbr></abbrgrp></p>
               </tblfn>
            </tbl>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Copy number of coding tandem repeats.</p>
               </caption>
               <tblbdy cols="19">
                  <r>
                     <c ca="left">
                        <p>Repeats</p>
                     </c>
                     <c ca="left">
                        <p>Strains</p>
                     </c>
                     <c ca="center">
                        <p>MC58</p>
                     </c>
                     <c ca="center">
                        <p>44/76</p>
                     </c>
                     <c ca="center">
                        <p>NGE30</p>
                     </c>
                     <c ca="center">
                        <p>BZ133</p>
                     </c>
                     <c ca="center">
                        <p>92001</p>
                     </c>
                     <c ca="center">
                        <p>94/155</p>
                     </c>
                     <c ca="center">
                        <p>A22</p>
                     </c>
                     <c ca="center">
                        <p>Z2491</p>
                     </c>
                     <c ca="center">
                        <p>FAM18</p>
                     </c>
                     <c ca="center">
                        <p>L18</p>
                     </c>
                     <c ca="center">
                        <p>L12</p>
                     </c>
                     <c ca="center">
                        <p>L22</p>
                     </c>
                     <c ca="center">
                        <p>FA1090</p>
                     </c>
                     <c ca="center">
                        <p>FA19</p>
                     </c>
                     <c ca="center">
                        <p>26034</p>
                     </c>
                     <c ca="left">
                        <p>Repeat length</p>
                     </c>
                     <c ca="left">
                        <p>Nature *</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="19">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>30 bp / 10 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>33 bp / 11 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>18 bp / 6 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>87 bp / 29 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR5 &#8224;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2 / 4</p>
                     </c>
                     <c ca="center">
                        <p>2 / 5</p>
                     </c>
                     <c ca="center">
                        <p>2 / 3</p>
                     </c>
                     <c ca="center">
                        <p>2 / 4</p>
                     </c>
                     <c ca="center">
                        <p>2 / 1</p>
                     </c>
                     <c ca="center">
                        <p>2 / 3</p>
                     </c>
                     <c ca="center">
                        <p>2 / 5</p>
                     </c>
                     <c ca="center">
                        <p>2 / 3</p>
                     </c>
                     <c ca="center">
                        <p>0 / 0&#8225;</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>1 / 1</p>
                     </c>
                     <c ca="center">
                        <p>1 / 2</p>
                     </c>
                     <c ca="center">
                        <p>1 / 2</p>
                     </c>
                     <c ca="left">
                        <p>&#8224;</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR6</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>15 bp / 5 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR7</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>12 bp / 4 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>30 bp / 10 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR9</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>30 bp / 10 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR10</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>207 bp / 69 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR11</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>15 bp / 5 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR12</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>21 bp / 7 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR13</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>21 bp / 7 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR14</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>240 bp / 80 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR15</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="left">
                        <p>15 bp / 5 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR16</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="left">
                        <p>12 bp / 4 aa</p>
                     </c>
                     <c ca="left">
                        <p>no new</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR17</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="left">
                        <p>57 bp / 19 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR18</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>12 bp / 4 aa</p>
                     </c>
                     <c ca="left">
                        <p>species&#167;</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR19a</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>18 bp / 6 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR19b</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="left">
                        <p>9 bp / 3 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR20 ||</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>nd</p>
                     </c>
                     <c ca="left">
                        <p>108 bp / 36 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR21</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>6 bp / 2 aa</p>
                     </c>
                     <c ca="left">
                        <p>species</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR22</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>9 bp / 3 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR24</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>---</p>
                     </c>
                     <c ca="center">
                        <p>---</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>---</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="left">
                        <p>18 bp / 6 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR26</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1&#182;</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>273 bp / 91 aa</p>
                     </c>
                     <c ca="left">
                        <p>none</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR27</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>np</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>261 bp / 87 aa</p>
                     </c>
                     <c ca="left">
                        <p>none</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR28</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="left">
                        <p>258 bp / 86 aa</p>
                     </c>
                     <c ca="left">
                        <p>none</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="19">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Repeats</p>
                     </c>
                     <c ca="left">
                        <p>Strains</p>
                     </c>
                     <c ca="center">
                        <p>FA1090</p>
                     </c>
                     <c ca="center">
                        <p>MS11</p>
                     </c>
                     <c ca="center">
                        <p>FA19</p>
                     </c>
                     <c ca="center">
                        <p>F62</p>
                     </c>
                     <c ca="center">
                        <p>25534</p>
                     </c>
                     <c ca="center">
                        <p>28539</p>
                     </c>
                     <c ca="center">
                        <p>26034</p>
                     </c>
                     <c ca="center">
                        <p>26241</p>
                     </c>
                     <c ca="center">
                        <p>27921</p>
                     </c>
                     <c ca="center">
                        <p>29528</p>
                     </c>
                     <c ca="center">
                        <p>28516</p>
                     </c>
                     <c ca="center">
                        <p>27806</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR23</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>18 bp / 6 aa</p>
                     </c>
                     <c ca="left">
                        <p>more</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TR25</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>30 bp / 10 aa</p>
                     </c>
                     <c ca="left">
                        <p>none</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>np &#8211; no product nd &#8211; not done * Nature of the length variations of the coding tandem repeat: species &#8211; observed lengths are associated with species; more &#8211; lengths in addition to what is seen in the three sequence strains used in genome comparison analysis; no new &#8211; no new lengths observed in addition to those seen in the sequenced strains used in genome comparison analysis; none &#8211; no length differences observed. &#8224; Compound tandem repeat, the first is 66 bp / 11 aa and the second is 24 bp / 8 aa &#8225; PilQ is frame-shifted in the genome sequence due to a large deletion starting 50 bp into the 66 bp component of the compound tandem repeat element and ending 361 bp after the region that contains the repeats in other strains. &#167; Length differences were only seen in the non-pathogen, <it>N. lactamica</it>. || From <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. &#182; The CDS in this strain contains a 303 bp deletion, which begins 63 bp before the first copy of the tandem repeat in the other strains and ends 32 bp before the second copy of the tandem repeat in the other strains. Thus this strain has one full copy of the tandem repeat and 32 bp remaining of a second copy.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Nucleotide sequence analysis</p>
            </st>
            <p>The Basic Local Alignment Search Tool (BLAST) <abbrgrp><abbr bid="B70">70</abbr></abbrgrp> was used to search publicly available microbial genome sequences, GenBank, or EMBL. The complete genome sequence of <it>N. gonorrhoeae </it>strain FA1090 was obtained from the <it>N. gonorrhoeae </it>Genome Sequencing Project at the University of Oklahoma <url>http://www.genome.ou.edu/gono.html</url>, which was independently annotated as described previously <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. XNG numbers refer to this annotation, and where no <it>N. meningitidis </it>homologue is present to identify these CDSs (TR23 &amp; TR25), the sequences of the <it>N. gonorrhoeae </it>CDSs referred to are provided as additional material [see <supplr sid="S1">Additional file</supplr>]. The <it>N. meningitidis </it>serogroup C strain FAM18 genome sequence was obtained from the Wellcome Trust Sanger Institute <url>ftp://ftp.sanger.ac.uk/pub/pathogens/nm/</url>. GenBank and EMBL were accessed through the National Center for Biotechnology Information <url>http://www.ncbi.nlm.nih.gov/</url> and the Oxford University Bioinformatics Centre, respectively. Protein domain determinations were addressed through the NCBI Conserved Domain Search, and crystal structures, where available, were visualized using Cn3D v4.0 (NCBI). The Wisconsin Package from GCG (Accelrys) was used for nucleotide and amino acid sequence analysis and alignments. Staden was used for ABI sequence trace assembly and analysis. Predictions of signal sequences and protein localization were generated using PSORT, which currently claims 83% prediction accuracy <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>. Transmembrane domains and hydrophobicity profiles were predicted using TopPredII <abbrgrp><abbr bid="B72">72</abbr><abbr bid="B73">73</abbr></abbrgrp> as implemented by Deveaud and Schuerer (Pasteur Institute; <url>http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html</url>).</p>
            <suppl id="S1">
               <title>
                  <p>Additional File 1</p>
               </title>
               <text>
                  <p>Sequences from the complete genome of <it>N. gonorrhoeae </it>strain FA1090 that are referred to in the manuscript, but for which there are no annotated meningococcal homologues to which readers can refer. It is necessary to identify of these putative coding sequences in this way due to the lack of publication and public annotation of the <it>N. gonorrhoeae </it>strain FA1090 genome sequence.</p>
               </text>
               <file name="1471-2180-3-23-S1.doc">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>PJ carried out the majority of the PCR and sequencing. LS conducted the whole-genome analysis, designed the primers, analyzed and aligned the sequences, did some of the PCR and sequencing, and drafted the manuscript. NS was the supervisor of the work, participating in its design, coordination, and data interpretation, as well as manuscript editing. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The authors would like to thank Dr. Sarah Butcher for continued bioinformatics support and Julian Robinson from the Sir William Dunn School of Pathology sequencing service. LASS was supported by the E. P. Abraham Trust. NJS was supported by a Wellcome Trust Advanced Research Fellowship. This publication made use of the Neisseria Multi Locus Sequence Typing website <url>http://neisseria.mlst.net</url> developed by Dr Man-Suen Chan and sited at the University of Oxford. The development of this site is funded by the Wellcome Trust. The meningococcal genome sequence data were produced by the <it>N. meningitidis </it>serogroup C strain FAM18 Sequencing Group at the Wellcome Trust Sanger Institute, and can be obtained from <url>ftp://ftp.sanger.ac.uk/pub/pathogens/nm/</url>. The <it>N. gonorrhoeae </it>genome sequence was obtained from the University of Oklahoma, the Gonococcal Genome Sequencing Project which was supported by USPHS/NIH grant #AI-38399, GenBank accession number AE004969 <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>A tandem repeats database for bacterial genomes: application to the genotyping of Yersinia pestis and Bacillus anthracis.</p>
            </title>
            <aug>
               <au>
                  <snm>Le Fleche</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hauck</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Onteniente</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Prieur</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Denoeud</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ramisse</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Sylvestre</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Benson</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Ramisse</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Vergnaud</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>BMC Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>1</volume>
            <fpage>2</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">31411</pubid>
                  <pubid idtype="pmpid" link="fulltext">11299044</pubid>
                  <pubid idtype="doi">10.1186/1471-2180-1-2</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Origin and fate of repeats in bacteria.</p>
            </title>
            <aug>
               <au>
                  <snm>Achaz</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Rocha</snm>
                  <fnm>EP</fnm>
               </au>
               <au>
                  <snm>Netter</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Coissac</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2002</pubdate>
            <volume>30</volume>
            <fpage>2987</fpage>
            <lpage>2994</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">117046</pubid>
                  <pubid idtype="pmpid" link="fulltext">12087185</pubid>
                  <pubid idtype="doi">10.1093/nar/gkf391</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Group B streptococci escape host immunity by deletion of tandem repeat elements of the alpha C protein.</p>
            </title>
            <aug>
               <au>
                  <snm>Madoff</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Michel</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Gong</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Kling</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Kasper</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <fpage>4131</fpage>
            <lpage>4136</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">39499</pubid>
                  <pubid idtype="pmpid" link="fulltext">8633028</pubid>
                  <pubid idtype="doi">10.1073/pnas.93.9.4131</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Deletion of repeats in the alpha C protein enhances the pathogenicity of group B streptococci in immune mice.</p>
            </title>
            <aug>
               <au>
                  <snm>Gravekamp</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rosner</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Madoff</snm>
                  <fnm>LC</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1998</pubdate>
            <volume>66</volume>
            <fpage>4347</fpage>
            <lpage>4354</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">108525</pubid>
                  <pubid idtype="pmpid" link="fulltext">9712787</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Large, identical, tandem repeating units in the C protein alpha antigen gene, bca, of group B streptococci.</p>
            </title>
            <aug>
               <au>
                  <snm>Michel</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Madoff</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kling</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Kasper</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Ausubel</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1992</pubdate>
            <volume>89</volume>
            <fpage>10060</fpage>
            <lpage>10064</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">50277</pubid>
                  <pubid idtype="pmpid" link="fulltext">1438195</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Identification of a family of streptococcal surface proteins with extremely repetitive structure.</p>
            </title>
            <aug>
               <au>
                  <snm>Wastfelt</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stalhammar_Carlemalm</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Delisse</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Cabezon</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lindahl</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1996</pubdate>
            <volume>271</volume>
            <fpage>18892</fpage>
            <lpage>18897</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.271.31.18892</pubid>
                  <pubid idtype="pmpid" link="fulltext">8702550</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein.</p>
            </title>
            <aug>
               <au>
                  <snm>Shankar</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Baghdayan</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Huycke</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Lindahl</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gilmore</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1999</pubdate>
            <volume>67</volume>
            <fpage>193</fpage>
            <lpage>200</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">96296</pubid>
                  <pubid idtype="pmpid" link="fulltext">9864215</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Size variation in group A streptococcal M protein is generated by homologous recombination between intragenic repeats.</p>
            </title>
            <aug>
               <au>
                  <snm>Hollingshead</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Fischetti</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1987</pubdate>
            <volume>207</volume>
            <fpage>196</fpage>
            <lpage>203</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00331578</pubid>
                  <pubid idtype="pmpid">3039291</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Complete nucleotide sequence of type 6 M protein of the group A Streptococcus. Repetitive structure and membrane anchor.</p>
            </title>
            <aug>
               <au>
                  <snm>Hollingshead</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Fischetti</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Scott</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1986</pubdate>
            <volume>261</volume>
            <fpage>1677</fpage>
            <lpage>1686</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3511046</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Molecular dissection of Mycoplasma hominis.</p>
            </title>
            <aug>
               <au>
                  <snm>Ladefoged</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>APMIS Suppl</source>
            <pubdate>2000</pubdate>
            <volume>97</volume>
            <fpage>1</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10721331</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Increased structural and combinatorial diversity in an extended family of genes encoding Vlp surface proteins of Mycoplasma hyorhinis.</p>
            </title>
            <aug>
               <au>
                  <snm>Yogev</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Watson_McKown</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rosengarten</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Im</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wise</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1995</pubdate>
            <volume>177</volume>
            <fpage>5636</fpage>
            <lpage>5643</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">177375</pubid>
                  <pubid idtype="pmpid" link="fulltext">7559353</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Elongated versions of Vlp surface lipoproteins protect Mycoplasma hyorhinis escape variants from growth-inhibiting host antibodies.</p>
            </title>
            <aug>
               <au>
                  <snm>Citti</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Wise</snm>
                  <fnm>KS</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1997</pubdate>
            <volume>65</volume>
            <fpage>1773</fpage>
            <lpage>1785</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">175216</pubid>
                  <pubid idtype="pmpid" link="fulltext">9125561</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The immunogenicity of various peptide antigens inducing cross-reacting antibodies to a cell surface protein antigen of Streptococcus mutans.</p>
            </title>
            <aug>
               <au>
                  <snm>Kato</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Takeuchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Oishi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Senpuku</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Shimura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hanada</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nisizawa</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Oral Microbiol Immunol</source>
            <pubdate>1999</pubdate>
            <volume>14</volume>
            <fpage>213</fpage>
            <lpage>219</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1034/j.1399-302X.1999.140403.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10551164</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Structure and function of repetitive sequence elements associated with a highly polymorphic domain of the Neisseria meningitidis PilQ protein.</p>
            </title>
            <aug>
               <au>
                  <snm>T&#248;njum</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Caugant</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Dunham</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Koomey</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>29</volume>
            <fpage>111</fpage>
            <lpage>124</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.1998.00910.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9701807</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Divergence and transcriptional analysis of the division and cell wall (dcw) gene cluster in Neisseria spp.</p>
            </title>
            <aug>
               <au>
                  <snm>Snyder</snm>
                  <fnm>LAS</fnm>
               </au>
               <au>
                  <snm>Shafer</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Molecular Microbiology</source>
            <pubdate>2003</pubdate>
            <volume>47</volume>
            <fpage>431</fpage>
            <lpage>441</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.2003.03204.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12519193</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>The virulence-associated gonococcal H.8 gene encodes 14 tandemly repeated pentapeptides.</p>
            </title>
            <aug>
               <au>
                  <snm>Baehr</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gotschlich</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Hitchcock</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1989</pubdate>
            <volume>3</volume>
            <fpage>49</fpage>
            <lpage>55</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2497299</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Conserved lipoprotein H.8 of pathogenic Neisseria consists entirely of pentapeptide repeats.</p>
            </title>
            <aug>
               <au>
                  <snm>Woods</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Spinola</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Strobel</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1989</pubdate>
            <volume>3</volume>
            <fpage>43</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2497298</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>The Gonococcal genome sequencing project</p>
            </title>
            <aug>
               <au>
                  <snm>Lewis</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Gillaspy</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Gipson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ducey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ownbey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hartman</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nydick</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Carson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vaughn</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Thomson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Najar</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zhan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ren</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Qi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kenton</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Clifton</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Roe</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Dyer</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>unpublished</source>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491.</p>
            </title>
            <aug>
               <au>
                  <snm>Parkhill</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Achtman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>James</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Bentley</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Churcher</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Klee</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Morelli</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Basham</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Chillingworth</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Davies</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Devlin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Feltwell</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hamlin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Holroyd</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jagels</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Leather</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Moule</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mungall</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Quail</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Rajandream</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Rutherford</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Simmonds</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Skelton</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Whitehead</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Spratt</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Barrell</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>404</volume>
            <fpage>502</fpage>
            <lpage>506</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35006655</pubid>
                  <pubid idtype="pmpid" link="fulltext">10761919</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Complete genome sequence of Neisseria meningitidis serogroup B strain MC58.</p>
            </title>
            <aug>
               <au>
                  <snm>Tettelin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Heidelberg</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Jeffries</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Eisen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Ketchum</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Hood</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Peden</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Dodson</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Gwinn</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>DeBoy</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Haft</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Salzberg</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Fleischmann</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Dougherty</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Mason</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ciecko</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Parksey</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Blair</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cittone</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>EB</fnm>
               </au>
               <au>
                  <snm>Cotton</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Utterback</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Khouri</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Qin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Vamathevan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gill</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Scarlato</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Masignani</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Pizza</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Grandi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>HO</fnm>
               </au>
               <au>
                  <snm>Fraser</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Rappuoli</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Venter</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>287</volume>
            <fpage>1809</fpage>
            <lpage>1815</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.287.5459.1809</pubid>
                  <pubid idtype="pmpid" link="fulltext">10710307</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing.</p>
            </title>
            <aug>
               <au>
                  <snm>Pizza</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Scarlato</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Masignani</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Giuliani</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Arico</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Comanducci</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jennings</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Baldi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bartolini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Capecchi</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Galeotti</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Luzzi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Manetti</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Marchetti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mora</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nuti</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ratti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Santini</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Savino</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Scarselli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Storni</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Zuo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Broeker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hundt</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Knapp</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Blair</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mason</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tettelin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hood</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Jeffries</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Granoff</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Venter</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Grandi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Rappuoli</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>287</volume>
            <fpage>1816</fpage>
            <lpage>1820</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.287.5459.1816</pubid>
                  <pubid idtype="pmpid" link="fulltext">10710308</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Protein p60 participates in intestinal host invasion by Listeria monocytogenes.</p>
            </title>
            <aug>
               <au>
                  <snm>Hess</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dreher</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gentschev</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Goebel</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Ladel</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Miko</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kaufmann</snm>
                  <fnm>SH</fnm>
               </au>
            </aug>
            <source>Zentralbl Bakteriol</source>
            <pubdate>1996</pubdate>
            <volume>284</volume>
            <fpage>263</fpage>
            <lpage>272</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8837387</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Analysis of the PilQ secretin from Neisseria meningitidis by transmission electron microscopy reveals a dodecameric quaternary structure.</p>
            </title>
            <aug>
               <au>
                  <snm>Collins</snm>
                  <fnm>RF</fnm>
               </au>
               <au>
                  <snm>Davidsen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Derrick</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Ford</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Tonjum</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2001</pubdate>
            <volume>183</volume>
            <fpage>3825</fpage>
            <lpage>3832</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">95263</pubid>
                  <pubid idtype="pmpid" link="fulltext">11395444</pubid>
                  <pubid idtype="doi">10.1128/JB.183.13.3825-3832.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Purification and characterization of H.8 antigen from group B Neisseria meningitidis.</p>
            </title>
            <aug>
               <au>
                  <snm>Bhattacharjee</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Moran</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Ray</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Zollinger</snm>
                  <fnm>WD</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1988</pubdate>
            <volume>56</volume>
            <fpage>773</fpage>
            <lpage>778</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">259369</pubid>
                  <pubid idtype="pmpid">2450067</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Analyses of gonococcal H8 antigen. Surface location, inter- and intrastrain electrophoretic heterogeneity, and unusual two-dimensional electrophoretic characteristics.</p>
            </title>
            <aug>
               <au>
                  <snm>Hitchcock</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Hayes</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Mayer</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Shafer</snm>
                  <fnm>WM</fnm>
               </au>
               <au>
                  <snm>Tessier</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>1985</pubdate>
            <volume>162</volume>
            <fpage>2017</fpage>
            <lpage>2034</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1084/jem.162.6.2017</pubid>
                  <pubid idtype="pmpid" link="fulltext">2415662</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Neisserial antigen H.8 is immunogenic in patients with disseminated gonococcal and meningococcal infections.</p>
            </title>
            <aug>
               <au>
                  <snm>Black</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Black</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>1985</pubdate>
            <volume>151</volume>
            <fpage>650</fpage>
            <lpage>657</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3919117</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Topographical alterations in proteins I of Neisseria gonorrhoeae correlated with lipooligosaccharide variation.</p>
            </title>
            <aug>
               <au>
                  <snm>Judd</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Shafer</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1989</pubdate>
            <volume>3</volume>
            <fpage>637</fpage>
            <lpage>643</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2503681</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Distribution of specific DNA sequences among pathogenic and commensal Neisseria species.</p>
            </title>
            <aug>
               <au>
                  <snm>Aho</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1987</pubdate>
            <volume>55</volume>
            <fpage>1009</fpage>
            <lpage>1013</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">260454</pubid>
                  <pubid idtype="pmpid">2881892</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Antibodies recognizing a variety of different structural motifs on meningococcal Lip antigen fail to demonstrate bactericidal activity.</p>
            </title>
            <aug>
               <au>
                  <snm>Tinsley</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Virji</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Heckels</snm>
                  <fnm>JE</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1992</pubdate>
            <volume>138 ( Pt 11)</volume>
            <fpage>2321</fpage>
            <lpage>2328</lpage>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Antibodies to meningococcal H.8 (Lip) antigen fail to show bactericidal activity.</p>
            </title>
            <aug>
               <au>
                  <snm>Bhattacharjee</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Moran</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Zollinger</snm>
                  <fnm>WD</fnm>
               </au>
            </aug>
            <source>Can J Microbiol</source>
            <pubdate>1990</pubdate>
            <volume>36</volume>
            <fpage>117</fpage>
            <lpage>122</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2110857</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Localization of a conserved epitope and an azurin-like domain in the H.8 protein of pathogenic Neisseria.</p>
            </title>
            <aug>
               <au>
                  <snm>Kawula</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Spinola</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Klapper</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1987</pubdate>
            <volume>1</volume>
            <fpage>179</fpage>
            <lpage>185</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2452958</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The major anaerobically induced outer membrane protein of Neisseria gonorrhoeae, Pan 1, is a lipoprotein.</p>
            </title>
            <aug>
               <au>
                  <snm>Hoehn</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>VL</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1992</pubdate>
            <volume>60</volume>
            <fpage>4704</fpage>
            <lpage>4708</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">258221</pubid>
                  <pubid idtype="pmpid">1398981</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Isolation and nucleotide sequence of the gene (aniA) encoding the major anaerobically induced outer membrane protein of Neisseria gonorrhoeae.</p>
            </title>
            <aug>
               <au>
                  <snm>Hoehn</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>VL</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1992</pubdate>
            <volume>60</volume>
            <fpage>4695</fpage>
            <lpage>4703</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">258220</pubid>
                  <pubid idtype="pmpid">1383156</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Expression of AniA, the major anaerobically induced outer membrane protein of Neisseria gonorrhoeae, provides protection against killing by normal human sera.</p>
            </title>
            <aug>
               <au>
                  <snm>Cardinale</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>VL</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2000</pubdate>
            <volume>68</volume>
            <fpage>4368</fpage>
            <lpage>4369</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">101774</pubid>
                  <pubid idtype="pmpid" link="fulltext">10858263</pubid>
                  <pubid idtype="doi">10.1128/IAI.68.7.4368-4369.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Crystal structure of the soluble domain of the major anaerobically induced outer membrane protein (AniA) from pathogenic Neisseria: a new class of copper-containing nitrite reductases.</p>
            </title>
            <aug>
               <au>
                  <snm>Boulanger</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>ME</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2002</pubdate>
            <volume>315</volume>
            <fpage>1111</fpage>
            <lpage>1127</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.2001.5251</pubid>
                  <pubid idtype="pmpid" link="fulltext">11827480</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Two genes, pemK and pemI, responsible for stable maintenance of resistance plasmid R100.</p>
            </title>
            <aug>
               <au>
                  <snm>Tsuchimoto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohtsubo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ohtsubo</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1988</pubdate>
            <volume>170</volume>
            <fpage>1461</fpage>
            <lpage>1466</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">210989</pubid>
                  <pubid idtype="pmpid">2832364</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli.</p>
            </title>
            <aug>
               <au>
                  <snm>Welch</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Burland</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Plunkett</snm>
                  <fnm>GDIII</fnm>
               </au>
               <au>
                  <snm>Redford</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Roesch</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rasko</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Buckles</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Liou</snm>
                  <fnm>S-R</fnm>
               </au>
               <au>
                  <snm>Boutin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hackett</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stroud</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mayhew</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Perna</snm>
                  <fnm>NT</fnm>
               </au>
               <au>
                  <snm>Mobley</snm>
                  <fnm>HLT</fnm>
               </au>
               <au>
                  <snm>Donnenberg</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Blattner</snm>
                  <fnm>FR</fnm>
               </au>
            </aug>
            <source>Proceedings of the National Academy of Sciences of the United States of America</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>17020</fpage>
            <lpage>17024</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">139262</pubid>
                  <pubid idtype="pmpid" link="fulltext">12471157</pubid>
                  <pubid idtype="doi">10.1073/pnas.252529799</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>The complete genome sequence of Chlorobium tepidum TLS, a photosynthetic, anaerobic, green-sulfur bacterium.</p>
            </title>
            <aug>
               <au>
                  <snm>Eisen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Paulsen</snm>
                  <fnm>IT</fnm>
               </au>
               <au>
                  <snm>Heidelberg</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dodson</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Deboy</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gwinn</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Haft</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Durkin</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Kolonay</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Holt</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Umayam</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Mason</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shea</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Parksey</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nierman</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Feldblyum</snm>
                  <fnm>TV</fnm>
               </au>
               <au>
                  <snm>Hansen</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Craven</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Radune</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Vamathevan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Khouri</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Gruber</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Ketchum</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Venter</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Tettelin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Bryant</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Fraser</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>9509</fpage>
            <lpage>9514</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">123171</pubid>
                  <pubid idtype="pmpid" link="fulltext">12093901</pubid>
                  <pubid idtype="doi">10.1073/pnas.132181499</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Complete genomic sequence of Pasteurella multocida, Pm70.</p>
            </title>
            <aug>
               <au>
                  <snm>May</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Paustian</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Whittam</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Kapur</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>3460</fpage>
            <lpage>3465</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">30675</pubid>
                  <pubid idtype="pmpid" link="fulltext">11248100</pubid>
                  <pubid idtype="doi">10.1073/pnas.051634598</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Analysis of the expression of the putatively virulence-associated neisserial protein RmpM (class 4) in commensal Neisseria and Moraxella catarrhalis strains.</p>
            </title>
            <aug>
               <au>
                  <snm>Troncoso</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kolberg</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Rosenqvist</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Veiga</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ferreiros</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Criado</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>2001</pubdate>
            <volume>199</volume>
            <fpage>171</fpage>
            <lpage>176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1097(01)00154-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">11377862</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Treponema pallidum TroA is a periplasmic zinc-binding protein with a helical backbone.</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Deka</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Norgard</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Radolf</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hasemann</snm>
                  <fnm>CA</fnm>
               </au>
            </aug>
            <source>Nat Struct Biol</source>
            <pubdate>1999</pubdate>
            <volume>6</volume>
            <fpage>628</fpage>
            <lpage>633</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/10677</pubid>
                  <pubid idtype="pmpid" link="fulltext">10404217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>The crystal structure of Zn(II)-free Treponema pallidum TroA, a periplasmic metal-binding protein, reveals a closed conformation.</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Dorwart</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Hazlett</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Deka</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Norgard</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Radolf</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Hasemann</snm>
                  <fnm>CA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <fpage>2300</fpage>
            <lpage>2304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">134957</pubid>
                  <pubid idtype="pmpid" link="fulltext">11914363</pubid>
                  <pubid idtype="doi">10.1128/JB.184.8.2300-2304.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Comparative whole-genome analyses reveal over 100 putative phase-variable genes in the pathogenic Neisseria spp.</p>
            </title>
            <aug>
               <au>
                  <snm>Snyder</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Butcher</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
            </aug>
            <source>Microbiology</source>
            <pubdate>2001</pubdate>
            <volume>147</volume>
            <fpage>2321</fpage>
            <lpage>2332</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11496009</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Recombination and the population structures of bacterial pathogens.</p>
            </title>
            <aug>
               <au>
                  <snm>Feil</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Spratt</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Annu Rev Microbiol</source>
            <pubdate>2001</pubdate>
            <volume>55</volume>
            <fpage>561</fpage>
            <lpage>590</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.micro.55.1.561</pubid>
                  <pubid idtype="pmpid" link="fulltext">11544367</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis.</p>
            </title>
            <aug>
               <au>
                  <snm>Feil</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Maiden</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Achtman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Spratt</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>1496</fpage>
            <lpage>1502</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10555280</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>The Mfd protein of Bacillus subtilis 168 is involved in both transcription-coupled DNA repair and DNA recombination.</p>
            </title>
            <aug>
               <au>
                  <snm>Ayora</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rojo</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ogasawara</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nakai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Alonso</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1996</pubdate>
            <volume>256</volume>
            <fpage>301</fpage>
            <lpage>318</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.1996.0087</pubid>
                  <pubid idtype="pmpid" link="fulltext">8594198</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Mutations in polI but not mutSLH destabilize Haemophilus influenzae tetranucleotide repeats.</p>
            </title>
            <aug>
               <au>
                  <snm>Bayliss</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>van_de_Ven</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>ER</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>2002</pubdate>
            <volume>21</volume>
            <fpage>1465</fpage>
            <lpage>1476</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">125930</pubid>
                  <pubid idtype="pmpid" link="fulltext">11889052</pubid>
                  <pubid idtype="doi">10.1093/emboj/21.6.1465</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Location of repeat elements in glucansucrases of Leuconostoc and Streptococcus species.</p>
            </title>
            <aug>
               <au>
                  <snm>Janecek</snm>
                  <fnm>&#352;</fnm>
               </au>
               <au>
                  <snm>Svensson</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>RR</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>2000</pubdate>
            <volume>192</volume>
            <fpage>53</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1097(00)00408-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">11040428</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Phosphoglycerate kinase gene from Zymomonas mobilis: cloning, sequencing, and localization within the gap operon.</p>
            </title>
            <aug>
               <au>
                  <snm>Conway</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ingram</snm>
                  <fnm>LO</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1988</pubdate>
            <volume>170</volume>
            <fpage>1926</fpage>
            <lpage>1933</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">211052</pubid>
                  <pubid idtype="pmpid">2832389</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Crystallographic and thiol-reactivity studies on the complex of pig muscle phosphoglycerate kinase with ATP analogues: correlation between nucleotide binding mode and helix flexibility.</p>
            </title>
            <aug>
               <au>
                  <snm>Kovari</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Flachner</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Naray_Szabo</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Vas</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biochemistry</source>
            <pubdate>2002</pubdate>
            <volume>41</volume>
            <fpage>8796</fpage>
            <lpage>8806</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1021/bi020210j</pubid>
                  <pubid idtype="pmpid" link="fulltext">12102622</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Closed structure of phosphoglycerate kinase from Thermotoga maritima reveals the catalytic mechanism and determinants of thermal stability.</p>
            </title>
            <aug>
               <au>
                  <snm>Auerbach</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Huber</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Grattinger</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zaiss</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Schurig</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jaenicke</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Jacob</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Structure</source>
            <pubdate>1997</pubdate>
            <volume>5</volume>
            <fpage>1475</fpage>
            <lpage>1483</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0969-2126(97)00297-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">9384563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Identification of major outer surface proteins of Streptococcus agalactiae.</p>
            </title>
            <aug>
               <au>
                  <snm>Hughes</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pribul</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Younes</snm>
                  <fnm>ZN</fnm>
               </au>
               <au>
                  <snm>Dobson</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Everest</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Reason</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Redfern</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Greer</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Paxton</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Panico</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Feldman</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Santangelo</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <fpage>1254</fpage>
            <lpage>1259</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">127763</pubid>
                  <pubid idtype="pmpid" link="fulltext">11854208</pubid>
                  <pubid idtype="doi">10.1128/IAI.70.3.1254-1259.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Nucleotide sequence of the sucB gene encoding the dihydrolipoamide succinyltransferase of Escherichia coli K12 and homology with the corresponding acetyltransferase.</p>
            </title>
            <aug>
               <au>
                  <snm>Spencer</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Darlison</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Stephens</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Duckenfield</snm>
                  <fnm>IK</fnm>
               </au>
               <au>
                  <snm>Guest</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1984</pubdate>
            <volume>141</volume>
            <fpage>361</fpage>
            <lpage>374</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1432-1033.1984.tb08200.x</pubid>
                  <pubid idtype="pmpid">6376124</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Cloning, nucleotide sequence, and expression of the Brucella melitensis sucB gene coding for an immunogenic dihydrolipoamide succinyltransferase homologous protein.</p>
            </title>
            <aug>
               <au>
                  <snm>Zygmunt</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Diaz</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Teixeira_Gomes</snm>
                  <fnm>AP</fnm>
               </au>
               <au>
                  <snm>Cloeckaert</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2001</pubdate>
            <volume>69</volume>
            <fpage>6537</fpage>
            <lpage>6540</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">98793</pubid>
                  <pubid idtype="pmpid" link="fulltext">11553602</pubid>
                  <pubid idtype="doi">10.1128/IAI.69.10.6537-6540.2001</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Characterization of the Coxiella burnetti sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase.</p>
            </title>
            <aug>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>SV</fnm>
               </au>
               <au>
                  <snm>To</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fukushi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hirai</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Microbiol Immunol</source>
            <pubdate>1999</pubdate>
            <volume>43</volume>
            <fpage>743</fpage>
            <lpage>749</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10524791</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Species-specific uptake of DNA by gonococci is mediated by a 10-base-pair sequence.</p>
            </title>
            <aug>
               <au>
                  <snm>Elkins</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Seifert</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Sparling</snm>
                  <fnm>PF</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1991</pubdate>
            <volume>173</volume>
            <fpage>3911</fpage>
            <lpage>3913</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">208026</pubid>
                  <pubid idtype="pmpid">1904861</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Genetic diversity and mosaicism at the por locus of Neisseria gonorrhoeae.</p>
            </title>
            <aug>
               <au>
                  <snm>Fudyk</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Maclean</snm>
                  <fnm>IW</fnm>
               </au>
               <au>
                  <snm>Simonsen</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Njagi</snm>
                  <fnm>EN</fnm>
               </au>
               <au>
                  <snm>Kimani</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Brunham</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Plummer</snm>
                  <fnm>FA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1999</pubdate>
            <volume>181</volume>
            <fpage>5591</fpage>
            <lpage>5599</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">94077</pubid>
                  <pubid idtype="pmpid" link="fulltext">10482498</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Interspecies recombination, and phylogenetic distortions, within the glutamine synthetase and shikimate dehydrogenase genes of Neisseria meningitidis and commensal Neisseria species.</p>
            </title>
            <aug>
               <au>
                  <snm>Zhou</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bowler</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Spratt</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1997</pubdate>
            <volume>23</volume>
            <fpage>799</fpage>
            <lpage>812</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.1997.2681633.x</pubid>
                  <pubid idtype="pmpid">9157250</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Population genetics of a transformable bacterium: the influence of horizontal genetic exchange on the biology of Neisseria meningitidis.</p>
            </title>
            <aug>
               <au>
                  <snm>Maiden</snm>
                  <fnm>MC</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>1993</pubdate>
            <volume>112</volume>
            <fpage>243</fpage>
            <lpage>250</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0378-1097(93)90607-4</pubid>
                  <pubid idtype="pmpid">8224787</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>How clonal are bacteria?</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>O_Rourke</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Spratt</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1993</pubdate>
            <volume>90</volume>
            <fpage>4384</fpage>
            <lpage>4388</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">46515</pubid>
                  <pubid idtype="pmpid" link="fulltext">8506277</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>The minimal mobile element.</p>
            </title>
            <aug>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Snyder</snm>
                  <fnm>LAS</fnm>
               </au>
            </aug>
            <source>Microbiology (Reading, England)</source>
            <pubdate>2002</pubdate>
            <volume>148</volume>
            <fpage>3756</fpage>
            <lpage>3760</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12480877</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Repeat-associated phase variable genes in the complete genome sequence of Neisseria meningitidis strain MC58.</p>
            </title>
            <aug>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Jeffries</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Peden</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Hood</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Tettelin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Rappuoli</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>ER</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>37</volume>
            <fpage>207</fpage>
            <lpage>215</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.2000.02000.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10931317</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Silent pilin genes of Neisseria gonorrhoeae MS11 and the occurrence of related hypervariant sequences among other gonococcal isolates.</p>
            </title>
            <aug>
               <au>
                  <snm>Haas</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Veit</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>TF</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1992</pubdate>
            <volume>6</volume>
            <fpage>197</fpage>
            <lpage>208</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1347637</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Simple sequence repeats in the Helicobacter pylori genome.</p>
            </title>
            <aug>
               <au>
                  <snm>Saunders</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Peden</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Hood</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Moxon</snm>
                  <fnm>ER</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>27</volume>
            <fpage>1091</fpage>
            <lpage>1098</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.1998.00768.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9570395</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>A C. elegans DataBase. Documentation, code and data available from http://www.acedb.org</p>
            </title>
            <aug>
               <au>
                  <snm>Durbin</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Thierry-Mieg</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <pubdate>1991</pubdate>
         </bibl>
         <bibl id="B66">
            <title>
               <p>The Gonococcal genome sequencing project</p>
            </title>
            <aug>
               <au>
                  <snm>Lewis</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Gillaspy</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Gipson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ducey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ownbey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hartman</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nydick</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Carson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vaughn</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Thomson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Najar</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zhan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ren</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Qi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kenton</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Clifton</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Roe</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Dyer</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>unpublished</source>
         </bibl>
         <bibl id="B67">
            <title>
               <p>EMBOSS: the European Molecular Biology Open Software Suite.</p>
            </title>
            <aug>
               <au>
                  <snm>Rice</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Longden</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Bleasby</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>2000</pubdate>
            <volume>16</volume>
            <fpage>276</fpage>
            <lpage>277</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-9525(00)02024-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">10827456</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation.</p>
            </title>
            <aug>
               <au>
                  <snm>Kellogg</snm>
                  <fnm>D.S., Jr.</fnm>
               </au>
               <au>
                  <snm>Peacock</snm>
                  <fnm>W.L., Jr.</fnm>
               </au>
               <au>
                  <snm>Deacon</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pirkle</snm>
                  <fnm>CI</fnm>
               </au>
            </aug>
            <source>Journal of Bacteriology</source>
            <pubdate>1963</pubdate>
            <volume>85</volume>
            <fpage>1274</fpage>
            <lpage>1279</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">278328</pubid>
                  <pubid idtype="pmpid">14047217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>Analysis in Neisseria meningitidis and other Neisseria species of genes homologous to the FKBP immunophilin family.</p>
            </title>
            <aug>
               <au>
                  <snm>McAllister</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Stephens</snm>
                  <fnm>DS</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1993</pubdate>
            <volume>10</volume>
            <fpage>13</fpage>
            <lpage>23</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7968509</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Preparation of genomic DNA from bacteria.</p>
            </title>
            <aug>
               <au>
                  <snm>Ausubel</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Brent</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kingston</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>Seidman</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Struhl</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Current Protocols in Molecular Biology</source>
            <pubdate>1990</pubdate>
            <volume>1</volume>
            <fpage>2.4.1</fpage>
            <lpage>2.4.2</lpage>
         </bibl>
         <bibl id="B71">
            <title>
               <p>Basic local alignment search tool.</p>
            </title>
            <aug>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Gish</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1990</pubdate>
            <volume>215</volume>
            <fpage>403</fpage>
            <lpage>410</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.1990.9999</pubid>
                  <pubid idtype="pmpid" link="fulltext">2231712</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Expert system for predicting protein localization sites in Gram-negative bacteria.</p>
            </title>
            <aug>
               <au>
                  <snm>Nakai</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kanehisa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Proteins</source>
            <pubdate>1991</pubdate>
            <volume>11</volume>
            <fpage>95</fpage>
            <lpage>110</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/prot.340110203</pubid>
                  <pubid idtype="pmpid">1946347</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Membrane protein structure prediction. Hydrophobicity analysis and the positive-inside rule.</p>
            </title>
            <aug>
               <au>
                  <snm>von_Heijne</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1992</pubdate>
            <volume>225</volume>
            <fpage>487</fpage>
            <lpage>494</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0022-2836(92)90934-C</pubid>
                  <pubid idtype="pmpid">1593632</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B74">
            <title>
               <p>TopPred II: an improved software for membrane protein structure predictions.</p>
            </title>
            <aug>
               <au>
                  <snm>Claros</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>von Heijne</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Comput Appl Biosci</source>
            <pubdate>1994</pubdate>
            <volume>10</volume>
            <fpage>685</fpage>
            <lpage>686</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7704669</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B75">
            <title>
               <p>The Gonococcal genome sequencing project</p>
            </title>
            <aug>
               <au>
                  <snm>Lewis</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Gillaspy</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>McLaughlin</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Gipson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ducey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ownbey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hartman</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nydick</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Carson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vaughn</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Thomson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Najar</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zhan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ren</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Qi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kenton</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Clifton</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Roe</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Dyer</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>unpublished</source>
         </bibl>
         <bibl id="B76">
            <title>
               <p>The product of the pilQ gene is essential for the biogenesis of type IV pili in Neisseria gonorrhoeae.</p>
            </title>
            <aug>
               <au>
                  <snm>Drake</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Koomey</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1995</pubdate>
            <volume>18</volume>
            <fpage>975</fpage>
            <lpage>986</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.1995.18050975.x</pubid>
                  <pubid idtype="pmpid">8825101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B77">
            <title>
               <p>Monoclonal antibody that recognizes an outer membrane antigen common to the pathogenic Neisseria species but not to most nonpathogenic Neisseria species.</p>
            </title>
            <aug>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Black</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Nachamkin</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>PW</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1984</pubdate>
            <volume>43</volume>
            <fpage>994</fpage>
            <lpage>999</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">264283</pubid>
                  <pubid idtype="pmpid">6421742</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B78">
            <title>
               <p>Neisseria meningitidis tonB, exbB, and exbD genes: Ton-dependent utilization of protein-bound iron in Neisseriae.</p>
            </title>
            <aug>
               <au>
                  <snm>Stojiljkovic</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Srinivasan</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1997</pubdate>
            <volume>179</volume>
            <fpage>805</fpage>
            <lpage>812</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">178763</pubid>
                  <pubid idtype="pmpid" link="fulltext">9006036</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B79">
            <title>
               <p>Sequence of the structural gene (rmpM) for the class 4 outer membrane protein of Neisseria meningitidis, homology of the protein to gonococcal protein III and Escherichia coli OmpA, and construction of meningococcal strains that lack class 4 protein.</p>
            </title>
            <aug>
               <au>
                  <snm>Klugman</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Gotschlich</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Blake</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1989</pubdate>
            <volume>57</volume>
            <fpage>2066</fpage>
            <lpage>2071</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">313842</pubid>
                  <pubid idtype="pmpid">2499543</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B80">
            <title>
               <p>Differential roles of homologous recombination pathways in Neisseria gonorrhoeae pilin antigenic variation, DNA transformation and DNA repair.</p>
            </title>
            <aug>
               <au>
                  <snm>Mehr</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Seifert</snm>
                  <fnm>HS</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>1998</pubdate>
            <volume>30</volume>
            <fpage>697</fpage>
            <lpage>710</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2958.1998.01089.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10094619</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

