Previous studies indicated that exogenous zinc diminished EPEC pathogenesis, in part, by inhibiting expression of virulence genes. Specifically, expression of genes of the LEE, encoding components of the type III secretion system, were reduced in the presence of 0.1 to 0.5 mM zinc acetate 1115. Data suggested that, for the LEE4 operon, encoding espA, zinc-dependent down-regulation required the global regulator Ler 14, which controls expression of the LEE4 operon. Thus we initially posited that upon zinc stress cytoplasmic concentrations of this metal ion prevented Ler binding to LEE4 regulatory DNA.

To test this hypothesis, we performed electrophoretic mobility shift assays (EMSA) using purified components (Figure 1). One hundred nanograms of LEE4 regulatory DNA was incubated with 500 nM Ler protein with increasing amounts of zinc acetate. In the absence of added zinc, the Ler/DNA complex migrated poorly into the polyacrylamide gel compared to the DNA fragment alone, consistent with previously published data 1617. Concentrations of added zinc acetate up to 100 μM showed no effect on the ability of Ler protein to bind and shift the LEE4 regulatory DNA (Figure 1). At 1000 μM, or 1 mM, zinc acetate we observed reduction in the ability of Ler to bind LEE4 DNA by 80%. Thus in vitro, millimolar concentrations of zinc were necessary to disrupt Ler binding to regulatory DNA sequences.

Sub-millimolar zinc does not interfere with Ler binding to the LEE4 operon in vitro.

To further our understanding of zinc alteration of LEE gene expression we transformed plasmids containing LEE1-lacZ and LEE4-lacZ fusions (pJLM164 and pJLM165; Table 1) into the prototypical EPEC strain E2348/69, EPEC strain LRT9, strain JPN15 lacking the EAF virulence plasmid, and the K-12 strain MC4100. Strains were grown in DMEM medium in the presence and absence of 0.5 mM zinc acetate, and assayed for β-galactosidase activity. β-galactosidase activity derived from the LEE4 operon was significantly diminished in the presence of zinc in all four strains (Figures 2A-D). Similarly, β-galactosidase activity derived from the LEE1-lacZ, multi-copy fusion was also diminished by the presence of 0.5 mM zinc acetate in the four strains tested (Figures 2E-H).

Strain or plasmid

Genotype or description

Source or reference

Strains

       E2348/69

Prototype EPEC strain (serotype O127:H6)

19

       JPN15

EAF plasmid-cured derivative of E2348/69

20

       MC4100

araD139Δ(argF−lac)U169 rpsL150 relA1flbB5301deoC1ptsF25rbsR

21

       JLM164

MC4100 ΦLEE1−lacZ

14

       JLM165

MC4100 ΦLEE4−lacZ

14

       SIP812

MC4100 zur::Spc^r/Str^r

22

       TB742

MC4100 ΔzntR

23

       CT32

MC4100 rpoE−lacZ

24

       MCamp

MC4100 bla−lacZ

25

       CVD452

E2348/69 ΔescN::aphT

26

       LRT-9

EPEC O111:abH2

27

Plasmids

       pRS551

Promoterless lacZ reporter fusion vector

28

       pVSAPR

bla−lacZ

25

       pJLM164

LEE 1−lacZ

14

       pJLM165

LEE 4−lacZ

14

Bacterial strains and plasmids used in this study

Effect of zinc acetate on LEE gene expression.

We took advantage of the fact that zinc down-regulation of LEE genes could be reconstituted in K-12-derived strains to determine whether the observed regulation involved regulators of zinc ion homeostasis. The Zur regulator represses expression of the znuABC zinc transporter when the bacterium has excess intracellular concentrations of zinc, while ZntR stimulates expression of the zntA exporter when excess concentrations of zinc are found within the cytoplasm 1829. In the MC4100 Δzur strain SIP812 containing the pJLM164 plasmid, β-galactosidase activity derived from the LEE1 operon decreased from ∼5000 to 1000 Miller units in the presence of 0.3 mM zinc acetate, a 5-fold reduction (Student’s t-test; n=3;p< 0.05). Similarly, in the MC4100 ΔzntR strain containing the pJLM164 plasmid β-galactosidase activity decreased from ∼3500 to 500 Miller units, a 7-fold reduction (Student’s t-test; n=3;p< 0.05), in the presence of 0.3 mM zinc acetate. We therefore concluded that zinc-mediated repression of LEE1, encoding Ler, did not require the global regulators of zinc homeostasis Zur or ZntR.

Previous publications have indicated that excess zinc induces the expression of genes involved in envelope stress 3031. While these studies were conducted in complex media, including LB, we wanted to determine if genes associated with envelope stress were stimulated by zinc in the tissue culture medium DMEM used in our assays. We therefore plated the MC4100-derived strains CT32, containing a single-copy rpoE-lacZ fusion, JLM164 and JLM165, containing LEE1lacZ and LEE4lacZ fusions, respectively, and as a negative control, strain MCamp containing a single-copy bla-lacZ fusion on DMEM agar. Sterile disks containing 15 μl of varying concentrations of zinc acetate were placed on the lawns of bacteria on selective medium containing X-gal, and growth proceeded overnight at 37°C.

A relatively small zone of growth inhibition was noted surrounding the disk containing 100 mM zinc acetate for all strains tested (Figure 3). Thus high concentrations of zinc inhibited growth of these MC4100 derivatives. Consistent with our previous assays, we observed decreased β-galactosidase activities, indicated by a lack of blue color, surrounding the zinc acetate-containing disks on the plates containing the JLM164 and JLM165 strains, demonstrating that LEE1 and LEE4 expression was down-regulated in the presence of zinc acetate. However, we also observed similar down-regulation of β-galactosidase activity derived from the bla-lacZ negative control fusion from strain MCamp, suggesting that zinc caused a generalized down-regulation of gene expression in E. coli.

Zinc downregulates both genes related and non-related to virulence but not rpoE.

To substantiate the damage to the EPEC envelope, comprising the inner membrane, periplasmic space, and outer membrane, suggested by our reporter gene fusion assays, we performed electron microscopy. EPEC bacteria were grown in DMEM tissue culture medium in the absence and presence of 0.3 mM zinc acetate. In the absence of zinc, the envelope of the bacteria appeared intact (Figures 4A-C). However, after growth in DMEM in the presence of zinc the outer membrane of the bacteria appeared compromised, and we observed what appeared to be multiple membrane blebs on individual bacteria (Figures 4D,E). Furthermore, we also observed bacteria with irregularly shaped inner membranes (Figure 4F). These data provided direct evidence that zinc damages the EPEC envelope.

The effects of zinc stress on the EPEC envelope imaged by transmission electron microscopy.

Zinc stimulates the expression of rpoE (Figure 3) and physically damages the EPEC envelope (Figure 4). These data demonstrated that, as for laboratory strains of E. coli, zinc causes envelope stress in EPEC. Along with down-regulation of LEE genes encoding type III secretion system components envelope stress could, at least in part, explain why zinc reduces diarrhoea in a rabbit illeal loop model of infection 11. To test this hypothesis we monitored proteins secreted from EPEC grown in DMEM in the presence of ammonium metavanadate (NH₄VO₃). Ammonium metavanadate causes envelope stress and specifically stimulates the rpoE regulon 2434. Thus our prediction was that this chemical, in a manner similar to zinc, would diminish protein secretion via the type III secretion system of EPEC strain E2348/69.

To test this prediction strain E2348/69 was grown in DMEM overnight, in static cultures in the presence of increasing concentrations of NH₄VO₃. Bacteria were pelleted, and secreted proteins were harvested from the supernatant by TCA-precipitation. To control for proteins being released from the bacteria independently from the type III secretion system, we also harvested supernatant proteins from the strain CVD452, deleted for escN, encoding the ATPase 26. We monitored secretion in the presence of zinc because protein secretion was previously shown to be diminished in the presence of this metal ion 11.

Upon separation by SDS-PAGE, for wild type strain E2348/69 we observed the EspB protein migrating to ∼33 kDa, which was dependent upon the type III system for secretion given that this band was absent in the lane corresponding to the ΔescNstrain CVD452 (Figure 5; 35). The identity of EspB was confirmed by an in-gel tryptic digest followed by mass spectrometry (data not shown). Increasing concentrations of NH₄VO₃ caused diminished protein secretion in a concentration dependent manner, such that at 10 mM of this chemical secretion of EspB was diminished by more than 70%. Because NH₄VO₃ stresses the bacterial envelope, specifically targeting the RpoE stress pathway, we concluded that stress to the EPEC envelope caused decreased protein secretion via the type III secretion system.

Zinc and ammonium metavanadate both inhibit protein secretion from EPEC.

Through the course of growing EPEC cultures in DMEM we observed that, not the doubling time, but rather the growth yield was modestly diminished in the presence of zinc acetate (data not shown). In addition, CFU/ml values after overnight growth in DMEM were ∼1.0 x 10⁹ versus 5.0 x 10⁸ in the absence and presence of 0.3 mM zinc. As phosphate is present in DMEM at 1 mM concentration, zinc phosphate is insoluble in solution, and we observed a small amount of white precipitate in DMEM in the presence of zinc acetate (data not shown), we hypothesized that the addition of zinc removed phosphate from this tissue culture medium. Indeed we observed that after the addition of millimolar concentrations of zinc, the concentration of soluble phosphate diminished in a linear fashion in DMEM (Figure 6). Therefore we concluded that zinc removed the essential element phosphorous from solution, and was the most likely explanation for the modestly diminished EPEC growth yield in the presence of zinc.

Effect of added zinc on soluble phosphate remaining in DMEM.

The bacterial strains used are listed in Table 1. Overnight cultures were grown at 37°C with aeration supplemented with the appropriate antibiotic at the following concentrations: kanamycin (50 μg/ml), ampicillin (100 μg/ml), chloramphenicol (30 μg/ml), or streptomycin (50 μg/ml). Overnight cultures were subcultured into Dulbecco’s modified Eagle medium (DMEM) at the dilutions indicated. DMEM in this report refers to DMEM-F12 (Sigma-Aldrich) containing L-glutamine and 4500 mg/L glucose, supplemented with 18 mM NaHCO₃ and 25 mM HEPES, pH 7.4. DMEM-F12 from Sigma-Aldrich was previously determined to contain no more than 1.5 μM zinc 15. The heavy metal content of the HEPES used in all culture media was measured by the manufacturer (Promega) as less than 5 ppm. Therefore the media used in this study contain a negligible amount of zinc compared to the amounts added as a zinc acetate supplement (100 μM or more).

The LEE4 regulatory fragment (bases -468 to +460 relative to the transription start point) was amplified with primers K1150 and K1153 (Table 2) by PCR using plasmid pJLM165 as template 14. DNA fragments were separated by 1.0% agarose gel electrophoresis, stained with ethidium bromide, excised and purified using a QIAQuick Gel Extraction kit (Qiagen). Ler protein was expressed from a pBadMycHis vector and purified as described previously 17. EMSA-based competition to assess Ler binding to LEE4 regulatory DNA was performed by using non-denaturing 5% polyacrylamide gels. Polyacrylamide gels were prepared with a 37.5 : 1 acrylamide/bisacrylamide solution (Bio-Rad) following a standard protocol. Binding reaction mixtures containing 100 ng DNA, EMSA buffer (10 mM Tris, pH 7.4, 5 mM NaCl, 50 mM KCl, 50 mg/ml BSA), 0.5 μM Ler, and zinc acetate at the indicated concentrations were incubated at room temperature for 15 min. After the addition of glycerol to a concentration of 2.5% (v/v), samples were separated by electrophoresis at 4°C overnight at 35 V. Gels were stained with ethidium bromide and imaged using a Bio-Rad Fluor-S MultiImager. Band intensities were quantified with the Gnu Image Manipulation Program (http://www.gimp.org/).

Primer

Sequence 5’ - 3’

Strand

Target

Reference

K1153

CCGGAATTCTGCCGATGGCACCAGACA

+

LEE4

14

K1150

CGCGGATCCTGCCAAACATCGCCAAAGTAG

−

LEE4

14

Oligonucleotide primers used in this study

 β -galactosidase assays

Plasmid pJLM164 containing a LEE1lacZ fusion, and plasmid pJLM165 containing a LEE4lacZfusion were transformed into EPEC strains E2348/69 and LRT9, and into the plasmid-cured EPEC derivative JPN15 and the K-12 strain MC4100. Strains were cultured overnight in LB medium with 50 μg/ml kanamycin and then subcultured 1:100 into 3 ml DMEM buffered with 25 mM HEPES, pH 7.4, in the presence and absence of 0.3 – 0.5 mM zinc acetate. Cells were harvested with OD₆₀₀ between 0.3 and 0.5, and β-galactosidase activity was monitored by standard methods 32. Three independent assays were performed from each culture.

MC4100-derived strains JLM164, JLM165, MCamp, and CT32 containing single-copy lacZ reporter fusions were plated evenly on DMEM agar containing 30 μg/ml X-gal. Sterile disks containing 15 μl of varying concentrations of zinc acetate were placed on the plates which were then cultured overnight at 37°C. The plates were then moved to 4°C for 6 hours to develop the color and photographed.

Overnight cultures of EPEC bacteria grown in LB medium were diluted 1:100 into DMEM-F12 medium, described above. After 10 hours of incubation at 37°C with shaking, incubation was continued in the absence and presence of final concentration 0.3 mM zinc acetate. After 15 hours of growth, samples were pelleted by centrifugation, spent medium discarded, and resuspended in 100 μl 0.1M MgSO₄. Forty μl samples were pipetted onto parafilm, and carbon-formvar grids, shiny side down, were placed on top of each drop and left for 7 minutes. The grid was then transferred to a 40-μl drop of 1.3% uranyl acetate in water and left to stain for 40 seconds. The grid was then removed and blotted dry. Samples were viewed on a Philips CM120 transmission electron microscope. Negatively stained samples were viewed at ambient temperature. Images were recorded at 16-bit grayscale in Gatan digital micrograph 3 (DM3) format on a 1,024×1,024 pixel Gatan 794 charge-coupled device multiscan camera. Gatan digital micrograph 3.4.0 software was used to calculate power spectra and to convert DM3 format raw images and power spectra to eight-bit grayscale TIF images. Grids were imaged at the Oregon Health & Science University Electron Microscopy Core Facility.

EPEC strain E2348/69 was cultured overnight in 2 ml LB medium; the EPEC escN deletion strain CVD452 was similarly grown in LB containing 50 μg/ml kanamycin. The cultures were diluted 100-fold into 20 ml DMEM containing 25 mM HEPES, pH 7.4, and various concentrations of zinc acetate or ammonium metavanadate in 125 ml flasks. Ammonium metavanadate was added from a 0.1 N stock solution prepared by adding the appropriate amount of solid NH₄VO₃ and raising the pH until complete dissolution was achieved; tests showed that adding NH₄VO₃ from this stock up to 2 mM did not change the pH of DMEM solutions appreciably. The cultures were grown statically overnight at 37°C, reaching an OD₆₀₀ of 0.9 - 1.1. Cells were removed from the medium by centrifugation at 12,000 x g for 30 minutes. Secreted proteins remaining in the supernatant were precipitated by adding 25% trichloroacetic acid to a volume of supernatant chosen such that volume (ml)×culture OD₆₀₀ = 6.0. Precipitated proteins in this volume were pelleted by multiple spins into the same 1.5 ml collection tube at 12,000 g. Pellets were washed with acetone, dried at 95°C for 10 minutes, then resuspended by heating with Laemmli sample buffer (0.1 M Tris-Cl pH 6.8, 5% glycerol, 2% β-mercaptoethanol, 2% sodium docedcyl sulfate, 0.01% bromophenol blue) at 95°C for 10 minutes. Proteins were separated on 15% SDS-polyacrylamide gels and visualized by Coomassie blue staining. To verify the identity of the secreted protein, the band migrating at 33 kDa was cut out of the gel, and an in-gel tryptic digest was performed according to the manufacturer’s instructions (Promega; mass spectrometry grade Trypsin and Protease Max surfactant). MALDI-TOF mass spectrometry was used to confirm the presence of EspB tryptic fragments in the digest.

DMEM was supplemented with 0 - 2.0 mM zinc acetate and allowed to incubate at 37°C for 2 hours. Insoluble material was removed by spin filtration, and then soluble phosphate was quantitated using a Bio-Mol Green assay (Enzo Life Sciences).