The plasmid used for construction of transgenic mice was illustrated in Fig. 1A. Transgenic founders is identified by PCR detection of luciferase gene (using the primer pair marked in Fig. 1A) in tail-clip DNA (Fig. 1B). Four founder mice were obtained and crossed to BALB/c mice for five generations to generate progeny for further experiments.

The progenies of cHS4I-hIL-1βP-Luc transgenic founders were screened for luciferase expression in response to LPS as described in materials and methods. All transgenic lines showed robust inducible luciferase activity in the whole body after LPS treatment while injection with saline did not induce luciferase expression. One line named BALB/cTg(cHS4I-hIL-1βP-Luc)Xen had the highest LPS-induced luciferase expression (Fig. 2) and was selected for further studies. In these mice, luciferase activity was detectable 1 h (n = 3/group, p > 0.05 in males compared with the baseline level, p < 0.01 in females compared with the baseline level) after LPS treatment all over the body and relatively higher expression levels were seen at the position of liver, intestine and lungs. The expression signal peaked at 3 h (n = 3/group, p < 0.001 in males and females compared with the baseline level, respectively) after treatment and then gradually declined; by 168 h (n = 3/group, p > 0.05 in males compared with the baseline level, p < 0.01 in females compared with the baseline level) the signal had returned to the baseline level (Fig. 2A, B). As quantified by the LivingImage software, both male and female mice showed significant LPS-induced luciferase signal above the baseline level from 1 to 72 h after treatment, and the kinetics and magnitude of the signals were similar in the two sexes (Fig. 2C). At the peak, the luciferase signal was induced by 7–8 fold in both sexes. In another experiment, no significant difference in LPS-induced luciferase expression was found among mice aged from 2 to 7 months (data not shown).

To confirm the in vivo activity data observed by live imaging, in another set of experiments, luciferase activity was detected ex vivo in dissected organs of cHS4I-hIL-1βP-Luc female mice at 5 h after LPS injection (Fig. 3A). The luciferase activity was significantly higher in the liver, lungs, duodenum, kidneys, brain, and heart. As compared with the saline treated mice, LPS treatment induced the luciferase activity by 11-fold in the liver, 19.6-fold in the lungs, 21-fold in the duodenum, 10-fold in the kidneys, 5-fold in the brain, 4.5-fold in the heart, 5.5-fold in the stomach, 2.7-fold in the thymus, and 1.5-fold in the spleen (Fig. 3B), which was consistent with the in vivo results at 5 h in Fig. 2B.

The LPS-induced expression of mouse endogenous IL-1β mRNA was evaluated by real-time RT-PCR (Fig. 3C). In a large degree in parallel with that of the induced luciferase expression, LPS treatment increased endogenous IL-1β mRNA expression by 15.6-fold in the liver, 9.5-fold in the lungs, 4.7-fold in the kidneys, 9-fold in the brain, 5-fold in the heart, 2.5-fold in the stomach, 12.7-fold in the thymus, 4.2-fold in the spleen, and 1.3-fold in the duodenum. Western Blot analysis showed that LPS significantly induced the expression of pro-IL-1β protein in lung, spleen, and thymus of mice (Fig. 3D).

The inducibility of IL-1β gene expression during acute inflammatory arthritis was studied using the cHS4I-hIL-1βP-Luc transgenic mouse model. Intra-articular injection of zymosan into the right knee joint of cHS4I-hIL-1βP-Luc mice caused a local induction of luciferase signal which was detectable at 2 h, peaked at 8 h, started to decline at 24 h and was still detectable at 96 h after the local treatment (Fig. 4A, B). The luciferase signal at the zymosan-injected right knee joints were 3.1-, 7.6-, 6.9-, and 2.8-fold of the base level at 3, 8, 24, and 96 h, respectively (Fig. 4B). The saline injected left knees showed slight increase in luciferase signal, possibly caused by a systemic response to zymosan administration and/or the lesion at the injection site. The induction of luciferase signal correlated with an increase of knee joint volume, as measured across lateral/medial axis and the anterior/posterior axis of the knee joints (results not shown).

In a third model of inflammatory disease, cHS4I-hIL-1βP-Luc female mice were sensitized with oxazolone and topically challenged at the right ear with oxazolone 6 days later. Oxazolone challenge induced luciferase expression in the right ears at the level of 2.6 fold of the base level at day 1 after challenge (Fig. 5B). A weak induction of luciferase expression was also observed in the vehicle injected left ear. Induction of luciferase expression correlated with increase in ear thickness (Fig. 5C).

Dexamethasone, a synthetic glucocorticoid, has been well characterized for its ability to inhibit IL-1β production. A major mechanism is that dexamethasone inhibits IκB degradation and therefore suppresses IL-1β gene transcription promoted by NF-κB signaling pathway 1617. Male cHS4I-hIL-1βP-Luc mice were cotreated with LPS and dexamethasone (3 mg/kg i.p.) or LPS and saline. The dexamethasone cotreated mice had 51.5% lower induced luciferase expression as compared with the saline cotreated mice (Fig. 6A, B). Similarly, dexamethasone inhibited the induced luciferase expression in the zymosan induced acute arthritis model (Fig. 6C, D).

Bacterial LPS (from Escherichia Coli Serotype 0127:B8), zymosan A (a cell wall preparation from Saccharomyces cerevisiae), dexamethasone and oxazolone were purchased from Sigma-Aldrich (St. Louis, MO, USA). Luciferin (Biosyth, Basel, Switzerland) was dissolved in PBS at 15 mg/ml and stored at -20°C.

A 4.5-kb Kpn I-Bgl II fragment of human IL-1β gene promoter (hIL-1βP) was isolated from human genomic DNA by PCR amplification according to the literature 12. The promoter fragment was verified by DNA sequencing and cloned into the polylinker sites Kpn I and Bgl II of pGL3-Basic (Promega) to direct the expression of luciferase reporter gene (hIL-1βP-Luc). The resulting plasmid was named as pGL3-hIL-1βP-Luc. In order to eliminate the transgenic chromosomal insertion site effect on transgene expression31, the Not I-Kpn I fragment of the chicken HS4 insulator (cHS4I) was cloned into the Not I and Kpn I sites upstream to hIL-1βP. Then, the constructed cHS4I-hIL-1βP-Luc cassette was cut and subcloned into the Apa I and Sal I sites of plasmid pGFP-1. The cHS4I-hIL-1βP-Luc transgenic cassette (Fig. 1A) was cut out by Apa I and Mlu I, and used to generate transgenic mice in the C57XCBA background by standard microinjection techniques. The transgenic mice were bred to BALB/c for 5 generations before testing. All animals were housed in a specific pathogen-free environment in accordance with institutional guidelines for animal care. Animal handling was performed in accordance with institutional guidelines and approved by the local institutional animal care and use committee.

Transgenic founders and their offspring were identified by PCR using the forward-luc (5' TTCCGCCCTTCTTGGCCTTTATGA 3') and reverse-luc (5' CAGCTATTCTGATTACACCCGAGG 3') primers specific for luciferase gene.

In vivo bioluminescent imaging was performed using an IVIS imaging system (Xenogen, Alameda, CA) as previously described. 150 ul sodium salt luciferin (dissolved in PBS) was injected into the intraperitoneal cavity at a dose of 150 mg/ml. Mice were anesthetized with isoflurane/oxygen and placed on the imaging stage. 12 min after luciferin injection, mice were imaged for 1 to 5 min. Photons emitted from specific regions were quantified using a LivingImage software (Xenogen). In vivo luciferase activity was presented in photons emitted per second.

For primary functional screening of transgenic lines, the luciferase gene PCR positive mice were imaged for expression of the luciferase transgene without any treatment or at 5 h after LPS injection at the does of 3.0 mg/kg. The criteria used for screening available transgenic lines were: (1) lower basal luciferase expression in normal status and (2) higher induced luciferase expression in whole body after LPS injection.

The acute septic shock model was produced by i.p. injection of LPS (3.0 mg/kg) into cHS4I-hIL-1βP-Luc transgenic mice at the age of 2–3 mo. Control mice were injected with saline. At selected time points after the treatment, mice were i.p. injected with luciferin and imaged 12 min later with the IVIS imaging system described above. To test the effect of dexamethasone on LPS-triggered luciferase expression, male mice were cotreated with dexamethasone and LPS, and the control mice were injected with saline and LPS. The luciferase signal was monitored through imaging.

Zymosan A was suspended in sterile saline containing 5% glucose at a concentration of 30 mg/ml. Female cHS4I-hIL-1βP-Luc mice at the age of 2–3 mo were anesthetized with isoflurane. Then the hind legs of mice were shaved and the skin was sterilized with 70% ethanol. The right knee tendon was exposed and 10 μl of zymosan A suspension was intra-articularly injected through the tendon with a 25-gauge needle. The left rear knees of the same mice were intra-articularly injected with 5% glucose in saline (sham control). Mice were imaged at selected time points after the injection. Separately, mice were pretreated with dexamethasone (50 μg/mouse i.p.) half hour before the zymosan administration, and the luciferase signal was monitored through imaging.

Female cHS4I-hIL-1βP-Luc mice, 3–6 mo of age, were shaved in the thorax area and treated topically with 50 μl of 2% oxazolone solution (in acetone/olive oil (4/1, vol/vol)). Six days after sensitization, the right ears were challenged by topical application of 10 μl of 1% oxazolone solution, and the left ears were treated with vehicle (acetone/olive oil, 4:1 vol/vol) alone. The extent of inflammation was assessed by measuring ear thickness with a micrometer. Bioluminescent images were collected on the day of sensitization (day -6), the day of challenge (day 0), and at day 1 and 30 after treatment.

Luciferase activity was assayed using the Luciferase Assay System (Promega) on a Luminometer (Lumat LB9507, EG&G, Berthold, Germany).

Female cHS4I-hIL-1βP-Luc mice, 3–6 mo of age, were treated with i.p. injection of LPS (3.0 mg/kg). Control mice were injected with saline. After 5 h, total RNA was isolated from selected mouse tissues using TRIZOL (Invitrogen, Paisley, Scotland, UK) according to the manufacturer's instruction and the extracted RNAs were kept at -80°C prior to use.

Two μg of the RNA samples isolated from the LPS-treated female cHS4I-hIL-1βP-Luc mice was reverse-transcribed into cDNA using M-MLV reverse transcriptase (Promega) in a final reaction volume of 25 μl. For real time PCR amplification, 0.5 μl of cDNA per reaction and 0.2 μM primer sets were used. Reaction conditions were as follows: 94°C/4 min; 51 cycles of 94°C/30 s, 60°C/30 s, 72°C/30 s; and 72°C/10 min. Evagreen used for detecting PCR products was purchased from Molecular Probes (Gentaurer, Brussels, Belgium). Amplification and detection of Evagreen were performed with RG-3000 Real Time Thermal Cycler (Corbett. Research, Sydney, Australia). The expression of the mRNA for the murine β-actin gene was used as a reference to normalize expression levels. All data were expressed relative to β-actin to compensate for any difference in sample loading, and all experiments were performed in triplicates. Data were obtained as threshold cycle (Ct) values (PCR cycle numbers at which fluorescence was threshold) using Rotor-Gene Real-Time Analysis Software 6.0 and used to calculate ΔCT values (ΔCT is the Ct of the target gene subtracted from the Ct of the housekeeping gene). Fold changes relative to saline controls were determined by the 2-ΔΔCT method.

Primers for real time PCR were synthesized as the sequences listed below (Sangon, Shanghai, China). The forward murine IL-1β primer used was 5' AAGGAGAACCAAGCAACGACAAAA 3', the reverse murine IL-1β primer used was 5' TGGGGAACTCTGCAGACTCAAACT 3'. The forward murine β-actin primer used was 5' CCTGTATGCCTCTGGTCGTA 3', the reverse murine β-actin primer used was 5' CCATCTCCTGCTCGAAGTCT 3'.

Mouse tissues were removed and homogenized in 3 volumes of phosphate buffered saline (PBS) containing a protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) and lysed with passive lysis buffer (Promega). After centrifugation at 14,000 rpm for 10 min at 4°C, the supernatant was collected. Luciferase activity was measured using a luminometer and the Luciferase Assay System (Promega). Protein concentration in lysate was estimated by Bradford reagent (Sangon, Shanghai, China). For Western blot analysis, equal amounts of proteins (120 μg) were loaded onto SDS-PAGE gels. After transfer, the membrane was probed with a specific anti-mIL-1β rabbit polyclonal Ab (Chemicon International, Temecula, CA, USA). The blots were developed using the ECL Plus Western Blotting Detection System (Amersham Biosciences, Piscataway, NJ, USA).

All data are expressed as means ± SE. The data were analyzed by one-way ANOVA. A P value of less than 0.05 was considered significant.