<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2164-8-437</ui>
   <ji>1471-2164</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Bioinformatic evaluation of L-arginine catabolic pathways in 24 cyanobacteria and transcriptional analysis of genes encoding enzymes of L-arginine catabolism in the cyanobacterium <it>Synechocystis </it>sp. PCC 6803</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Schriek</snm>
               <fnm>Sarah</fnm>
               <insr iid="I1"/>
               <email>sarah.schriek@uni-bielefeld.de</email>
            </au>
            <au id="A2">
               <snm>R&#252;ckert</snm>
               <fnm>Christian</fnm>
               <insr iid="I2"/>
               <email>christian.rueckert@genetik.uni-bielefeld.de</email>
            </au>
            <au id="A3">
               <snm>Staiger</snm>
               <fnm>Dorothee</fnm>
               <insr iid="I1"/>
               <email>dorothee.staiger@uni-bielefeld.de</email>
            </au>
            <au id="A4">
               <snm>Pistorius</snm>
               <mi>K</mi>
               <fnm>Elfriede</fnm>
               <insr iid="I1"/>
               <email>e.pistorius@uni-bielefeld.de</email>
            </au>
            <au id="A5" ca="yes">
               <snm>Michel</snm>
               <fnm>Klaus-Peter</fnm>
               <insr iid="I1"/>
               <email>klauspeter.michel@uni-bielefeld.de</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Lehrstuhl f&#252;r Molekulare Zellphysiologie, Universit&#228;t Bielefeld, Universit&#228;tsstr. 25, D-33615 Bielefeld, Germany</p>
            </ins>
            <ins id="I2">
               <p>Lehrstuhl f&#252;r Genetik, Universit&#228;t Bielefeld, Universit&#228;tsstr. 25, D-33615 Bielefeld, Germany</p>
            </ins>
         </insg>
         <source>BMC Genomics</source>
         <issn>1471-2164</issn>
         <pubdate>2007</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>437</fpage>
         <url>http://www.biomedcentral.com/1471-2164/8/437</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18045455</pubid>
               <pubid idtype="doi">10.1186/1471-2164-8-437</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>06</day>
               <month>2</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>28</day>
               <month>11</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>28</day>
               <month>11</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Schriek et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>So far very limited knowledge exists on L-arginine catabolism in cyanobacteria, although six major L-arginine-degrading pathways have been described for prokaryotes. Thus, we have performed a bioinformatic analysis of possible L-arginine-degrading pathways in cyanobacteria. Further, we chose <it>Synechocystis </it>sp. PCC 6803 for a more detailed bioinformatic analysis and for validation of the bioinformatic predictions on L-arginine catabolism with a transcript analysis.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We have evaluated 24 cyanobacterial genomes of freshwater or marine strains for the presence of putative L-arginine-degrading enzymes. We identified an L-arginine decarboxylase pathway in all 24 strains. In addition, cyanobacteria have one or two further pathways representing either an arginase pathway or L-arginine deiminase pathway or an L-arginine oxidase/dehydrogenase pathway. An L-arginine amidinotransferase pathway as a major L-arginine-degrading pathway is not likely but can not be entirely excluded. A rather unusual finding was that the cyanobacterial L-arginine deiminases are substantially larger than the enzymes in non-photosynthetic bacteria and that they are membrane-bound. A more detailed bioinformatic analysis of <it>Synechocystis </it>sp. PCC 6803 revealed that three different L-arginine-degrading pathways may in principle be functional in this cyanobacterium. These are (i) an L-arginine decarboxylase pathway, (ii) an L-arginine deiminase pathway, and (iii) an L-arginine oxidase/dehydrogenase pathway. A transcript analysis of cells grown either with nitrate or L-arginine as sole N-source and with an illumination of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1 </sup>showed that the transcripts for the first enzyme(s) of all three pathways were present, but that the transcript levels for the L-arginine deiminase and the L-arginine oxidase/dehydrogenase were substantially higher than that of the three isoenzymes of L-arginine decarboxylase.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The evaluation of 24 cyanobacterial genomes revealed that five different L-arginine-degrading pathways are present in the investigated cyanobacterial species. In <it>Synechocystis </it>sp. PCC 6803 an L-arginine deiminase pathway and an L-arginine oxidase/dehydrogenase pathway represent the major pathways, while the L-arginine decarboxylase pathway most likely only functions in polyamine biosynthesis. The transcripts encoding the enzymes of the two major pathways were constitutively expressed with the exception of the transcript for the carbamate kinase, which was substantially up-regulated in cells grown with L-arginine.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>L-arginine metabolism is more complex than the majority of other metabolic pathways in living organisms. This is due to (1) the occurrence of a biosynthetic branch point at the level of carbamoylphosphate, a precursor for L-arginine and pyrimidine biosynthesis, (2) the fact that L-arginine is a potential precursor of polyamines, (3) the fact that L-arginine can be a precursor of 4-aminobutyrate, having a role as neurotransmitter in mammals, (4) the function of L-arginine as a precursor for nitric oxide, acting as an abundant signal molecule in bacteria, mammals, and plants, and (5) the existence of an impressive variety of L-arginine-degrading pathways in eubacteria and archaea. Compared to heterotrophically-growing prokaryotes, L-arginine has specific additional roles in cyanobacteria, because some strains have an alternative carbon dioxide fixation pathway with carbamoylphosphate as the first carbon dioxide fixation product. This pathway leads to the formation of L-citrulline and subsequently to L-arginine <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Moreover, a number of cyanobacteria is able to synthesize the polymer cyanophycin (multi-L-arginyl-poly-L-aspartate), which consists of an aspartic acid backbone with L-arginine residues being attached to the &#946;-carboxyl group of aspartate by isopeptide bonds <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>. Cyanophycin has been shown to have a complex dynamic metabolism, which is not yet completely understood <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>.</p>
         <p>L-Arginine serves as a source of nitrogen, carbon, and energy through a variety of catabolic pathways in archaea and eubacteria <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. In eubacteria, six major L-arginine-degrading pathways have been described (Fig. <figr fid="F1">1</figr>). The first enzymes of these six pathways are an arginase, an L-arginine deiminase, an L-arginine decarboxylase, an L-arginine amidino-transferase, an L-arginine succinyl transferase, and an L-arginine oxidase/dehydrogenase, respectively. Heterotrophically growing bacteria contain either only one of these pathways or have multiple catabolic pathways, as e.g. shown for several <it>Pseudomonas </it>species <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. In <it>Pseudomonas putida </it>and <it>Pseudomonas aeruginosa </it>four L-arginine-degrading pathways are functional. The L-arginine succinyl transferase pathway and the L-arginine deiminase pathway serve as major routes of L-arginine catabolism under aerobic and anaerobic conditions, respectively. In addition, an L-arginine oxidase/dehydrogenase pathway also contributes to L-arginine catabolism under aerobic conditions. The role of a fourth pathway, the L-arginine decarboxylase pathway, still remains somewhat unclear. Although it may provide ammonium from L-arginine, it does not seem to play a major role in L-arginine utilization as carbon source. It may have its major function in the biosynthesis of the polyamines agmatine and putrescine <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Six major L-arginine-degrading pathways have been described in bacteria</p>
            </caption>
            <text>
               <p><b>Six major L-arginine-degrading pathways have been described in bacteria</b>. The first enzymatic reaction of each pathway is shown. *Transfer of an amidino group to an acceptor such as glycine, L-lysine or inosamine phosphate. **Molecular oxygen or other electron acceptors such as NADP<sup>+ </sup>or quinones.</p>
            </text>
            <graphic file="1471-2164-8-437-1"/>
         </fig>
         <p>The understanding of cyanobacterial L-arginine catabolism is scarce and only a few studies on L-arginine-degrading enzymes exist. This work includes the detection of arginase and L-arginine deiminase activity in <it>Anabaena cylindrica </it>(being synonymous with <it>Nostoc </it>sp. PCC 7120 and <it>Anabaena </it>sp. PCC 7120) <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, <it>Anabaena variabilis </it><abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, <it>Aphanocapsa </it>PCC 6308 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, and <it>Nosto</it>c sp. PCC 73102 <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. In <it>Synechocystis </it>sp. PCC 6803 two genes encoding ureohydrolase-type enzymes (Sll1077 and Sll0228) have been identified using bioinformatic tools <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. L-Ornithine was detected as a major initial product of L-arginine degradation. Based on the detected products, a model of L-arginine catabolism with a putative arginase as the first enzyme has been proposed <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. In this model L-arginine degradation via arginase is suggested to lead to L-ornithine as first product and subsequently to the production of L-glutamate, and also L-proline. Since L-citrulline and a minor amount of argininosuccinate were also detected as products, an urea cycle-type pathway, besides an arginase pathway, was included in the model <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>In the two closely related strains <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942 an L-amino acid oxidase (AoxA) with a high specificity for basic L-amino acids and with L-arginine as preferred substrate has been partially characterized <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. Recently, such an enzyme has also been identified by enzymatic activity tests in <it>Synechococcus cedrorum </it>PCC 6908 <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. The <it>aoxA </it>genes in <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942 have also been identified <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>.</p>
         <p>Since L-arginine catabolism in heterotrophically growing eubacteria is very diverse and since the knowledge on L-arginine catabolism in cyanobacteria is rather limited, the genomes of 24 cyanobacterial strains were screened for the presence of genes encoding putative L-arginine-degrading enzymes in order to obtain an overview on L-arginine catabolism in cyanobacteria. We chose <it>Synechocystis </it>sp. PCC 6803 as a model organism and validated the results of our bioinformatic analysis for this strain with a transcript analysis. We chose <it>Synechocystis </it>sp. PCC 6803, because results on the products of L-arginine degradation have been published more recently <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Evaluation of 24 cyanobacterial genomes for the presence of genes encoding enzymes of L-arginine-degrading pathways</p>
            </st>
            <p>We used a bioinformatic approach to analyze 24 cyanobacterial strains with fully sequenced and annotated genomes for the presence of genes encoding putative enzymes being involved in the degradation of L-arginine. Among the marine cyanobacteria, the genomes of six <it>Prochlorococcus </it>and six <it>Synechococcus </it>species as well as the genomes of two N<sub>2</sub>-fixing species (<it>Crocosphaera watsonii </it>WH 8501 and <it>Trichodesmium erythraeum </it>IMS 101) were investigated. The investigated freshwater cyanobacteria included three mesophilic strains, <it>Synechococcus elongatus </it>PCC 6301, <it>Synechococcus elongatus </it>PCC 7942, and <it>Synechocystis </it>sp. PCC 6803, and three thermophilic strains, <it>Thermosynechococcus elongatus </it>BP-1, and two <it>Synechococcus </it>Yellowstone species. The latter two thermophilic strains are capable of N<sub>2</sub>-fixation with a diurnal rhythm. Moreover, three heterocyst-forming N<sub>2</sub>-fixing species <it>Anabaena variabilis </it>ATCC 29413, <it>Nostoc </it>sp. PCC 7120, and <it>Nostoc punctiforme </it>PCC 73102 as well as <it>Gloeobacter violaceus </it>PCC 7421, a strain which lacks thylakoid membranes, were investigated. The origins of the evaluated cyanobacterial genome sequences are listed in Table <tblr tid="T1">1</tblr>. Sequences of genes encoding enzymes involved in L-arginine degradation in various archaea and heterotrophically growing eubacteria were used to identify corresponding genes in cyanobacteria (Table <tblr tid="T2">2</tblr>). The results of the bioinformatic analyses of the 24 cyanobacterial genomes are given in Tables <tblr tid="T3">3</tblr> and <tblr tid="T4">4</tblr>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Origin of the 24 cyanobacterial genome sequences that were used to perform the bioinformatic evaluation of the presence of L-arginine-degrading pathways in cyanobacteria.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Cyanobacterial strain</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Origin of genome sequence*</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reference sequence</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GenBank</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mbps</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>%GC</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Proteins/RNAs</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>European Union/Genoscope</p>
                     </c>
                     <c ca="left">
                        <p>NC_005042</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE017126">AE017126</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.75</p>
                     </c>
                     <c ca="center">
                        <p>36.4</p>
                     </c>
                     <c ca="center">
                        <p>1883/46</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>Craig Venter Institute</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AALP00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AALP00000000">AALP00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.84</p>
                     </c>
                     <c ca="center">
                        <p>39.7</p>
                     </c>
                     <c ca="center">
                        <p>2123/45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>JGI/MIT/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007577</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000111">CP000111</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.71</p>
                     </c>
                     <c ca="center">
                        <p>31.2</p>
                     </c>
                     <c ca="center">
                        <p>1810/45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT9313</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_005071</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BX548175">BX548175</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.41</p>
                     </c>
                     <c ca="center">
                        <p>50.7</p>
                     </c>
                     <c ca="center">
                        <p>2269/55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_005072</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BX548174">BX548174</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.70</p>
                     </c>
                     <c ca="center">
                        <p>30.8</p>
                     </c>
                     <c ca="center">
                        <p>1717/44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>JGI/MIT/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007335</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000095">CP000095</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.84</p>
                     </c>
                     <c ca="center">
                        <p>35.1</p>
                     </c>
                     <c ca="center">
                        <p>1892/44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_005070</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BX548020">BX548020</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.44</p>
                     </c>
                     <c ca="center">
                        <p>59.4</p>
                     </c>
                     <c ca="center">
                        <p>2519/55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007513</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000097">CP000097</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.24</p>
                     </c>
                     <c ca="center">
                        <p>54.2</p>
                     </c>
                     <c ca="center">
                        <p>2307/51</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>Craig Venter Institute</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AANP00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AANP00000000">AANP00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.58</p>
                     </c>
                     <c ca="center">
                        <p>64.5</p>
                     </c>
                     <c ca="center">
                        <p>2770/50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007516</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000110">CP000110</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.51</p>
                     </c>
                     <c ca="center">
                        <p>59.2</p>
                     </c>
                     <c ca="center">
                        <p>2645/54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>Craig Venter Institute</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AANO00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AANO00000000">AANO00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3.04</p>
                     </c>
                     <c ca="center">
                        <p>65.4</p>
                     </c>
                     <c ca="center">
                        <p>3346/55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>Craig Venter Institute</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AAOK00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AAOK00000000">AAOK00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.62</p>
                     </c>
                     <c ca="center">
                        <p>57.6</p>
                     </c>
                     <c ca="center">
                        <p>2883/51</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>WHOI/JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_008312</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000393">CP000393</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.75</p>
                     </c>
                     <c ca="center">
                        <p>34.1</p>
                     </c>
                     <c ca="center">
                        <p>4451/48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>WHOI/JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AADV00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AADV00000000">AADV00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.24</p>
                     </c>
                     <c ca="center">
                        <p>37.1</p>
                     </c>
                     <c ca="center">
                        <p>5958/38</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>Nagoya University</p>
                     </c>
                     <c ca="left">
                        <p>NC_006576</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AP008231">AP008231</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.70</p>
                     </c>
                     <c ca="center">
                        <p>55.5</p>
                     </c>
                     <c ca="center">
                        <p>2527/55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>JGI/Texas A &amp; M University/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007604</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000100">CP000100</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.70</p>
                     </c>
                     <c ca="center">
                        <p>55.5</p>
                     </c>
                     <c ca="center">
                        <p>2612/53</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Kazusa DNA Research Institute</p>
                     </c>
                     <c ca="left">
                        <p>NC_000911</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000022">BA000022</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3.57</p>
                     </c>
                     <c ca="center">
                        <p>47.7</p>
                     </c>
                     <c ca="center">
                        <p>3172/50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>Kazusa DNA Research Institute</p>
                     </c>
                     <c ca="left">
                        <p>NC_005125</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000045">BA000045</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.66</p>
                     </c>
                     <c ca="center">
                        <p>62.0</p>
                     </c>
                     <c ca="center">
                        <p>4430/52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Kazusa DNA Research Institute</p>
                     </c>
                     <c ca="left">
                        <p>NC_003272</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000019">BA000019</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.41</p>
                     </c>
                     <c ca="center">
                        <p>41.3</p>
                     </c>
                     <c ca="center">
                        <p>5366/64</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NZ_AAAY00000000</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AAAY00000000">AAAY00000000</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9.02</p>
                     </c>
                     <c ca="center">
                        <p>41.4</p>
                     </c>
                     <c ca="center">
                        <p>7672/n.d.</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>Missouri State University/JGI/DOE</p>
                     </c>
                     <c ca="left">
                        <p>NC_007413</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000117">CP000117</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.37</p>
                     </c>
                     <c ca="center">
                        <p>41.4</p>
                     </c>
                     <c ca="center">
                        <p>5043/62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>Kazusa DNA Research Institute</p>
                     </c>
                     <c ca="left">
                        <p>NC_004113</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000039">BA000039</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.59</p>
                     </c>
                     <c ca="center">
                        <p>53.9</p>
                     </c>
                     <c ca="center">
                        <p>2476/49</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>Yellowstone A JA-3-3Ab</p>
                     </c>
                     <c ca="left">
                        <p>TIGR</p>
                     </c>
                     <c ca="left">
                        <p>NC_007775</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000239">CP000239</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.93</p>
                     </c>
                     <c ca="center">
                        <p>60.2</p>
                     </c>
                     <c ca="center">
                        <p>2760/55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>Yellowstone B JA-2-3B'a (2&#8211;13)</p>
                     </c>
                     <c ca="left">
                        <p>TIGR</p>
                     </c>
                     <c ca="left">
                        <p>NC_007776</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000240">CP000240</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3.05</p>
                     </c>
                     <c ca="center">
                        <p>58.5</p>
                     </c>
                     <c ca="center">
                        <p>2862/52</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*JGI, Joint Genome Research Institute; DOE, Department of Energy USA; WHOI, Woods Hole Oceanographic Institute; MIT, Massachusetts Institute of Technology; TIGR, The Institute for Genomic Research. The strain <it>Prochlorococcus marinus </it>SS 120 corresponds to <it>Prochlorococcus marinus </it>subsp. <it>marinus </it>str. CCMP 1375 and strain <it>Prochlorococcus marinus </it>MED 4 corresponds to <it>Prochlorococcus marinus </it>subsp.<it>pastoris </it>str. CCMP 1986 or CCMP 1378. <it>Nostoc </it>sp. PCC 7120 is synonymous to <it>Anabaena </it>sp. PCC 7120 as well as <it>Anabaena cylindrica</it>. N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Origin of archaea, eubacterial, and eukaryotic genome sequences used as a reference for the bioinformatic analysis of putative L-arginine-degrading pathways in cyanobacteria.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Organism</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Origin of genome sequence</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reference sequence</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GenBank</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mbps</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>% GC</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Number of Proteins/RNA</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Eubacteria</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Escherichia coli </it>K-12 MG1655</p>
                     </c>
                     <c ca="left">
                        <p>University of Wisconsin-Madison, U.S.A.; <it>Escherichia coli </it>Genome Project</p>
                     </c>
                     <c ca="left">
                        <p>NC_000913</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="U00096">U00096</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.64</p>
                     </c>
                     <c ca="center">
                        <p>50.8</p>
                     </c>
                     <c ca="left">
                        <p>4243/157</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Pseudomonas aeruginosa </it>PAO1</p>
                     </c>
                     <c ca="left">
                        <p>PathoGenesis Corporation, Skokie, U.S.A.;</p>
                     </c>
                     <c ca="left">
                        <p>NC_002516</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE004091">AE004091</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.30</p>
                     </c>
                     <c ca="center">
                        <p>66.6</p>
                     </c>
                     <c ca="left">
                        <p>5568/81</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Pseudomonas fluorescens </it>Pf-5</p>
                     </c>
                     <c ca="left">
                        <p>DOE Joint Genome Institute, U.S.A.</p>
                     </c>
                     <c ca="left">
                        <p>NC_004129</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000076">CP000076</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>7.08</p>
                     </c>
                     <c ca="center">
                        <p>63.3</p>
                     </c>
                     <c ca="left">
                        <p>6137/87</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Pseudomonas syringae </it>pv. <it>syringae </it>B728a</p>
                     </c>
                     <c ca="left">
                        <p>DOE Joint Genome Institute, U.S.A.</p>
                     </c>
                     <c ca="left">
                        <p>NC_007005</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="CP000075">CP000075</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>6.09</p>
                     </c>
                     <c ca="center">
                        <p>59.2</p>
                     </c>
                     <c ca="left">
                        <p>5089/83</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Bacillus subtilis </it>subsp. <it>subtilis </it>str. 168</p>
                     </c>
                     <c ca="left">
                        <p>Non-redundant <it>B. subtilis </it>database</p>
                     </c>
                     <c ca="left">
                        <p>NC_000964</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AL009126">AL009126</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.22</p>
                     </c>
                     <c ca="center">
                        <p>43.5</p>
                     </c>
                     <c ca="left">
                        <p>4105/119</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Bacillus clausii </it>KSM-K16</p>
                     </c>
                     <c ca="left">
                        <p>Kao Corporation, Biological Science Laboraties, Japan</p>
                     </c>
                     <c ca="left">
                        <p>NC_006582</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AP006627">AP006627</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.30</p>
                     </c>
                     <c ca="center">
                        <p>44.8</p>
                     </c>
                     <c ca="left">
                        <p>4096/96</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Bacillus halodurans </it>C-125</p>
                     </c>
                     <c ca="left">
                        <p>Extreme Biosphere Research Center MSTC, Japan</p>
                     </c>
                     <c ca="left">
                        <p>NC_002570</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000004">BA000004</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>4.20</p>
                     </c>
                     <c ca="center">
                        <p>43.7</p>
                     </c>
                     <c ca="left">
                        <p>4066/105</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Xanthomonas campestris </it>pv. <it>campestris </it>str. ATCC 33913</p>
                     </c>
                     <c ca="left">
                        <p>Sao Paulo (State) Consortium</p>
                     </c>
                     <c ca="left">
                        <p>NC_003902</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE008922">AE008922</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>5.08</p>
                     </c>
                     <c ca="center">
                        <p>65.1</p>
                     </c>
                     <c ca="left">
                        <p>4181/61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Corynebacterium glutamicum </it>ATCC 13032</p>
                     </c>
                     <c ca="left">
                        <p>Kitasato University, Kitasato, Japan</p>
                     </c>
                     <c ca="left">
                        <p>NC_003450</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000036">BA000036</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3.31</p>
                     </c>
                     <c ca="center">
                        <p>53.8</p>
                     </c>
                     <c ca="left">
                        <p>2993/81</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Brucella melitensis </it>16M</p>
                     </c>
                     <c ca="left">
                        <p>Integrated Genomics Inc., Chicago, U.S.A.</p>
                     </c>
                     <c ca="left">
                        <p>NC_003317(chr. I)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE008917">AE008917</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.12</p>
                     </c>
                     <c ca="center">
                        <p>57.2</p>
                     </c>
                     <c ca="left">
                        <p>2059/48</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003318 (chr. II)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE008918">AE008918</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.18</p>
                     </c>
                     <c ca="center">
                        <p>57.3</p>
                     </c>
                     <c ca="left">
                        <p>1139/18</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Ralstonia solanacearum </it>GMI 1000</p>
                     </c>
                     <c ca="left">
                        <p>Genoscope, Evry cedex, France</p>
                     </c>
                     <c ca="left">
                        <p>NC_003295 (chr.)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AL646052">AL646052</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3.72</p>
                     </c>
                     <c ca="center">
                        <p>67.0</p>
                     </c>
                     <c ca="left">
                        <p>3440/67</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003296 (plas.)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AL646053">AL646053</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2.10</p>
                     </c>
                     <c ca="center">
                        <p>66.9</p>
                     </c>
                     <c ca="left">
                        <p>1676/7</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Higher Plants</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Arabidopsis thaliana (thale cress)</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>Arabidopsis </it>Genome Initiative</p>
                     </c>
                     <c ca="left">
                        <p>NC_003070 (chr. 1)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE005172">AE005172</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30.43</p>
                     </c>
                     <c ca="center">
                        <p>35.7</p>
                     </c>
                     <c ca="left">
                        <p>7852/7852</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003071 (chr. 2)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AE002093">AE002093</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>19.71</p>
                     </c>
                     <c ca="center">
                        <p>35.9</p>
                     </c>
                     <c ca="left">
                        <p>4853/4853</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003074 (chr. 3)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000014">BA000014</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>23.47</p>
                     </c>
                     <c ca="center">
                        <p>36.3</p>
                     </c>
                     <c ca="left">
                        <p>6048/6048</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003075 (chr. 4)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AJ270058">AJ270058</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>18.58</p>
                     </c>
                     <c ca="center">
                        <p>36.2</p>
                     </c>
                     <c ca="left">
                        <p>4655/4655</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NC_003076 (chr. 5)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="BA000015">BA000015</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>26.99</p>
                     </c>
                     <c ca="center">
                        <p>35.9</p>
                     </c>
                     <c ca="left">
                        <p>7072/7072</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>A sequence from <it>Synechococcus </it>sp. Yellowstone B JA-2-3B'a 2&#8211;13 was used to screen for L-arginine amidinotransferase sequences. The screen for L-arginine oxidase/dehydrogenases was performed with the <it>aoxA </it>sequence from <it>Synechococcus elongatus </it>PCC 6301/PCC 7942.</p>
               </tblfn>
            </tbl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Presence of genes encoding enzymes of the L-arginine-degrading pathways in the genomes of selected marine and freshwater cyanobacteria.</p>
               </caption>
               <tblbdy cols="9">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Pathway</b>
                        </p>
                     </c>
                     <c cspan="8" ca="center">
                        <p>
                           <b>L-Arginine decarboxylase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzymes</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A2.1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A2.2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A2.3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A4</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>A6</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="9" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="9" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="9">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. A JA-3-3-AB</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. B JA-2-3B'a (2&#8211;13)</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>L-ornithine is formed from L-arginine by the enzymes arginase or L-arginine amidinotransferase. It is also formed in the 2<sup>nd </sup>reaction of the L-arginine deiminase pathway. Enzymes A5 and E3 are identical enzymes and both represent a 4-aminobutyrate transaminase. Enzymes A6 and E4 are identical and both represent a succinate semialdehyde dehydrogenase (Fig. 2). Enzymes A2.1, B1, and C1 represent ureohydrolases, and the same gene(s) is (are) annotated as an agmatinase (A2.1), an arginase (B1) or a 4-guanidinobutyrase (E2). The genes encoding the enzymes C1 and D1 are annotated as L-arginine amidinotransferase as well as L-arginine deiminase (see text for further details). N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Presence of genes encoding enzymes of the L-arginine-degrading pathways in the genomes of selected marine and freshwater cyanobacteria.</p>
               </caption>
               <tblbdy cols="16">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Pathway</b>
                        </p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>
                           <b>Arginase</b>
                        </p>
                     </c>
                     <c cspan="3" ca="center">
                        <p>
                           <b>L-Arginine amidinotransferase</b>
                        </p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>L-Arginine deiminase</b>
                        </p>
                     </c>
                     <c cspan="4" ca="center">
                        <p>
                           <b>L-Arginine oxidase/dehydrogenase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzymes</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>B1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>B2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>B3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>C1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>C2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>C3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D4</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E4</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="16" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="16" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="16">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. A JA-3-3-AB</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. B JA-2-3B'a (2&#8211;13)</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                     <c ca="center">
                        <p>+</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>In total, we found evidence for the presence of five putative pathways for L-arginine catabolism in the investigated genomes. These are an L-arginine decarboxylase pathway, an arginase pathway, an L-arginine amidinotransferase pathway, an L-arginine deiminase pathway, and an L-arginine oxidase/dehydrogenase pathway. These pathways are outlined (Fig. <figr fid="F2">2</figr>), and the accession numbers of the corresponding genes are given as supplement in Tables <tblr tid="T5">5</tblr>, <tblr tid="T6">6</tblr>, <tblr tid="T7">7</tblr>, <tblr tid="T8">8</tblr>, <tblr tid="T9">9</tblr>. No evidence has been found for the presence of an L-arginine succinyl transferase pathway.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Schematic presentation of putative L-arginine-degrading pathways in cyanobacteria with the corresponding enzymes, intermediate metabolites, and final products</p>
               </caption>
               <text>
                  <p><b>Schematic presentation of putative L-arginine-degrading pathways in cyanobacteria with the corresponding enzymes, intermediate metabolites, and final products</b>. Numbering of enzymes refers to the one used in Table 3, 4, and 5&#8211;9.</p>
               </text>
               <graphic file="1471-2164-8-437-2"/>
            </fig>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Database entries of genes from 24 cyanobacterial genomes encoding putative L-arginine decarboxylases (A1), agmatinases (A2.1), agmatine deiminases (A2.2), <it>N</it>-carbamoylputrescine hydrolases (A2.3), putrescine oxidases or putrescine transaminases (A3), and 4-aminobutyraldehyde dehydrogenases (A4) of the L-arginine decarboxylase pathway.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzyme</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A2.1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A2.2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A2.3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>A4</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>Pro1112, Pro0049</p>
                     </c>
                     <c ca="left">
                        <p>Pro1849</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Pro1045</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Pro1319</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>P9211_03242, P9211_08607</p>
                     </c>
                     <c ca="left">
                        <p>P9211_09067</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>P9211_03592</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>P9211_07012</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1095, PMT9312_0046</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1779</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0615</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>PMT1066, PMT2150</p>
                     </c>
                     <c ca="left">
                        <p>PMT2214</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMT0395</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMT0191</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>PMM1084, PMM0045</p>
                     </c>
                     <c ca="left">
                        <p>PMM1686</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMM0615</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMM1215, PMM0331</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0665, PMN2A_1378</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1287</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0052</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1709</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1621, Syncc9605_2513</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1082Syncc9605_2591</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1134</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0497</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1380, Syncc9902_2172</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_2230</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1323</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1838</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>SYNW0944, SYNW2359</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1412, SYNW2422</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1008</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>SYNW_1956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_04481, WH7805_10353</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_09974</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_01902</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_04905, WH5701_10310</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_03684, WH5701_03860</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_10020, WH5701_10155</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_06196</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_01007, RS9917_06495</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_06190</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_11395</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02641</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_1880</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_4111</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_2611CwatDRAFT_0842 CwatDRAFT_0969 CwatDRAFT_1032</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_0894, TeryDRAFT_0959, TeryDRAFT_0311</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT4567</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_0835</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3296, TeryDRAFT_3923</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>Syc0823_d, Syc0510_c</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>SYC1703_c, SYC1643_d</p>
                     </c>
                     <c ca="left">
                        <p>Syc1946_d, Syc1745_c</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Syc1030_d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0707, Synpcc7942_1037</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc79422402 Synpcc79422461</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc79422145 Synpcc79422358</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                     </c>
                     <c ca="left">
                        <p>CYA_1002, CYA_0128</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0859</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0558</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0364</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Synechococcus Yellowstone sp. JA-2-3Ba (2-13)  </it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CYB_2779, CYB_0482</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1744</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1181</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0715, CYB_1893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>Tlr1866, Tll1807</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0111</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0112, Tll0920</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0221</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Sll1683, Slr0662, Slr1312</p>
                     </c>
                     <c ca="left">
                        <p>Sll1077, Sll0228</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Sll0601, Sll1640</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Sll1495, Slr0370</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>Gll4070, Gll3478</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Glr1681</p>
                     </c>
                     <c ca="left">
                        <p>Glr1682, Glr2043</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Gll2207, Gll1504, Glr3848, Gll2805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>All3401, All4887</p>
                     </c>
                     <c ca="left">
                        <p>Alr2310</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Alr2001</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Alr2826, Alr3771, All3556, All5022</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>Npun02000556, Npun02000612</p>
                     </c>
                     <c ca="left">
                        <p>Npun02002114</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Npun02002053</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003427, Npun02002895, Npun02002692, Npun02003702</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2157, Ava_3423</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0127</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Ava_5061</p>
                     </c>
                     <c ca="left">
                        <p>n.d</p>
                     </c>
                     <c ca="left">
                        <p>Ava_1107, Ava_1554, Ava_3534, Ava_2258</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Database entries of genes from 24 cyanobacterial genomes encoding putative arginases (B1), L-ornithine transaminases (C2), and &#916;<sup>1 </sup>pyrroline-5-carboxylate dehydrogenases (C3) of the arginase pathway.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzyme</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>B1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>B2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>B3</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>Pro1849</p>
                     </c>
                     <c ca="left">
                        <p>Pro1375, Pro1626</p>
                     </c>
                     <c ca="left">
                        <p>Pro0374</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>P9211_09067</p>
                     </c>
                     <c ca="left">
                        <p>P9211_02002, P9211_10217</p>
                     </c>
                     <c ca="left">
                        <p>P9211_07012</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1779</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1397, PMT9312_1565</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>PMT2214</p>
                     </c>
                     <c ca="left">
                        <p>PMT0331, PMT1493</p>
                     </c>
                     <c ca="left">
                        <p>PMT0191</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>PMM1686</p>
                     </c>
                     <c ca="left">
                        <p>PMM1301, PMM1472</p>
                     </c>
                     <c ca="left">
                        <p>PMM0331</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1287</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0867, PMN2A_1003</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1709</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1082, Syncc9605_2591</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0858, Syncc9605_2052, Syncc9605_0659</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0497</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_2230</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1534, Syncc9902_0620</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1838</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1412, SYNW2422</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1634, SYNW0629</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_06086, WH7805_09974</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05656, WH7805_12388, WH7805_13803</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_06416</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_03684, WH5701_03860</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_07406, WH5701_15376</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_06196</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_06190</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02041, RS9917_05240</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02641</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_5161</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0865, CwatDRAFT_0842, CwatDRAFT_0969</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_4567</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3251</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_2672 TeryDRAFT_3296, TeryDRAFT_3923</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syc0599_c, Syc1466_c</p>
                     </c>
                     <c ca="left">
                        <p>Syc1030_d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0943, Synpcc7942_0031</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0859</p>
                     </c>
                     <c ca="left">
                        <p>CYA_1537, CYA_0689</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0364</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Synechococcus Yellowstone sp. JA-2-3Ba (2-13)</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>CYB_1744</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1419, CYB_2128</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0516, CYB_0715, CYB_1893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Tlr1328, Tlr0408, Tll1935</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0416, Tlr0221</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Sll1077, Sll0228</p>
                     </c>
                     <c ca="left">
                        <p>Slr1022</p>
                     </c>
                     <c ca="left">
                        <p>Sll1561, Slr0370, Slr0091</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Glr0547, Glr3849, Gll2223</p>
                     </c>
                     <c ca="left">
                        <p>Glr2755, Glr3848, Gll1504, Gll2805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Alr2310</p>
                     </c>
                     <c ca="left">
                        <p>Alr2398, Alr1080, All0396</p>
                     </c>
                     <c ca="left">
                        <p>Alr0540, Alr3771, All3556, All5022</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>Npun02002114</p>
                     </c>
                     <c ca="left">
                        <p>Npun02005728, Npun02001164, Npun02001509</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003702, Npun02006572, Npun02002895, Npun02002692</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0127</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0214, Ava_3730, Ava_2839</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2942, Ava_1554, Ava_3534, Ava_2258</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T7">
               <title>
                  <p>Table 7</p>
               </title>
               <caption>
                  <p>Database entries of genes from 24 cyanobacterial genomes encoding putative L-arginine amidinotransferases (C1), L-ornithine transaminases (C2), and &#916;<sup>1 </sup>pyrroline-5-carboxylate dehydrogenases (C3) of the L-arginine amidinotransferase pathway.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzyme</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C3</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Pro1375, Pro1626</p>
                     </c>
                     <c ca="left">
                        <p>Pro0374</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>P9211_02002, P9211_10217</p>
                     </c>
                     <c ca="left">
                        <p>P9211_07012</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1397, PMT9312_1565</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT0331, PMT1493</p>
                     </c>
                     <c ca="left">
                        <p>PMT0191</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMM1301, PMM1472</p>
                     </c>
                     <c ca="left">
                        <p>PMM0331</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0867, PMN2A_1003</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1709</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0858, Syncc9605_2052, Syncc9605_0659</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0497</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1534, Syncc9902_0620</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1838</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1634, SYNW0629</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05656, WH7805_12388, WH7805_13803</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_06416</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_07406, WH5701_15376</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_06196</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02041, RS9917_05240</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02641</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0830</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_5161</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0865, CwatDRAFT_0842, CwatDRAFT_0969</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_2282</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3251</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_2672 TeryDRAFT_3296, TeryDRAFT_3923</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syc0599_c, Syc1466_c</p>
                     </c>
                     <c ca="left">
                        <p>Syc1030_d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0943, Synpcc7942_0031</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYA_1537, CYA_0689</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0364</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone</it> sp. JA-2-3Ba (2-13)</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0250</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1419, CYB_2128</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0516, CYB_0715, CYB_1893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>Tll0507</p>
                     </c>
                     <c ca="left">
                        <p>Tlr1328, Tlr0408, Tll1935</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0416, Tlr0221</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Sll1336</p>
                     </c>
                     <c ca="left">
                        <p>Slr1022</p>
                     </c>
                     <c ca="left">
                        <p>Sll1561, Slr0370, Slr0091</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>Glr1758</p>
                     </c>
                     <c ca="left">
                        <p>Glr0547, Glr3849, Gll2223</p>
                     </c>
                     <c ca="left">
                        <p>Glr2755, Glr3848, Gll1504, Gll2805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Alr4495</p>
                     </c>
                     <c ca="left">
                        <p>Alr2398, Alr1080, All0396</p>
                     </c>
                     <c ca="left">
                        <p>Alr0540, Alr3771, All3556, All5022</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>Npun02001803</p>
                     </c>
                     <c ca="left">
                        <p>Npun02005728, Npun02001164, Npun02001509</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003702, Npun02006572, Npun02002895, Npun02002692</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2273</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0214, Ava_3730, Ava_2839</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2942, Ava_1554, Ava_3534, Ava_2258</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T8">
               <title>
                  <p>Table 8</p>
               </title>
               <caption>
                  <p>Database entries of genes from 24 cyanobacterial genomes encoding putative L-arginine deiminases (D1), L-ornithine transcarbamoylases (D2), carbamate kinases (D3), L-ornithine transaminases (D4), and &#916;<sup>1 </sup>pyrroline-5-carboxylate dehydrogenases (D5) of the L-arginine deiminase pathway.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzyme</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>D1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>D2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>D3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>D4</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>D5</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Pro1337, Pro0262</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Pro1375, Pro1626</p>
                     </c>
                     <c ca="left">
                        <p>Pro0374</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>P9211_0227, P9211_07567</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>P9211_02002, P9211_10217</p>
                     </c>
                     <c ca="left">
                        <p>P9211_07012</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1357</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1397, PMT9312_1565</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT0379, PMT1807</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT0331, PMT1493</p>
                     </c>
                     <c ca="left">
                        <p>PMT0191</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMM1263, PMM0233</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMM1301, PMM1472</p>
                     </c>
                     <c ca="left">
                        <p>PMM0331</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMN2S_0829</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0867, PMN2A_1003</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1709</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0926, Syncc9605_0292, Syncc9605_2634</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0858, Syncc9605_2052, Syncc9605_0659</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0497</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1482, Syncc9902_2261, Syncc9902_2051</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1534, Syncc9902_0620</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1838</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1586, SYNW2454, SYNW0296</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1634, SYNW0629</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05251, WH7805_09779, WH7805_07451</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05656, WH7805_12388, WH7805_13803</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_06416</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_14691, WH5701_01185</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_07406, WH5701_15376</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_06196</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>RS_01761, RS_10896, RS_03633</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02041, RS9917_05240</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02641</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0830</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_4406, CwatDRAFT_6596</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_5161</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0865, CwatDRAFT_0842, CwatDRAFT_0969</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_2282</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_0921, TeryDRAFT_1912</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3251</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_2672 TeryDRAFT_3296, TeryDRAFT_3923</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="6" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syc1592_c, Syc0859_c</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syc0599_c, Syc1466_c</p>
                     </c>
                     <c ca="left">
                        <p>Syc1030_d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc7942_2514, Syncc7942_0670</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0943, Synpcc7942_0031</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYA_2817, CYA_1730</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYA_1537, CYA_0689</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0364</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone</it> sp. JA-2-3Ba (2-13)</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0250</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0821, CYB_1917</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1419, CYB_2128</p>
                     </c>
                     <c ca="left">
                        <p>CYB_0516, CYB_0715, CYB_1893</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>Tll0507</p>
                     </c>
                     <c ca="left">
                        <p>Tll1106, Tll1558</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Tlr1328, Tlr0408, Tll1935</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0416, Tlr0221</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Sll1336</p>
                     </c>
                     <c ca="left">
                        <p>Sll0902, Slr1476</p>
                     </c>
                     <c ca="left">
                        <p>Sll0573</p>
                     </c>
                     <c ca="left">
                        <p>Slr1022</p>
                     </c>
                     <c ca="left">
                        <p>Sll1561, Slr0370, Slr0091</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>Glr1758</p>
                     </c>
                     <c ca="left">
                        <p>Gll3101, Gll2875</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Glr0547, Glr3849, Gll2223</p>
                     </c>
                     <c ca="left">
                        <p>Glr2755, Glr3848, Gll1504, Gll2805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Alr4495</p>
                     </c>
                     <c ca="left">
                        <p>Alr4907, All1681</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Alr2398, Alr1080, All0396</p>
                     </c>
                     <c ca="left">
                        <p>Alr0540, Alr3771, All3556, All5022</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>Npun02001803</p>
                     </c>
                     <c ca="left">
                        <p>Npun_02004258, Npun_02007755</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Npun02005728, Npun02001164, Npun02001509</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003702, Npun02006572, Npun02002895, Npun02002692</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2273</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2197, Ava_1174</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0214, Ava_3730, Ava_2839</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2942, Ava_1554, Ava_3534, Ava_2258</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <tbl id="T9">
               <title>
                  <p>Table 9</p>
               </title>
               <caption>
                  <p>Database entries of genes from 24 cyanobacterial genomes encoding putative L-arginine oxidase/dehydrogenase (E1), 4-guanidino butyrase (E2), 4-aminobutyrate transaminase (E3), and succinate semialdehyde dehydrogenase (E4) of the L-arginine oxidase/dehydrogenase pathway.</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzymes</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>E1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>E2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>E3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>E4</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5" ca="left">
                        <p>
                           <b>Marine species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS 120</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Pro1849</p>
                     </c>
                     <c ca="left">
                        <p>Pro1375, Pro0482, Pro1626</p>
                     </c>
                     <c ca="left">
                        <p>Pro0374</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>P9211_09067</p>
                     </c>
                     <c ca="left">
                        <p>P9211_02002, P9211_06427, P9211_10217</p>
                     </c>
                     <c ca="left">
                        <p>P9211_00350, P9211_07012</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1779</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_1397, PMT9312_0484, PMT9312_1565</p>
                     </c>
                     <c ca="left">
                        <p>PMT9312_0337</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMT2214</p>
                     </c>
                     <c ca="left">
                        <p>PMT0331, PMT1296, PMT0103, PMT1493</p>
                     </c>
                     <c ca="left">
                        <p>PMT0191</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED 4</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMM1686</p>
                     </c>
                     <c ca="left">
                        <p>PMM1301, PMM0483, PMM1472</p>
                     </c>
                     <c ca="left">
                        <p>PMM0331</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1287</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0867, PMN2A_1816, PMN2A_1003</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_1709</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9605</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1906, Syncc9605_0745</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_1082, Syncc9605_2591</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0858, Syncc9605_0659, Syncc9605_2052</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9605_0497</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. CC 9902</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_2230</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1534, Syncc9902_1701, Syncc9902_0620</p>
                     </c>
                     <c ca="left">
                        <p>Syncc9902_1838</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1412, SYNW2422</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1634, SYNW1809, SYNW0629</p>
                     </c>
                     <c ca="left">
                        <p>SYNW1956</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05376</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_09974</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_05656, WH7805_1303, WH7805_12388</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_06416</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 5701</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_04470</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_03684, WH5701_03860</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_07406, WH5701_10070, WH5701_15376</p>
                     </c>
                     <c ca="left">
                        <p>WH5701_06196</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS 9917</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_06190</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02041, RS9917_05240, RS9917_02041, RS9917_09251</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_02641</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Crocosphaera watsonii </it>WH 8501</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_5161, CwatDRAFT_2647</p>
                     </c>
                     <c ca="left">
                        <p>CwatDRAFT_0842, CwatDRAFT_0969, CwatDRAFT_0865, CwatDRAFT_1032</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_0956</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT4567</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3251, TeryDRAFT_3173</p>
                     </c>
                     <c ca="left">
                        <p>TeryDRAFT_3296, TeryDRAFT_3923, TeryDRAFT_3248</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Enzymes</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C3*</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>C4**</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5" ca="left">
                        <p>
                           <b>Freshwater species</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                     </c>
                     <c ca="left">
                        <p>Syc0596_c, Syc1144_c</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Syc0599_c, Syc1466_c, Syc0881_c</p>
                     </c>
                     <c ca="left">
                        <p>Syc1030_d</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0946, Synpcc7942_0369</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0943, Synpcc7942_0031, Synpcc7942_0645</p>
                     </c>
                     <c ca="left">
                        <p>Synpcc7942_0489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0859</p>
                     </c>
                     <c ca="left">
                        <p>CYA_1537, CYA_2386, CYA_0689</p>
                     </c>
                     <c ca="left">
                        <p>CYA_0364</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus Yellowstone</it> sp. JA-2-3Ba (2-13)</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1744</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1419, CYB_2128, CYB_1012</p>
                     </c>
                     <c ca="left">
                        <p>CYB_1893, CYB_1419, CYB_0715</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0479, Tlr1328, Tlr0408, Tlr1935</p>
                     </c>
                     <c ca="left">
                        <p>Tlr0221, Tlr0416</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Slr0782</p>
                     </c>
                     <c ca="left">
                        <p>Sll1077, Sll0228</p>
                     </c>
                     <c ca="left">
                        <p>Slr1022, Sll0017</p>
                     </c>
                     <c ca="left">
                        <p>Slr0370, Slr0091, Sll1561</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                     </c>
                     <c ca="left">
                        <p>Gll1123</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Glr3849, Glr0547, Glr0071, Gll2223</p>
                     </c>
                     <c ca="left">
                        <p>Glr3848, Gll1504, Gll2805</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Alr7169</p>
                     </c>
                     <c ca="left">
                        <p>Alr2310</p>
                     </c>
                     <c ca="left">
                        <p>Alr2398, Alr1080, All0396, Alr3265</p>
                     </c>
                     <c ca="left">
                        <p>Alr3771, All3556, Alr0540, All5022, Alr3672</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc punctiforme </it>PCC 73102</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003735</p>
                     </c>
                     <c ca="left">
                        <p>Npun02002114</p>
                     </c>
                     <c ca="left">
                        <p>Npun02005728, Npun02001509, Npun02001164, Npun02002747</p>
                     </c>
                     <c ca="left">
                        <p>Npun02003702, Npun02002895, Npun02002692, Npun02005276</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 29413</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0127</p>
                     </c>
                     <c ca="left">
                        <p>Ava_0214, Ava_3730, Ava_2839, Ava_4920</p>
                     </c>
                     <c ca="left">
                        <p>Ava_1554, Ava_3534, Ava_2942, Ava_2258, Ava_3615</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>N.d. = not detected.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>L-arginine decarboxylase pathway</p>
            </st>
            <p>One or several genes encoding L-arginine decarboxylase-type enzymes, which catalyze the formation of agmatine from L-arginine, are present in all investigated cyanobacteria (Fig. <figr fid="F2">2</figr>, Tables <tblr tid="T3">3</tblr> and <tblr tid="T5">5</tblr>). A putative agmatinase that converts agmatine to putrescine and urea is present in nineteen cyanobacterial strains. No such gene was identified in <it>Crocosphaera watsonii </it>WH 8501, <it>Synechococcus elongatus </it>PCC 6301, <it>Synechococcus elongatus </it>PCC 7942, <it>Thermosynechococcus elongatus </it>BP-1, and <it>Gloeobacter violaceus </it>PCC 7421. These strains, with the exception of <it>Crocosphaera watsonii </it>WH 8501, convert agmatine to putrescine via an agmatine deiminase and an <it>N</it>-carbamoylputrescine hydrolase. Since in none of the investigated cyanobacteria a putrescine oxidase or a putrescine transaminase encoding gene has been found, we consider the L-arginine decarboxylase pathway to be mainly responsible for the synthesis of the polyamines agmatine and putrescine as well as for production of ammonium from L-arginine. Putrescine can subsequently be converted to spermidine or spermine. Evidence for the utilization of putrescine by &#947;-glutamylation like in <it>E. coli </it><abbrgrp><abbr bid="B25">25</abbr></abbrgrp> was not found. However, since transaminases frequently show broad substrate specificity, we can not entirely exclude that a rather unspecific transaminase, which is not annotated as a putrescine transaminase, catalyzes the conversion of putrescine to 4-aminobutyr aldehyde. The subsequent dehydrogenase that converts the aldehyde to 4-aminobutyrate is present in 23 of the 24 investigated strains. Such an enzyme is absent in <it>Synechococcus </it>sp. WH 7805. The two enzymes, which catalyze the conversion of 4-aminobutyrate to succinate (4-aminobutyrate transaminase and succinate semialdehyde dehydrogenase) are present in all 24 strains. However, since 4-aminobutyrate also is an intermediate of the L-amino oxidase/dehydrogenase pathway and can additionally be formed by decarboxylation of L-glutamate, the presence of genes encoding the latter two enzymes not necessarily implies that a complete L-arginine decarboxylase pathway is present. Therefore, the question whether the L-arginine decarboxylase pathway only provides polyamines and ammonium or also allows for utilization of L-arginine as C-source can not be answered on the basis of the bioinformatic considerations.</p>
            <p>A phylogenetic tree of the L-arginine decarboxylases, which are present in the investigated cyanobacterial genomes, is given (Fig. <figr fid="F3">3</figr>) and shows that the cyanobacterial L-arginine decarboxylases cluster into four distinct groups. The clusters marked in green and yellow exclusively contain L-arginine decarboxylases of the marine non-N<sub>2</sub>-fixing strains, while the red and blue clusters contain L-arginine decarboxylases of freshwater cyanobacteria and of the two marine N<sub>2</sub>-fixing species <it>Crocosphaera watsonii </it>and <it>Trichodesmium erythraeum </it>IMS101. It should be pointed out that in species with more than several L-arginine decarboxylase(s) the corresponding enzymes always group into two different clusters. Thus, the marine as well as the fresh water cyanobacteria seem to have two distinct types of L-arginine decarboxylases.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Phylogenetic tree of cyanobacterial L-arginine decarboxylases</p>
               </caption>
               <text>
                  <p><b>Phylogenetic tree of cyanobacterial L-arginine decarboxylases</b>. The L-arginine decarboxylases are the same as in Table 3 and 5.</p>
               </text>
               <graphic file="1471-2164-8-437-3"/>
            </fig>
            <p>It has previously been shown by Sandmeier et al. <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> that amino acid decarboxylases in general can be subdivided into four different groups. These groups seem to be evolutionary unrelated to each other. In these subdivisions, the groups III and IV contain decarboxylases with specificity for basic L-amino acids. In addition, there is evidence that <it>E. coli </it>has two different L-arginine decarboxylases &#8211; a biosynthetic and a biodegradable form. The biodegradable L-arginine decarboxylase (P28629 &#8211; group III decarboxylase) is only induced in large amounts when cells are grown in rich medium containing L-arginine, while the biosynthetic enzyme (P21170 &#8211; group IV decarboxylase) is expressed constitutively <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>. On the basis of this classification, the red and green clusters (Fig. <figr fid="F3">3</figr>) contain L-arginine decarboxylases being more similar to group IV L-arginine decarboxylases, while the blue and yellow clusters contain L-arginine decarboxylases with higher similarity to group III L-arginine decarboxylases. The similarity of the biodegradable and the biosynthetic L-arginine decarboxylase of <it>E. coli </it>to selected marine and fresh water cyanobacterial L-arginine decarboxylases is presented in Table <tblr tid="T10">10</tblr>. E.g. the L-arginine decarboxylases Slr0662 and Slr1312 of <it>Synechocystis </it>sp. PCC 6803 in the red cluster have a higher similarity to the biosynthetic L-arginine decarboxylase (P21170) of group IV than to the biodegradable L-arginine decarboxylase P28629 of group III. In contrast, Sll1683 of <it>Synechocystis </it>sp. PCC 6803 has a higher similarity to P28629 (group III) than to P21170 (group IV) (Table <tblr tid="T10">10</tblr>). Thus, it is likely that the green and the red cluster (Fig. <figr fid="F3">3</figr>) contain L-arginine decarboxylases of the biosynthetic-type, while the yellow and blue clusters contain L-arginine decarboxylases of the biodegradative type.</p>
            <tbl id="T10">
               <title>
                  <p>Table 10</p>
               </title>
               <caption>
                  <p>Biochemical properties of selected L-arginine decarboxylases of freshwater and marine cyanobacteria, and their similarity to L-arginine decarboxylases from <it>E. coli</it>.</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Strain</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Database entry</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>AA</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>MM (kDa)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>pI</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p><b>Group III decarboxylase: </b><it>E. coli </it>P28629 (biodegradable type) 755 aa; 84.4 kDa; pI 5.12</p>
                     </c>
                     <c ca="center">
                        <p><b>Group IV decarboxylase: </b><it>E. coli </it>P21170 (biosynthetic type) 658 aa; 73.9 kDa; pI 4.83</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Score vs. P28629</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Score vs. P21170</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Yellow cluster decarboxylases</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. RS9917</p>
                     </c>
                     <c ca="left">
                        <p>RS9917_01007</p>
                     </c>
                     <c ca="center">
                        <p>470</p>
                     </c>
                     <c ca="center">
                        <p>50.4</p>
                     </c>
                     <c ca="center">
                        <p>9.64</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. NATL2A</p>
                     </c>
                     <c ca="left">
                        <p>PMN2A_0665</p>
                     </c>
                     <c ca="center">
                        <p>464</p>
                     </c>
                     <c ca="center">
                        <p>51.5</p>
                     </c>
                     <c ca="center">
                        <p>8.57</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS120</p>
                     </c>
                     <c ca="left">
                        <p>Pro1112</p>
                     </c>
                     <c ca="center">
                        <p>440</p>
                     </c>
                     <c ca="center">
                        <p>48.5</p>
                     </c>
                     <c ca="center">
                        <p>5.32</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 8102</p>
                     </c>
                     <c ca="left">
                        <p>SYNW0994</p>
                     </c>
                     <c ca="center">
                        <p>468</p>
                     </c>
                     <c ca="center">
                        <p>50.6</p>
                     </c>
                     <c ca="center">
                        <p>6.95</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Blue cluster decarboxylases</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Sll1683</p>
                     </c>
                     <c ca="center">
                        <p>483</p>
                     </c>
                     <c ca="center">
                        <p>51.8</p>
                     </c>
                     <c ca="center">
                        <p>5.44</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Gll3487</p>
                     </c>
                     <c ca="center">
                        <p>467</p>
                     </c>
                     <c ca="center">
                        <p>49.4</p>
                     </c>
                     <c ca="center">
                        <p>6.39</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                     </c>
                     <c ca="left">
                        <p>Tlr1866</p>
                     </c>
                     <c ca="center">
                        <p>437</p>
                     </c>
                     <c ca="center">
                        <p>46.6</p>
                     </c>
                     <c ca="center">
                        <p>5.22</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 2941</p>
                     </c>
                     <c ca="left">
                        <p>Ava_2157</p>
                     </c>
                     <c ca="center">
                        <p>488</p>
                     </c>
                     <c ca="center">
                        <p>52.0</p>
                     </c>
                     <c ca="center">
                        <p>5.34</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Green cluster decarboxylases</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>MED4</p>
                     </c>
                     <c ca="left">
                        <p>PMM0045</p>
                     </c>
                     <c ca="center">
                        <p>488</p>
                     </c>
                     <c ca="center">
                        <p>50.01</p>
                     </c>
                     <c ca="center">
                        <p>5.34</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9313</p>
                     </c>
                     <c ca="left">
                        <p>PMT2150</p>
                     </c>
                     <c ca="center">
                        <p>648</p>
                     </c>
                     <c ca="center">
                        <p>71.3</p>
                     </c>
                     <c ca="center">
                        <p>5.31</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>SS120</p>
                     </c>
                     <c ca="left">
                        <p>Pro0049</p>
                     </c>
                     <c ca="center">
                        <p>648</p>
                     </c>
                     <c ca="center">
                        <p>72.4</p>
                     </c>
                     <c ca="center">
                        <p>6.44</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechococcus </it>sp. WH 7805</p>
                     </c>
                     <c ca="left">
                        <p>WH7805_10353</p>
                     </c>
                     <c ca="center">
                        <p>636</p>
                     </c>
                     <c ca="center">
                        <p>69.9</p>
                     </c>
                     <c ca="center">
                        <p>5.24</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>36</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                     </c>
                     <c ca="left">
                        <p>P9211_08607</p>
                     </c>
                     <c ca="center">
                        <p>648</p>
                     </c>
                     <c ca="center">
                        <p>72.2</p>
                     </c>
                     <c ca="center">
                        <p>6.00</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>33</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="7" ca="left">
                        <p>
                           <b>Red cluster decarboxylases</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Synechocystis </it>sp. PCC 6803</p>
                     </c>
                     <c ca="left">
                        <p>Slr0662</p>
                        <p>Slr1312</p>
                     </c>
                     <c ca="center">
                        <p>695</p>
                        <p> 659</p>
                     </c>
                     <c ca="center">
                        <p>78.2</p>
                        <p> 74.5</p>
                     </c>
                     <c ca="center">
                        <p>5.08 </p>
                        <p>5.30</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                        <p> 4</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                        <p> 36</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Nostoc </it>sp. PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>All3401</p>
                     </c>
                     <c ca="center">
                        <p>671</p>
                     </c>
                     <c ca="center">
                        <p>75.7</p>
                     </c>
                     <c ca="center">
                        <p>5.25</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Anabaena variabilis </it>ATCC 2941</p>
                     </c>
                     <c ca="left">
                        <p>Ava_3423</p>
                     </c>
                     <c ca="center">
                        <p>671</p>
                     </c>
                     <c ca="center">
                        <p>75.7</p>
                     </c>
                     <c ca="center">
                        <p>5.25</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Gloeobacter violaceus </it>PCC 7120</p>
                     </c>
                     <c ca="left">
                        <p>Gll4070</p>
                     </c>
                     <c ca="center">
                        <p>644</p>
                     </c>
                     <c ca="center">
                        <p>72.7</p>
                     </c>
                     <c ca="center">
                        <p>5.10</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>P28629 represents a biodegradable and inducible L-arginine decarboxylase (group III); P21270 represents a biosynthetic and constitutively expressed L-arginine decarboxylase (group IV) in <it>E. coli </it>[26]. Score values were calculated with the ClustalW software [62]. The L-arginine decarboxylases in the yellow, blue, green, and red cluster are identical to those L-arginine decarboxylases given in Fig. 3.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Arginase pathway</p>
            </st>
            <p>Urea is released from L-arginine by an arginase in the arginase pathway, and the resulting L-ornithine is further catabolized to L-glutamate by L-ornithine transaminase and &#916;<sup>1</sup>pyrroline-5-carboxylate dehydrogenase (Fig. <figr fid="F2">2</figr>). In the presence of urease, urea is further degraded to ammonium. The arginase pathway seems to be widely distributed among the investigated cyanobacteria. Genes encoding the putative second and third enzyme of this pathway, the L-ornithine transaminase and the &#916;<sup>1</sup>pyrroline-5-carboxylate dehydrogenase, are present in all 24 investigated cyanobacteria. A gene encoding a putative arginase is only present in 19 of the investigated genomes (Tables <tblr tid="T4">4</tblr> and <tblr tid="T6">6</tblr>). Such a gene is absent in <it>Crocosphaera watsonii </it>WH 8501, <it>Synechococcus elongatus </it>PCC 6301, <it>Synechococcus elongatus </it>PCC 7942, <it>Thermosynechococcus elongatus </it>BP-1, and <it>Gloeobacter violaceus </it>PCC 7421. The likely absence of an arginase-type enzyme in five of the investigated 24 cyanobacterial strains is somewhat surprising, since arginases have been shown to be present in all so far investigated higher plants <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. However, since plant-type arginases represent a distinct group of ureohydrolases <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> (Fig. <figr fid="F4">4</figr>, ARGAH1 and AT4G08870) and localize in mitochondria <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, they may have originated from the predecessor organism, which gave rise to the evolutionary lineage of mitochondria.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Phylogenetic tree of ureohydrolases</p>
               </caption>
               <text>
                  <p><b>Phylogenetic tree of ureohydrolases</b>. For construction of the tree, selected sequences from eubacteria, fungi, plants, and animals were used in addition to the cyanobacterial sequences given (Tables 3 and 4). For details on the non-cyanobacterial sequences see Sekowska et al. [37] and Chen et al. [28]. Details on the cyanobacterial sequences are given (Tables 5, 6, and 9).</p>
               </text>
               <graphic file="1471-2164-8-437-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>L-arginine amidinotransferase pathway</p>
            </st>
            <p>In addition to arginases, L-ornithine may also be synthesized by L-arginine amidinotransferases (Fig. <figr fid="F2">2</figr>). A gene for such an enzyme was detected in the N<sub>2</sub>-fixing species <it>Nostoc </it>sp. PCC 7120, <it>Nostoc punctiforme </it>PCC 73102, <it>Anabaena variabilis </it>ATCC 29413, <it>Trichodesmium erythraeum </it>IMS 101, <it>Crocosphaera watsonii </it>WH 8501, <it>Synechococcus Yellowstone </it>sp. JA-2-3Ba' (2&#8211;13), and in the non-N<sub>2 </sub>fixing cyanobacteria <it>Synechocystis </it>sp. PCC 6803, <it>Thermosynechococcus elongatus </it>BP-1, and <it>Gloeobacter violaceus </it>PCC 7421 (Table <tblr tid="T4">4</tblr> and <tblr tid="T7">7</tblr>). Three of the five cyanobacteria without an arginase-type enzyme have a putative L-arginine amidinotransferase-type enzyme (<it>Crocosphaera watsonii </it>WH 8501, <it>Thermosynechococcus elongatus </it>BP-1, and <it>Gloeobacter violaceus </it>PCC 7421). Thus, <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942 are probably the only cyanobacterial strains among the 24 investigated ones, which are unable to form L-ornithine from L-arginine. Interestingly, they have a very active L-amino acid oxidase (AoxA) with high specificity for basic amino acids and a preference for L-arginine, utilizing molecular oxygen as an electron acceptor <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>L-arginine deiminase pathway</p>
            </st>
            <p>The L-arginine deiminase pathway is widely distributed among eubacteria and archaea <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp> and has also been discovered in a few primitive eukaryotes, e.g. in <it>Giardia intestinalis </it><abbrgrp><abbr bid="B30">30</abbr></abbrgrp>, <it>Trichomonas vaginalis </it><abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, and <it>Tritrichomonas foetus </it><abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. However, it has so far not been detected in multi-cellular organisms. The L-arginine deiminase pathway consists of three enzymes and catalyzes the production of ATP in its final enzymatic step. The first enzyme of this pathway is an L-arginine deiminase, which irreversibly converts L-arginine to L-citrulline and ammonium. The second and third enzymes are an L-ornithine transcarbamoylase and a carbamate kinase, respectively (Fig. <figr fid="F2">2</figr>). A gene encoding a putative L-arginine deiminase was detected in the N<sub>2</sub>-fixing species <it>Nostoc </it>sp. PCC 7120, <it>Nostoc punctiforme </it>PCC 73102, <it>Anabaena variabilis </it>ATCC 29413, <it>Trichodesmium erythraeum </it>IMS 101, <it>Crocosphaera watsonii </it>WH 8501, and <it>Synechococcus Yellowstone </it>sp. JA-2-3Ba' 2&#8211;13 as well as in the non-N<sub>2 </sub>fixing cyanobacteria <it>Synechocystis </it>sp. PCC 6803, <it>Thermosynechococcus elongatus </it>BP-1, and <it>Gloeobacter violaceus </it>PCC 7421 (Tables <tblr tid="T4">4</tblr> and <tblr tid="T8">8</tblr>). This gene is the same as the one being annotated encoding a putative L-arginine amidinotransferase (see below for discussion of this aspect). An L-ornithine transcarbamoylase is present in all investigated cyanobacteria. Since the majority of the investigated cyanobacteria have two genes encoding a putative L-ornithine transcarbamoylase, it is likely that they contain a catabolic and an anabolic enzyme <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B33">33</abbr></abbrgrp>. Surprisingly, a carbamate kinase, which catalyzes the last step of the deiminase pathway, has only been detected in <it>Synechocystis </it>sp. PCC 6803. An L-arginine deiminase activity has previously been detected in <it>Anabaena cylindrica </it><abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, <it>Anabaena variabilis </it><abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, <it>Nostoc </it>sp. PCC 73102 <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, and <it>Aphanocapsa </it>PCC 6308 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>L-arginine oxidase/dehydrogenase pathway</p>
            </st>
            <p>The fifth putative L-arginine catabolic pathway starts with an L-arginine oxidase/dehydrogenase-type enzyme. In this pathway L-arginine is converted to succinate via 2-ketoarginine, 4-guanidinobutyrate, and 4-aminobutyrate with a concomitant production of ammonium, carbon dioxide, and urea (Fig. <figr fid="F2">2</figr>). Ten out of 24 cyanobacterial species have one or two gene(s) encoding an L-arginine oxidase/dehydrogenase (Tables <tblr tid="T4">4</tblr> and <tblr tid="T9">9</tblr>), which is similar to an L-amino acid oxidase that is present in the two closely related strains <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942 <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. The corresponding L-amino acid oxidase of these two cyanobacteria is encoded by the <it>aoxA </it>genes YP_171306 and ZP_00164087 for <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942, respectively, and has been purified and partially characterized. This AoxA has a high specificity for basic L-amino acids as substrate with a preference for L-arginine. AoxA converts L-arginine to 2-ketoarginine and ammonium and utilizes oxygen as electron acceptor. When hydrogen peroxide is not removed by hydrogen peroxide decomposing enzymes, 2-ketoarginine is converted to 4-guanidinobutyrate in a non-enzymatic reaction. Seven of the 10 cyanobacteria, which have a putative L-arginine oxidase/dehydrogenase, also have a gene encoding a putative 4-guanidino butyrase (<it>Synechococcus </it>sp. CC 9605, <it>Synechococcus </it>sp. WH 7805, <it>Synechococcus </it>sp. WH 5701, <it>Trichodesmium erythraeum </it>IMS 101, <it>Synechocystis </it>sp. PCC 6803, <it>Nostoc </it>sp. PCC 7120, and <it>Nostoc punctiforme </it>PCC 73102), while the enzyme is absent in <it>Synechococcus elongatus </it>PCC 6301, <it>Synechococcus elongatus </it>PCC 7942, and <it>Gloeobacter violaceus </it>PCC 7421. The genes encoding the two enzymes which convert 4-aminobutyrate to succinate (4-aminobutyrate transaminase and succinate semialdehyde dehydrogenase) are present in all investigated cyanobacteria. The fact that 4-aminobutyrate is also an intermediate in the L-arginine decarboxylase pathway and can additionally be formed by decarboxylation of L-glutamate might explain the presence of these two enzymes even in those cyanobacteria that do not have an L-arginine oxidase/dehydrogenase. An L-arginine oxidase/dehydrogenase pathway, converting L-arginine to 4-aminobutyrate, was first described on the basis of detected products for <it>Streptomyces griseus </it><abbrgrp><abbr bid="B34">34</abbr></abbrgrp> and is also present in <it>Pseudomonas putida </it>(Trevisan) Migula P2 ATCC 25571. However, the first enzyme has not yet been characterized biochemically <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>L-arginine succinyl transferase pathway</p>
            </st>
            <p>We did not find evidence for the presence of an L-arginine succinyl transferase pathway in the genome sequences of the investigated 24 cyanobacterial strains. This pathway is suggested to be mainly limited to those heterotrophically growing eubacteria that have the ability to use L-arginine as both, a nitrogen and a carbon source <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Problems related to the bioinformatic analysis</p>
            </st>
            <p>All 24 investigated cyanobacterial genomes have a putative L-arginine decarboxylase pathway and one or several additional L-arginine-degrading pathways. These can either be an arginase pathway, an L-arginine amidinotransferase pathway, an L-arginine deiminase or an L-arginine oxidase/dehydrogenase pathway. Thus, all investigated cyanobacteria have at least two putative L-arginine-degrading pathways. However, the performed similarity searches do not always allow a statement whether all enzymes of the corresponding pathways are present and whether the gene products have indeed the enzymatic activity that has been assigned to them on the basis of the corresponding similarity searches and domain predictions. No matter what similarity search results suggest, a proof is only provided by activity measurements with purified enzymes. Therefore, uncertainties related to this aspect will be briefly discussed with respect to the enzymes being annotated as ureohydrolases <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and enzymes being annotated as L-arginine amidinotransferases or L-arginine deiminases. The latter two types of enzymes belong to the family of guanidino group modifiers <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>.</p>
            <sec>
               <st>
                  <p>Ureohydrolases</p>
               </st>
               <p>The bioinformatic evaluation of the 24 cyanobacterial genome sequences suggests the presence of (a) gene(s) encoding an arginase, an agmatinase, or a 4-guanidino butyrase in 19 cyanobacterial genomes. Five cyanobacterial species have neither an arginase- nor an agmatinase- nor a 4-guanidino butyrase-encoding gene (Tables <tblr tid="T4">4</tblr> and <tblr tid="T11">11</tblr>). Arginases, agmatinases, and 4-guanidino butyrases release urea from L-arginine (guanidino amino acid), agmatine (guanidino amine) or 4-guanidino butyrate (guanidino acid), respectively. All three types of enzymes belong to the group of ureohydrolases (C-N hydrolases), require the cofactor manganese, and might have an identical evolutionary origin. This implies that an ancient enzyme with broad substrate specificity has progressively been evolved to gain narrower substrate specificity during evolution. Therefore, it is extremely difficult to annotate these genes correctly with respect to the nature of their true substrate <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B39">39</abbr></abbrgrp>. According to Sekowska et al. <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, we constructed a phylogenetic distance tree (Fig. <figr fid="F4">4</figr>) with 20 sequences of arginases or agmatinases (given in that paper) as well as the sequences of two arginases from <it>Arabidopsis thaliana </it>and the sequences of cyanobacterial ureohydrolases (Table <tblr tid="T11">11</tblr>). The eukaryotic non-plant arginases cluster in one group (marked in red), while the majority of the cyanobacterial enzymes form two clusters containing either the enzymes from marine cyanobacteria (marked in yellow) or from freshwater cyanobacteria (marked in blue). The two plant arginases form a separate group <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and are more closely related to agmatinases (encoded by <it>speB</it>) than to the arginases from non-photosynthetic organisms of the red cluster. The green cluster contains 4-guanidino butyrases from <it>Pseudomonas aeruginosa </it>and <it>Pseudomonas putida </it>(GbuA_Paeru and GbuA_Pputi) and the cyanobacterial enzyme Sll1077 of <it>Synechocystis </it>sp. PCC 6803 (for relevance of this finding see below) as well as the enzymes of <it>Synechococcus </it>sp. CC 9605, <it>Synechococcus </it>sp. WH 8102, and <it>Synechococcus </it>sp. WH 5701. The similarity of these cyanobacterial enzymes to known 4-guanidino butyrases <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> suggests that these enzymes also have a 4-guanidino butyrase activity (Fig. <figr fid="F4">4</figr>). Since all other cyanobacterial ureohydrolases group into two separate clusters (blue and yellow cluster), it is likely that they do not represent 4-guanidino butyrases, but represent either an arginase or an agmatinase or an enzyme with both activities &#8211; albeit with different substrate affinities. It has been shown that the two arginases of <it>Lycopersicon esculentum </it>(tomato), which have an arginase activity, also have a very low agmatinase activity (0.2&#8211;0.5% of the arginase activity) <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Since the blue cluster contains <it>sll0228 </it>of <it>Synechocystis </it>sp. PCC 6803, which has been shown to encode an agmatinase <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B37">37</abbr></abbrgrp>, it is likely that at least some of the enzymes in the blue cluster are true agmatinases. To further investigate the real activity of the putative cyanobacterial ureohydrolases, the expression of the corresponding proteins in <it>E. coli </it>is required to allow activity measurements as was done for Sll0228 and Sll1077 of <it>Synechocystis </it>sp. PCC 6803. Although originally being annotated as arginases, neither Sll0228 nor Sll1077 have arginase activity <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B37">37</abbr></abbrgrp>. Sll0228 has been shown to have agmatinase activity, while Sll1077 has neither arginase nor an agmatinase activity <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and thus, most likely is a 4-guanidino butyrase (alignment of Sll1077 and GbuA from <it>Pseudomonas putida </it>F1, ZP_00902038 is given in Fig. <figr fid="F5">5</figr>).</p>
               <tbl id="T11">
                  <title>
                     <p>Table 11</p>
                  </title>
                  <caption>
                     <p>Genes encoding ureohydrolases in the investigated cyanobacterial marine and freshwater cyanobacteria.</p>
                  </caption>
                  <tblbdy cols="5">
                     <r>
                        <c ca="left">
                           <p>
                              <b>Strain</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>Database entry*</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>AA</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>MM (kDa)</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>pI</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="5">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="5" ca="left">
                           <p>
                              <b>Marine species</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="5">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>SS 120</p>
                        </c>
                        <c ca="left">
                           <p>Pro1849</p>
                        </c>
                        <c ca="left">
                           <p>303</p>
                        </c>
                        <c ca="left">
                           <p>33.6</p>
                        </c>
                        <c ca="left">
                           <p>6.32</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>str. MIT 9211</p>
                        </c>
                        <c ca="left">
                           <p>P9211_09067</p>
                        </c>
                        <c ca="left">
                           <p>296</p>
                        </c>
                        <c ca="left">
                           <p>32.7</p>
                        </c>
                        <c ca="left">
                           <p>6.45</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>MIT 9312</p>
                        </c>
                        <c ca="left">
                           <p>PMT9312_1779</p>
                        </c>
                        <c ca="left">
                           <p>293</p>
                        </c>
                        <c ca="left">
                           <p>32.6</p>
                        </c>
                        <c ca="left">
                           <p>5.38</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>MIT 9313</p>
                        </c>
                        <c ca="left">
                           <p>PMT2214</p>
                        </c>
                        <c ca="left">
                           <p>304</p>
                        </c>
                        <c ca="left">
                           <p>32.8</p>
                        </c>
                        <c ca="left">
                           <p>5.55</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>MED 4</p>
                        </c>
                        <c ca="left">
                           <p>PMM1686</p>
                        </c>
                        <c ca="left">
                           <p>294</p>
                        </c>
                        <c ca="left">
                           <p>32.6</p>
                        </c>
                        <c ca="left">
                           <p>5.13</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Prochlorococcus marinus </it>NATL 2A</p>
                        </c>
                        <c ca="left">
                           <p>PMN2A_1287</p>
                        </c>
                        <c ca="left">
                           <p>299</p>
                        </c>
                        <c ca="left">
                           <p>32.9</p>
                        </c>
                        <c ca="left">
                           <p>5.01</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. CC 9605</p>
                        </c>
                        <c ca="left">
                           <p>Syncc9605_1082</p>
                           <p>Syncc9605_2591</p>
                        </c>
                        <c ca="left">
                           <p>396</p>
                           <p>291</p>
                        </c>
                        <c ca="left">
                           <p>43.8</p>
                           <p>31.3</p>
                        </c>
                        <c ca="left">
                           <p>5.03</p>
                           <p>4.91</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. CC 9902</p>
                        </c>
                        <c ca="left">
                           <p>Syncc9902_2230</p>
                        </c>
                        <c ca="left">
                           <p>287</p>
                        </c>
                        <c ca="left">
                           <p>30.8</p>
                        </c>
                        <c ca="left">
                           <p>5.10</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. WH 8102</p>
                        </c>
                        <c ca="left">
                           <p>SYNW1412</p>
                           <p>SYNW2422</p>
                        </c>
                        <c ca="left">
                           <p>426</p>
                           <p>286</p>
                        </c>
                        <c ca="left">
                           <p>46.8</p>
                           <p>30.4</p>
                        </c>
                        <c ca="left">
                           <p>5.48</p>
                           <p>4.68</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. WH 7805</p>
                        </c>
                        <c ca="left">
                           <p>WH7805_06086</p>
                           <p>WH7805_09974</p>
                        </c>
                        <c ca="left">
                           <p>492</p>
                           <p>294</p>
                        </c>
                        <c ca="left">
                           <p>53.8</p>
                           <p>31.5</p>
                        </c>
                        <c ca="left">
                           <p>4.48</p>
                           <p>4.96</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. WH 5701</p>
                        </c>
                        <c ca="left">
                           <p>WH5701_03860</p>
                           <p>WH5701_03684</p>
                        </c>
                        <c ca="left">
                           <p>401</p>
                           <p>308</p>
                        </c>
                        <c ca="left">
                           <p>44.1</p>
                           <p>32.6</p>
                        </c>
                        <c ca="left">
                           <p>5.35</p>
                           <p>4.96</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus </it>sp. RS 9917</p>
                        </c>
                        <c ca="left">
                           <p>RS9917_06190</p>
                        </c>
                        <c ca="left">
                           <p>286</p>
                        </c>
                        <c ca="left">
                           <p>30.9</p>
                        </c>
                        <c ca="left">
                           <p>5.06</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Crocosphaera watsonii </it>WH 8501</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                        </c>
                        <c ca="left">
                           <p>Tery_3780</p>
                        </c>
                        <c ca="left">
                           <p>303</p>
                        </c>
                        <c ca="left">
                           <p>34.0</p>
                        </c>
                        <c ca="left">
                           <p>4.80</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="5">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="5" ca="left">
                           <p>
                              <b>Freshwater species</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="5">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus elongatus </it>sp. PCC 6301</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus elongatus </it>sp. PCC 7942</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus Yellowstone </it>sp. JA-3-3-AB</p>
                        </c>
                        <c ca="left">
                           <p>CYA_0859</p>
                        </c>
                        <c ca="left">
                           <p>301</p>
                        </c>
                        <c ca="left">
                           <p>33.1</p>
                        </c>
                        <c ca="left">
                           <p>5.51</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus Yellowstone </it>sp. JA-2-3B&#945; (2&#8211;13)</p>
                        </c>
                        <c ca="left">
                           <p>CYB_1744</p>
                        </c>
                        <c ca="left">
                           <p>307</p>
                        </c>
                        <c ca="left">
                           <p>33.7</p>
                        </c>
                        <c ca="left">
                           <p>5.23</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechocystis </it>sp. PCC 6803</p>
                        </c>
                        <c ca="left">
                           <p>Sll1077</p>
                           <p>Sll0228</p>
                        </c>
                        <c ca="left">
                           <p>390</p>
                           <p>306</p>
                        </c>
                        <c ca="left">
                           <p>42.9</p>
                           <p>33.5</p>
                        </c>
                        <c ca="left">
                           <p>5.06</p>
                           <p>4.90</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                        <c ca="left">
                           <p>n.d.</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Nostoc </it>sp. PCC 7120</p>
                        </c>
                        <c ca="left">
                           <p>Alr2310</p>
                        </c>
                        <c ca="left">
                           <p>346</p>
                        </c>
                        <c ca="left">
                           <p>38.6</p>
                        </c>
                        <c ca="left">
                           <p>4.69</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Nostoc punctiforme </it>PCC 73102</p>
                        </c>
                        <c ca="left">
                           <p>Npun02002114</p>
                        </c>
                        <c ca="left">
                           <p>347</p>
                        </c>
                        <c ca="left">
                           <p>38.5</p>
                        </c>
                        <c ca="left">
                           <p>4.53</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Anabaena variabilis </it>ATCC 29413</p>
                        </c>
                        <c ca="left">
                           <p>Ava_0127</p>
                        </c>
                        <c ca="left">
                           <p>346</p>
                        </c>
                        <c ca="left">
                           <p>38.5</p>
                        </c>
                        <c ca="left">
                           <p>4.66</p>
                        </c>
                     </r>
                  </tblbdy>
                  <tblfn>
                     <p>N.d. = not detected. *These ureohydrolases are annotated as arginases, as agmatinases as well as 4-guanidino butyrases. The (+) in Table 3 for A2.1, B1, and E2 refers to an identical gene, because the gene annotation does not distinguish between arginases, agmatinases, and 4-guanidino butyrases. A classification is only possible in a few cases, in which enzymatic activity has been measured or the similarity values are very high to already biochemically well-characterized enzymes (see text for details).</p>
                  </tblfn>
               </tbl>
               <fig id="F5">
                  <title>
                     <p>Figure 5</p>
                  </title>
                  <caption>
                     <p>ClustalW alignment of the putative 4-guanidino butyrase Sll1077 of <it>Synechocystis </it>sp. PCC 6803 and the 4-guanidino butyrase GbuA from <it>Pseudomonas putida </it>F1 (GbuA_Pputi, ZP_00902038; 25% identical, 20% similar, and 15% weakly similar amino acid residues)</p>
                  </caption>
                  <text>
                     <p><b>ClustalW alignment of the putative 4-guanidino butyrase Sll1077 of <it>Synechocystis </it>sp. PCC 6803 and the 4-guanidino butyrase GbuA from <it>Pseudomonas putida </it>F1 (GbuA_Pputi, ZP_00902038; 25% identical, 20% similar, and 15% weakly similar amino acid residues)</b>. * identical amino acid residues, : similar amino acid residues (A/V/F/P/M/I/L/W, D/E, R/H/K, S/T/Y/H/C/N/G/Q, and &#8226; weakly similar amino acid residues. Gaps were introduced into the sequences to maintain an optimal alignment.</p>
                  </text>
                  <graphic file="1471-2164-8-437-5"/>
               </fig>
            </sec>
            <sec>
               <st>
                  <p>Enzymes modifying the guanidino group</p>
               </st>
               <p>This family of enzymes comprises L-arginine deiminases and L-arginine amidinotransferases <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B41">41</abbr></abbrgrp>, which share common structural features <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. L-arginine deiminases participate in L-arginine catabolism and are found in prokaryotes <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B16">16</abbr><abbr bid="B42">42</abbr></abbrgrp> and primitive eukaryotes <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. L-arginine amidinotransferases have been shown to have a function as L-arginine:glycine amidinotransferase in creatine biosynthesis in vertebrates <abbrgrp><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>, as L-arginine:glycine amidinotransferase in the biosynthesis of the toxin cylindrospermopsin in various cyanobacteria <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, as L-arginine:inosamine phosphate amidinotransferase in streptomycin biosynthesis in <it>Streptomyces </it>spp. <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, and as L-arginine:L-lysine amidinotransferase in the phaseolotoxin biosynthesis in <it>Pseudomonas syringae </it>pv. <it>phaseolicola </it><abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. In nine cyanobacteria an identical gene was annotated as L-arginine amidinotransferase as well as L-arginine deiminase (Table <tblr tid="T4">4</tblr>). Thus, a decision, which of the two putative pathways is present, can not be made with certainty. The similarity of the cyanobacterial enzymes to characterized L-arginine deiminases is rather low and is even lower to L-arginine amidinotransferases (Table <tblr tid="T12">12</tblr>). However, since L-arginine amidinotransferases have so far only been shown to function in antibiotic or toxin biosynthesis in prokaryotes and since an L-arginine deiminase activity has been detected in several fresh water cyanobacteria <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>, we think that it is more likely that the corresponding gene in the nine cyanobacteria (Tables <tblr tid="T4">4</tblr>, <tblr tid="T7">7</tblr>, and <tblr tid="T8">8</tblr>) encodes an L-arginine deiminase and not an L-arginine amidinotransferase. One reason, why these genes have not yet been annotated as L-arginine deiminases in the databases, may be related to the fact that so far well characterized prokaryotic L-arginine deiminases consist of about 400 amino acid residues (Table <tblr tid="T12">12</tblr>) <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp> and that the L-arginine deiminase of the primitive eukaryote <it>Giardia intestinalis </it>consists of 580 amino acid residues <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. In contrast, the corresponding nine cyanobacterial genes encode proteins of 699 to 710 amino acid residues length with a molecular mass of 77.5 to 78.3 kDa. Among the cyanobacterial proteins a high similarity of about 80% exists (Table <tblr tid="T12">12</tblr>). Another unique property of cyanobacterial L-arginine deiminases is that they contain two transmembrane helixes in their C-terminal region. This implies that the cyanobacterial enzymes are membrane-bound or at least membrane-associated. Whether the enzymes are bound to the cytoplasmic or the thylakoid membrane is not yet known.</p>
               <tbl id="T12">
                  <title>
                     <p>Table 12</p>
                  </title>
                  <caption>
                     <p>Comparison of cyanobacterial putative L-arginine deiminases or L-arginine amidinotransferases to selected prokaryotic sequences and a sequence of a primitive eukaryote*.</p>
                  </caption>
                  <tblbdy cols="6">
                     <r>
                        <c ca="left">
                           <p>
                              <b>Strain</b>
                           </p>
                        </c>
                        <c ca="left">
                           <p>
                              <b>Database entry</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>AA</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>MM (kDa)</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>pI</b>
                           </p>
                        </c>
                        <c ca="center">
                           <p>
                              <b>Identity/similarity/gaps vs. Sll1336 (%)</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="6" ca="left">
                           <p>
                              <b>Cyanobacterial L-arginine deiminases or L-arginine amidinotransferases</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechocystis </it>sp. PCC 6803</p>
                        </c>
                        <c ca="left">
                           <p>Sll1336</p>
                        </c>
                        <c ca="center">
                           <p>705</p>
                        </c>
                        <c ca="center">
                           <p>78.3</p>
                        </c>
                        <c ca="center">
                           <p>5.40</p>
                        </c>
                        <c ca="center">
                           <p>100.0/100.0/0.0</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Crocosphaera watsonii </it>WH 8501</p>
                        </c>
                        <c ca="left">
                           <p>CwatDRAFT_0830</p>
                        </c>
                        <c ca="center">
                           <p>703</p>
                        </c>
                        <c ca="center">
                           <p>78.0</p>
                        </c>
                        <c ca="center">
                           <p>5.15</p>
                        </c>
                        <c ca="center">
                           <p>78.0/88.8/0.3</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Trichodesmium erythraeum </it>IMS 101</p>
                        </c>
                        <c ca="left">
                           <p>Tery_4659</p>
                        </c>
                        <c ca="center">
                           <p>703</p>
                        </c>
                        <c ca="center">
                           <p>77.8</p>
                        </c>
                        <c ca="center">
                           <p>5.43</p>
                        </c>
                        <c ca="center">
                           <p>74.3/85.7/1.1</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Synechococcus Yellowstone </it>sp. JA-2-3B&#945; (2&#8211;13)</p>
                        </c>
                        <c ca="left">
                           <p>YP_476511</p>
                        </c>
                        <c ca="center">
                           <p>710</p>
                        </c>
                        <c ca="center">
                           <p>78.2</p>
                        </c>
                        <c ca="center">
                           <p>5.75</p>
                        </c>
                        <c ca="center">
                           <p>64.1/79.0/2.1</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Thermosynechococcus elongatus </it>BP-1</p>
                        </c>
                        <c ca="left">
                           <p>Tll0507</p>
                        </c>
                        <c ca="center">
                           <p>699</p>
                        </c>
                        <c ca="center">
                           <p>77.5</p>
                        </c>
                        <c ca="center">
                           <p>5.53</p>
                        </c>
                        <c ca="center">
                           <p>71.3/84.9/1.4</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Gloeobacter violaceus </it>PCC 7421</p>
                        </c>
                        <c ca="left">
                           <p>Glr1758</p>
                        </c>
                        <c ca="center">
                           <p>699</p>
                        </c>
                        <c ca="center">
                           <p>77.5</p>
                        </c>
                        <c ca="center">
                           <p>5.53</p>
                        </c>
                        <c ca="center">
                           <p>63.7/78.6/2.1</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Nostoc </it>sp. PCC 7120</p>
                        </c>
                        <c ca="left">
                           <p>Alr4995</p>
                        </c>
                        <c ca="center">
                           <p>703</p>
                        </c>
                        <c ca="center">
                           <p>77.9</p>
                        </c>
                        <c ca="center">
                           <p>5.41</p>
                        </c>
                        <c ca="center">
                           <p>73.4/85.7/0.8</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Nostoc punctiforme </it>PCC 73102</p>
                        </c>
                        <c ca="left">
                           <p>Npun02001803</p>
                        </c>
                        <c ca="center">
                           <p>703</p>
                        </c>
                        <c ca="center">
                           <p>77.9</p>
                        </c>
                        <c ca="center">
                           <p>5.48</p>
                        </c>
                        <c ca="center">
                           <p>74.6/86.6/1.4</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Anabaena variabilis </it>ATCC 29413</p>
                        </c>
                        <c ca="left">
                           <p>Ava_2273</p>
                        </c>
                        <c ca="center">
                           <p>703</p>
                        </c>
                        <c ca="center">
                           <p>78.2</p>
                        </c>
                        <c ca="center">
                           <p>5.38</p>
                        </c>
                        <c ca="center">
                           <p>73.7/86.6/0.8</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="6" ca="left">
                           <p>
                              <b>L-arginine deiminases of prokaryotes and a primitive eukaryote*</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Giardia intestinales*</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>AAC06116</p>
                        </c>
                        <c ca="center">
                           <p>580</p>
                        </c>
                        <c ca="center">
                           <p>64.1</p>
                        </c>
                        <c ca="center">
                           <p>6.11</p>
                        </c>
                        <c ca="center">
                           <p>13.9/22.3/53.1</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Thermoplasma volcanium </it>GSS1</p>
                        </c>
                        <c ca="left">
                           <p>NP_110996</p>
                        </c>
                        <c ca="center">
                           <p>418</p>
                        </c>
                        <c ca="center">
                           <p>48.1</p>
                        </c>
                        <c ca="center">
                           <p>5.32</p>
                        </c>
                        <c ca="center">
                           <p>10.2/18.1/65.7</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p><it>Thermoplasma acidophilum </it>DSM 1728</p>
                        </c>
                        <c ca="left">
                           <p>NP_394447</p>
                        </c>
                        <c ca="center">
                           <p>418</p>
                        </c>
                        <c ca="center">
                           <p>47.7</p>
                        </c>
                        <c ca="center">
                           <p>5.20</p>
                        </c>
                        <c ca="center">
                           <p>8.7/17.5/65.5</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Pseudomonas aeruginosa</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>P13981</p>
                        </c>
                        <c ca="center">
                           <p>418</p>
                        </c>
                        <c ca="center">
                           <p>46.4</p>
                        </c>
                        <c ca="center">
                           <p>5.52</p>
                        </c>
                        <c ca="center">
                           <p>7.3/12.0/74.9</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Enterococcus faecalis</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>CAC41341</p>
                        </c>
                        <c ca="center">
                           <p>408</p>
                        </c>
                        <c ca="center">
                           <p>46.7</p>
                        </c>
                        <c ca="center">
                           <p>4.87</p>
                        </c>
                        <c ca="center">
                           <p>7.4/14.8/71.6</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Bacillus licheniformis</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>AAU25597</p>
                        </c>
                        <c ca="center">
                           <p>411</p>
                        </c>
                        <c ca="center">
                           <p>47.2</p>
                        </c>
                        <c ca="center">
                           <p>5.28</p>
                        </c>
                        <c ca="center">
                           <p>7.8/13.2/73.3</p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c cspan="6" ca="left">
                           <p>
                              <b>Characterized L-arginine amidinotransferases</b>
                           </p>
                        </c>
                     </r>
                     <r>
                        <c cspan="6">
                           <hr/>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Rattus norvegicus</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>AAA21250</p>
                        </c>
                        <c ca="center">
                           <p>423</p>
                        </c>
                        <c ca="center">
                           <p>48.2</p>
                        </c>
                        <c ca="center">
                           <p>7.17</p>
                        </c>
                        <c ca="center">
                           <p>6.3/9.5/82.1</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Streptomyces griseus</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>CAA68517</p>
                        </c>
                        <c ca="center">
                           <p>347</p>
                        </c>
                        <c ca="center">
                           <p>38.7</p>
                        </c>
                        <c ca="center">
                           <p>5.12</p>
                        </c>
                        <c ca="center">
                           <p>9.0/12.7/72.5</p>
                        </c>
                     </r>
                     <r>
                        <c ca="left">
                           <p>
                              <it>Aphanizoemon ovalisporum</it>
                           </p>
                        </c>
                        <c ca="left">
                           <p>AAM33469</p>
                        </c>
                        <c ca="center">
                           <p>392</p>
                        </c>
                        <c ca="center">
                           <p>44.8</p>
                        </c>
                        <c ca="center">
                           <p>5.40</p>
                        </c>
                        <c ca="center">
                           <p>8.0/13.2/74.3</p>
                        </c>
                     </r>
                  </tblbdy>
                  <tblfn>
                     <p>L-arginine deiminases and L-arginine amidinotransferases belong to a superfamily of enzymes that catalyze the modification of guanidino groups. The number of amino acid residues, the molecular mass, and the calculated isoelectric point is given. Moreover, the similarity of the selected reference enzymes to Sll1336 from <it>Synechocystis </it>sp. PCC 6803 is given. Values for % identity and similarity to Sll1336 were determined with the EMBOSS Pairwise alignment algorithm [65]. The percentage identity and similarity does not include weakly similar amino acid residues.</p>
                  </tblfn>
               </tbl>
            </sec>
         </sec>
         <sec>
            <st>
               <p>Identification of genes encoding enzymes of L-arginine catabolizing pathways in Synechocystis sp. PCC 6803</p>
            </st>
            <p>We chose <it>Synechocystis </it>sp. PCC 6803 as a model organism to present more details on the enzymes of the L-arginine-degrading pathways and to validate the bioinformatic results by a transcript analysis. The reason for choosing this cyanobacterium is based on previously published results, showing that <it>Synechocystis </it>sp. PCC 6803 possesses a very effective uptake system for L-arginine <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Moreover, several products of L-arginine degradation have already been identified <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. In addition, substantial differences in the utilization of L-arginine as sole N-source in the growth medium have been observed between <it>Synechocystis </it>sp. PCC 6803 WT and a PsbO-free <it>Synechocystis </it>mutant <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>.</p>
            <p><it>Synechocystis </it>sp. PCC 6803 contains genes encoding enzymes of a putative L-arginine decarboxylase pathway, an L-arginine deiminase pathway, and an L-arginine oxidase/dehydrogenase pathway (Tables <tblr tid="T3">3</tblr>, <tblr tid="T4">4</tblr>, <tblr tid="T13">13</tblr>, and Fig. <figr fid="F6">6</figr>).</p>
            <tbl id="T13">
               <title>
                  <p>Table 13</p>
               </title>
               <caption>
                  <p>Presence of genes in the <it>Synechocystis </it>sp. PCC 6803 genome encoding putative enzymes of an L-arginine decarboxylase-, an L-arginine deiminase-, and an L-arginine oxidase/dehydrogenase pathway.</p>
               </caption>
               <tblbdy cols="10">
                  <r>
                     <c ca="left">
                        <p>
                           <b>L-arginine-degrading pathways in <it>Synechocystis </it>sp. PCC 6803</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>ORF</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Database #</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Length (aa)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>pI</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>MW (kDa)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Best hit vs. gene</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Organism</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>E-value</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Similarity (ident./pos. aa)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="10" ca="left">
                        <p>
                           <b>L-Arginine decarboxylase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L-Arginine decarboxylase (A1)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1683</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440109</p>
                     </c>
                     <c ca="center">
                        <p>483</p>
                     </c>
                     <c ca="center">
                        <p>5.44</p>
                     </c>
                     <c ca="center">
                        <p>51.84</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>speA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. subtilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.0e-103</p>
                     </c>
                     <c ca="center">
                        <p>40/61</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0662</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442871</p>
                     </c>
                     <c ca="center">
                        <p>695</p>
                     </c>
                     <c ca="center">
                        <p>5.08</p>
                     </c>
                     <c ca="center">
                        <p>78.24</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>speA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>X. campestris</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>2.0e-134</p>
                     </c>
                     <c ca="center">
                        <p>41/56</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr1312</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_439907</p>
                     </c>
                     <c ca="center">
                        <p>659</p>
                     </c>
                     <c ca="center">
                        <p>5.30</p>
                     </c>
                     <c ca="center">
                        <p>74.48</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>speA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>X. campestris</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.0e-121</p>
                     </c>
                     <c ca="center">
                        <p>38/56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Agmatinase (A2.1)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1077</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440618</p>
                     </c>
                     <c ca="center">
                        <p>390</p>
                     </c>
                     <c ca="center">
                        <p>5.06</p>
                     </c>
                     <c ca="center">
                        <p>42.96</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>speB2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.1e-40</p>
                     </c>
                     <c ca="center">
                        <p>33/41</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0228</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440030</p>
                     </c>
                     <c ca="center">
                        <p>306</p>
                     </c>
                     <c ca="center">
                        <p>4.90</p>
                     </c>
                     <c ca="center">
                        <p>33.46</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>speB</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. subtilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.6e-22</p>
                     </c>
                     <c ca="center">
                        <p>30/45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Putrescine oxidase or transaminase (A3)</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="left">
                        <p>n.d.</p>
                     </c>
                     <c ca="center">
                        <p>n.d.</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4-Aminobutyraldehyde dehydrogenase (A4)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1495</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442886</p>
                     </c>
                     <c ca="center">
                        <p>397</p>
                     </c>
                     <c ca="center">
                        <p>8.43</p>
                     </c>
                     <c ca="center">
                        <p>43.54</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>BMEII0291</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. melitensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.2e-93</p>
                     </c>
                     <c ca="center">
                        <p>42/61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4-Aminobutyrate transaminase (A5)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr1022</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440479</p>
                     </c>
                     <c ca="center">
                        <p>429</p>
                     </c>
                     <c ca="center">
                        <p>5.11</p>
                     </c>
                     <c ca="center">
                        <p>46.54</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabT</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>6.7e-58</p>
                     </c>
                     <c ca="center">
                        <p>33/50</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0017</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442115</p>
                     </c>
                     <c ca="center">
                        <p>433</p>
                     </c>
                     <c ca="center">
                        <p>5.13</p>
                     </c>
                     <c ca="center">
                        <p>45.87</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabT</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>E. coli</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.7e-41</p>
                     </c>
                     <c ca="center">
                        <p>30/44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Succinate semialdehyde dehydrogenase (A6)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0370</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442020</p>
                     </c>
                     <c ca="center">
                        <p>454</p>
                     </c>
                     <c ca="center">
                        <p>5.02</p>
                     </c>
                     <c ca="center">
                        <p>48.75</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabD</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>X. campestris</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.0e-121</p>
                     </c>
                     <c ca="center">
                        <p>47/65</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1561</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_441689</p>
                     </c>
                     <c ca="center">
                        <p>990</p>
                     </c>
                     <c ca="center">
                        <p>5.46</p>
                     </c>
                     <c ca="center">
                        <p>110.03</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabD</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>2.7e-66</p>
                     </c>
                     <c ca="center">
                        <p>17/25</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="10" ca="left">
                        <p>
                           <b>L-Arginine deiminase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L-Arginine deiminase (D1)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1336</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442829</p>
                     </c>
                     <c ca="center">
                        <p>705</p>
                     </c>
                     <c ca="center">
                        <p>5.40</p>
                     </c>
                     <c ca="center">
                        <p>78.33</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cyb_250</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>S. yellowstone</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>0.0</p>
                     </c>
                     <c ca="center">
                        <p>61/79</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L-Ornithine transcarbamoylase (D2)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0902</it>
                        </p>
                        <p>
                           <it> slr1476</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442776</p>
                        <p>NP_441572</p>
                     </c>
                     <c ca="center">
                        <p>308</p>
                        <p>331</p>
                     </c>
                     <c ca="center">
                        <p>5.38</p>
                        <p>6.53</p>
                     </c>
                     <c ca="center">
                        <p>33.62</p>
                        <p>33.39</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>argF</it>
                        </p>
                        <p>
                           <it> argF</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                        <p>
                           <it> P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.1e-77</p>
                        <p> 7.2e-13</p>
                     </c>
                     <c ca="center">
                        <p>47/66</p>
                        <p>26/42</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Carbamate kinase (D3)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0573</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_443041</p>
                     </c>
                     <c ca="center">
                        <p>308</p>
                     </c>
                     <c ca="center">
                        <p>5.66</p>
                     </c>
                     <c ca="center">
                        <p>32.93</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ygcA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>E. coli</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>8.1e-52</p>
                     </c>
                     <c ca="center">
                        <p>41/58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L-Ornithine transaminase (D4)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr1022</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440479</p>
                     </c>
                     <c ca="center">
                        <p>429</p>
                     </c>
                     <c ca="center">
                        <p>5.11</p>
                     </c>
                     <c ca="center">
                        <p>46.54</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>rocD</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. subtilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>2.1e-61</p>
                     </c>
                     <c ca="center">
                        <p>32/52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#916;<sup>1</sup>Pyrroline-5-carboxylate dehydrogenase (D5)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0370</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442020</p>
                     </c>
                     <c ca="center">
                        <p>454</p>
                     </c>
                     <c ca="center">
                        <p>5.02</p>
                     </c>
                     <c ca="center">
                        <p>48.75</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>ycgN</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. subtilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>7.9e-40</p>
                     </c>
                     <c ca="center">
                        <p>26/40</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#916;<sup>1</sup>Pyrroline-5-carboxylate reductase</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0661</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442689</p>
                     </c>
                     <c ca="center">
                        <p>128</p>
                     </c>
                     <c ca="center">
                        <p>5.11</p>
                     </c>
                     <c ca="center">
                        <p>14.4</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0661</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>S. PCC </it>6803</p>
                     </c>
                     <c ca="left">
                        <p>0.0</p>
                     </c>
                     <c ca="center">
                        <p>100/100</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Proline oxidase</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1561</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_441689</p>
                     </c>
                     <c ca="center">
                        <p>990</p>
                     </c>
                     <c ca="center">
                        <p>5.46</p>
                     </c>
                     <c ca="center">
                        <p>110.03</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>rocA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>B. subtilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>6.0e-138</p>
                     </c>
                     <c ca="center">
                        <p>25/34</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="10" ca="left">
                        <p>
                           <b>L-Arginine oxidase/dehydrogenase</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L-Arginine oxidase/dehydrogenase (E1)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0782</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442072</p>
                     </c>
                     <c ca="center">
                        <p>471</p>
                     </c>
                     <c ca="center">
                        <p>5.19</p>
                     </c>
                     <c ca="center">
                        <p>51.37</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>aoxA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>S. elongatus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.7e-18</p>
                     </c>
                     <c ca="center">
                        <p>20/35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4-Guanidino butyrase (E2)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1077</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440618</p>
                     </c>
                     <c ca="center">
                        <p>390</p>
                     </c>
                     <c ca="center">
                        <p>5.06</p>
                     </c>
                     <c ca="center">
                        <p>42.96</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gbuA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.1e-40</p>
                     </c>
                     <c ca="center">
                        <p>26/41</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0228</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440030</p>
                     </c>
                     <c ca="center">
                        <p>306</p>
                     </c>
                     <c ca="center">
                        <p>4.90</p>
                     </c>
                     <c ca="center">
                        <p>33.46</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gbuA</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1.1e-19</p>
                     </c>
                     <c ca="center">
                        <p>26/41</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4-Aminobutyrate transaminase (E3)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr1022</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_440479</p>
                     </c>
                     <c ca="center">
                        <p>429</p>
                     </c>
                     <c ca="center">
                        <p>5.11</p>
                     </c>
                     <c ca="center">
                        <p>46.54</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabT</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>6.7e-58</p>
                     </c>
                     <c ca="center">
                        <p>33/50</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll0017</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442115</p>
                     </c>
                     <c ca="center">
                        <p>433</p>
                     </c>
                     <c ca="center">
                        <p>5.13</p>
                     </c>
                     <c ca="center">
                        <p>45.87</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabT</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.7e-41</p>
                     </c>
                     <c ca="center">
                        <p>30/44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Succinate semialdehyde dehydrogenase (E4)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>slr0370</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_442020</p>
                     </c>
                     <c ca="center">
                        <p>454</p>
                     </c>
                     <c ca="center">
                        <p>5.02</p>
                     </c>
                     <c ca="center">
                        <p>48.75</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabD</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>X. campestris</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>5.0e-121</p>
                     </c>
                     <c ca="center">
                        <p>47/65</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>sll1561</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NP_441689</p>
                     </c>
                     <c ca="center">
                        <p>990</p>
                     </c>
                     <c ca="center">
                        <p>5.46</p>
                     </c>
                     <c ca="center">
                        <p>110.03</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>gabD</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>P. aeruginosa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>2.7e-66</p>
                     </c>
                     <c ca="center">
                        <p>17/25</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>The letters with numbers in parenthesis behind the enzyme names correspond to those given in Tables 3 and 4, and Fig. 2. In <it>Synechocystis </it>sp. PCC 6803 the gene <it>slr1022 </it>has similarity to L-ornithine transaminases and to 4-aminobutyrate transaminases. The L-ornithine transferase (D2) and the 4-aminobutyrate transferase (E3) both belong to the group of class III aminotransferases (InterProScan), which explains why the same gene <it>slr1022 </it>is annotated either as L-ornithine transaminase or as 4-aminobutyrate transaminase. The gene <it>slr0370 </it>has similarity to the &#916;<sup>1</sup>pyrroline-5-carboxylate dehydrogenase (D5) and to succinate semialdehyde dehydrogenase (E4). Both enzymes belong to the NAD-dependent aldehyde dehydrogenases (InterProScan), which explains why the same gene <it>slr0370 </it>is either annotated as &#916;<sup>1</sup>pyrroline-5-carboxylate dehydrogenase or succinate semialdehyde dehydrogenase Thus, it can not be decided in a bioinformatic approach whether the gene products Slr1022 and Slr0370 are components of the L-arginine deiminase pathway or the L-arginine oxidase/dehydrogenase pathway or of both pathways. N.d. = not detected.</p>
               </tblfn>
            </tbl>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Schematic presentation of the three L-arginine-degrading pathways in <it>Synechocystis </it>sp. PCC 6803 with the corresponding enzymes, intermediates, cofactors, and final products</p>
               </caption>
               <text>
                  <p><b>Schematic presentation of the three L-arginine-degrading pathways in <it>Synechocystis </it>sp. PCC 6803 with the corresponding enzymes, intermediates, cofactors, and final products</b>. <b>A)</b>. L-arginine decarboxylase pathway most likely only provides polyamines and ammonia. <b>B) </b>L-arginine deiminase pathway degrades L-arginine via L-citrulline to L-ornithine and carbamoyl phosphate. L-ornithine is further metabolized via glutamate semialdehyde to L-glutamate. Glutamate semialdehyde can also be converted to L-proline via &#916;<sup>1</sup>pyrroline-5-carboxylate. Carbamoyl phosphate is further metabolized to ammonium and carbon dioxide. This enzymatic reaction is catalyzed by the enzyme carbamate kinase and is coupled to ATP synthesis. <b>C) </b>The L-arginine oxidase/dehydrogenase pathway converts L-arginine to succinate via 2-ketoarginine, 4-guanidinobutyrate, 4-aminobutyrate, and succinate semialdehyde.</p>
               </text>
               <graphic file="1471-2164-8-437-6"/>
            </fig>
            <p>Three genes, <it>sll1683</it>, <it>slr0662</it>, and <it>slr1312</it>, encoding enzymes with similarity to L-arginine decarboxylases, are present. As shown in Table <tblr tid="T10">10</tblr>, Sll1683 has a higher similarity to the biodegradable than to the biosynthetic L-arginine decarboxylase of <it>E. coli</it>. In contrast, Slr0662 and Slr1312 have higher similarity to the biosynthetic than to the biodegradable enzyme. Moreover, two genes, <it>sll1077 </it>and <it>sll0228</it>, encoding proteins with similarity to ureohydrolases, were detected. Sll0228, but not Sll1077, has been shown to have agmatinase activity, catalyzing the synthesis of putrescine <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B37">37</abbr></abbrgrp>. However, no true putrescine oxidase or putrescine transaminase encoding genes were found in the genome of <it>Synechocystis </it>sp. PCC 6803. Therefore, the L-arginine decarboxylase pathway may mainly serve as a route for polyamine biosynthesis and for the production of ammonium from L-arginine. This assumption is in agreement with results obtained for pseudomonads, which were shown to an L-arginine decarboxylase pathway <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>.</p>
            <p>Sll1336 has the common features of an L-arginine amidinotransferase as well as of an L-arginine deiminase. However, since L-arginine amidinotransferases are predominantly involved in antibiotic or toxin synthesis in prokaryotes, it is more likely that Sll1336 is an L-arginine deiminase. This is supported by the fact that Sll1336 has a slightly higher similarity to sequenced L-arginine deiminases than to L-arginine amidinotransferases (Table <tblr tid="T12">12</tblr>). The highest similarity of Sll1336 (705 aa) exists to the L-arginine deiminase ArcA from <it>Giardia intestinales </it>(580 aa, 43% overall similar amino acid residues: 10% identical, 19% strongly similar, and 14% weakly similar amino acid residues). Thus, Sll1336 (705 aa) is substantially larger than the average L-arginine deiminases of primitive eukaryotes (~580 aa) or of heterotrophically growing prokaryotes (~400 aa) (Table <tblr tid="T12">12</tblr> and Fig. <figr fid="F7">7</figr>). In contrast to the bacterial enzymes, the L-arginine deiminase of <it>Synechocystis </it>sp. PCC 6803 (and of all other investigated cyanobacterial species) also has two putative transmembrane helices in the C-terminal region between the amino acid residues 630 to 651 and between the amino acid residues 674 and 692 (Fig. <figr fid="F7">7</figr>). The prediction was carried out with three different software packages (DAS Transmembrane Prediction Server <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>; TMpred Server <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>; TopPred Server <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>. Therefore, Sll1336 is bound either to the cytoplasmic or the thylakoid membrane.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>ClustalW alignment of the putative L-arginine deiminase Sll1336 of <it>Synechocystis </it>sp. PCC 6803 and the L-arginine deiminase ArcA from the primitive eukaryote <it>Giardia intestinales</it></p>
               </caption>
               <text>
                  <p><b>ClustalW alignment of the putative L-arginine deiminase Sll1336 of <it>Synechocystis </it>sp. PCC 6803 and the L-arginine deiminase ArcA from the primitive eukaryote <it>Giardia intestinales</it></b>. Both proteins share 43% overall similarity (10% identical, 19% strongly similar, 14% weakly similar amino acid residues. * Identical amino acid residues, : similar amino acid residues (A/V/F/P/M/I/L/W, D/E, R/H/K, S/T/Y/H/C/N/G/Q, and &#8226; weakly similar amino acid residues. Gaps were introduced into the sequences to maintain an optimal alignment. Two putative transmembrane helices of Sll0573 are boxed (see text for details).</p>
               </text>
               <graphic file="1471-2164-8-437-7"/>
            </fig>
            <p>Like all other investigated cyanobacteria, <it>Synechocystis </it>sp. PCC 6803 has an L-ornithine transcarbamoylase (Slr1022), but it is the only species among the investigated strains, which has a gene encoding a carbamate kinase (<it>sll0573</it>). This enzyme shows an intriguingly high degree of similarity to carbamate kinases from other eubacteria. Sll0573 (32 kDa and calculated pI 5.66) has an overall similarity of 71% (41% identical, 19% strongly similar, and 11% weakly similar amino acid residues) to the carbamate kinase ArcC from <it>Enterococcus faecalis </it>(32.9 kDa and calculated pI 5.13) and an overall similarity of 82% (55% identical, 18% strongly similar, 9% weakly similar amino acid residues) to ArcC from <it>Pseudomonas aeruginosa </it>(33 kDa and calculated pI 5.25) (Fig. <figr fid="F8">8</figr>). Thus, it is likely that the second possible route for L-arginine degradation in <it>Synechocystis </it>sp. PCC 6803 is an L-arginine deiminase pathway leading to synthesis of L-citrulline and subsequently to L-ornithine, carbon dioxide, ammonium, and ATP (Fig. <figr fid="F6">6</figr>). L-ornithine becomes further metabolized to L-glutamate by an L-ornithine transaminase (Slr1022) and a &#916;<sup>1</sup>pyrroline-5-carboxylate dehydrogenase (Slr0370) (Table <tblr tid="T11">11</tblr>). This pathway also leads to the synthesis of L-proline via a &#916;<sup>1</sup>pyrroline-5-carboxylate reductase (ProC, Slr0661), and L-proline can be converted back to this intermediate by a proline oxidase (PutA, Sll1561) <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
            <fig id="F8">
               <title>
                  <p>Figure 8</p>
               </title>
               <caption>
                  <p>ClustalW alignment of the putative carbamate kinase Sll0573 of <it>Synechocystis </it>sp. PCC 6803 and the carbamate kinase ArcC from <it>Pseudomonas aeruginosa</it></p>
               </caption>
               <text>
                  <p><b>ClustalW alignment of the putative carbamate kinase Sll0573 of <it>Synechocystis </it>sp. PCC 6803 and the carbamate kinase ArcC from <it>Pseudomonas aeruginosa</it></b>. Both proteins share 82% overall similarity (55% identical, 18% strongly similar, 9% weakly similar amino acid residues. * Identical amino acid residues, : similar amino acid residues (A/V/F/P/M/I/L/W, D/E, R/H/K, S/T/Y/H/C/N/G/Q, and &#8226; weakly similar amino acid residues. Gaps were introduced into the sequences to maintain an optimal alignment. Two putative transmembrane helices of Sll0573 are boxed (see text for details).</p>
               </text>
               <graphic file="1471-2164-8-437-8"/>
            </fig>
            <p>The third possible route of L-arginine catabolism in <it>Synechocystis </it>sp. PCC 6803 may be an L-arginine oxidase/dehydrogenase pathway. The gene <it>slr0782 </it>encodes a putative L-arginine oxidase/dehydrogenase, <it>sll1077 </it>and <it>sll0228 </it>encode putative ureohydrolases, <it>slr1022 </it>and <it>sll0017 </it>encode putative 4-aminobutyrate transaminases, and <it>slr0370</it>, <it>sll1561</it>, and <it>slr0091 </it>encode putative succinate semialdehyde dehydrogenases. Thus, L-arginine becomes degraded to succinate, carbon dioxide, and ammonium, via 2-ketoarginine, 4-guanidinobutyrate, and 4-aminobutyrate. Since the ureohydrolase Sll1077 groups with known 4-guanidino butyrases (Fig. <figr fid="F4">4</figr>), and the heterologously expressed enzyme has neither an arginase nor an agmatinase activity <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, this enzyme may indeed be a 4-guanidino butyrase. An alignment of the enzyme with the biochemically identified 4-guanidino butyrase of <it>Pseudomonas putida </it>strain F1 (ZP_00902038) is given (Fig. <figr fid="F5">5</figr>).</p>
            <p>The first enzyme of the L-arginine oxidase/dehydrogenase pathway (Slr0782) in <it>Synechocystis </it>sp. PCC 6803 has 58% similarity (20% identical, 24% similar, and 14% weakly similar amino acid residues) to an L-amino acid oxidase (AoxA) from <it>Synechococcus elongatus </it>PCC 6301, encoded by the <it>aoxA </it>gene (YP_171306) <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. This enzyme catalyzes the oxidative deamination of basic L-amino acids with a preference for L-arginine. An alignment of Slr0782 with AoxA of <it>Synechococcus elongatus </it>PCC 6301 is given and shows that Slr0782 has a dinucleotide-binding site (GxGxxG) <abbrgrp><abbr bid="B55">55</abbr></abbrgrp> like the AoxA enzyme (Fig. <figr fid="F9">9</figr>). Thus, Slr0782 may also be a FAD-containing enzyme. Since we were never able to detect an L-arginine oxidizing activity with utilization of molecular oxygen in intact cells or cell extracts of <it>Synechocystis </it>sp. PCC 6803 so far (unpublished results), it is more likely that Slr0782 interacts in a complex not yet understood way with the electron transport chain. This is in agreement with the fact that the enzyme has two hydrophobic regions possibly being transmembrane helices. We would like to also point out that <it>Synechococcus elongatus </it>PCC 6301 has an additional gene encoding a protein called AoxB (YP_171854), which has 59% similarity (25% identical, 21% similar, and 13% weakly similar amino acid residues) to AoxA <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. AoxB has not yet been characterized biochemically. Slr0782 of <it>Synechocystis </it>sp. PCC 6803 has a higher similarity to AoxB (in total 66% similarity: 31% identical, 22% similar, and 13% weakly similar amino acid residues) than to AoxA (in total 58% similarity). It should also be mentioned that the genomes of different <it>Pseudomonas </it>species contain a gene encoding an enzyme, which has similarity to Slr0782 (<it>P. putida </it>KT2440, NP_747085; <it>P. putida </it>F1, ZP_00902633; <it>P. aeruginosa </it>PAO-1, NP_249112; <it>P fluorescens </it>PfO-1, YP_348469). The similarity of Slr0782 to the enzyme of <it>P. fluorescens </it>corresponds to 47% (27% identical, 17% similar, and 13% weakly similar amino acid residues). All these enzymes contain a dinucleotide-binding GxGxxG motif and thus, are likely FAD-containing dehydrogenases and not aminotransferases <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>. For <it>Pseudomonas putida </it>(Trevisan) Migula P2 ATCC 2557 the Rodwell group has indeed suggested that an L-amino acid oxidase is the first enzyme degrading L-arginine via 2-ketoarginine, 4-guanidinobutyrate, and 4-aminobutyrate to succinate <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>.</p>
            <fig id="F9">
               <title>
                  <p>Figure 9</p>
               </title>
               <caption>
                  <p>ClustalW alignment of the putative L-arginine oxidase/dehydrogenase Slr0782 from <it>Synechocystis </it>sp. PCC 6803 with the characterized L-amino acid oxidase AoxA from <it>Synechococcus elongatus </it>PCC 6301 (P72346) [23]</p>
               </caption>
               <text>
                  <p><b>ClustalW alignment of the putative L-arginine oxidase/dehydrogenase Slr0782 from <it>Synechocystis </it>sp. PCC 6803 with the characterized L-amino acid oxidase AoxA from <it>Synechococcus elongatus </it>PCC 6301 (P72346) [23]</b>. Both proteins share an overall similarity of 57% (21% identical, 23% similar, and 13% weakly amino acid residues). The dinucleotide binding motif GxGxxG is boxed. * Identical amino acid residues, : similar amino acid residues (A/V/F/P/M/I/L/W, D/E, R/H/K, S/T/Y/H/C/N/G/Q, and &#8226; weakly similar amino acid residues. Gaps were introduced into the sequences to maintain an optimal alignment. Two putative transmembrane helices (aa 628&#8211;648; aa 670&#8211;690) were detected for Slr0782 using the DAS TM prediction algorithm [52]. Slr0782 also has 66% similarity (31% identical; 22% strongly similar, and 13% weakly similar amino acid residues) to AoxB of <it>Synechococcus elongatus </it>PCC 6301, an enzyme not yet characterized.</p>
               </text>
               <graphic file="1471-2164-8-437-9"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Detection of transcripts for L-arginine-degrading enzymes in <it>Synechocystis </it>sp. PCC 6803</p>
            </st>
            <p>The bioinformatic evaluation suggests the presence of three putative L-arginine-degrading pathways in <it>Synechocystis </it>sp. PCC 6803. These putative pathways are an L-arginine decarboxylase pathway (three isoenzymes as first enzyme: Sll1683, Slr0662, and Slr1312), an L-arginine deiminase pathway (first enzyme Sll1336), and an L-arginine oxidase/dehydrogenase pathway (first enzyme Slr0782) (Fig. <figr fid="F6">6</figr>).</p>
            <p>For detection of the corresponding transcripts, <it>Synechocystis </it>sp. PCC 6803 was cultivated with nitrate or with L-arginine as sole N-source and with an illumination of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1 </sup>for three days. These growth conditions were similar to those published previously <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> for experiments to determine products of L-arginine degradation. The growth curves and the chlorophyll content are given in Fig. <figr fid="F10">10</figr>. <it>Synechocystis </it>sp. PCC 6803 grew about equally well with nitrate as with L-arginine. Total RNA was isolated from the corresponding cultures and was applied to RNA slot-blot hybridization with selected Dig-dUTP-labeled gene-specific DNA probes (Fig. <figr fid="F11">11</figr>). Equal length, concentration, almost equal GC-content of the probes, and equal exposure time allowed for semi-quantitative comparison of mRNA levels of all five investigated transcripts: <it>sll1683</it>, <it>sll0662</it>, and <it>slr1312 </it>encoding isoenzymes of L-arginine decarboxylases, <it>sll1336 </it>encoding an L-arginine deiminase, and <it>slr0782 </it>encoding an L-arginine oxidase/dehydrogenase. The transcript level for the three L-arginine decarboxylase-encoding genes was low when the cells grew with nitrate and did not or only slightly increase when the cells grew with L-arginine as sole N-source. A low steady-state mRNA level was also observed for <it>sll0228 </it>transcript (not shown), which encodes an agmatinase-type enzyme <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B51">51</abbr></abbrgrp> &#8211; the second enzyme in the L-arginine decarboxylase pathway. This implies that the L-arginine decarboxylase pathway probably has its only function in polyamine biosynthesis and does not represent a major pathway for L-arginine degradation in <it>Synechocystis </it>sp. PCC 6803 when cells grew with L-arginine as sole N-source.</p>
            <fig id="F10">
               <title>
                  <p>Figure 10</p>
               </title>
               <caption>
                  <p>Growth and phenotypical appearance of <it>Synechocystis </it>sp. PCC 6803 cells grown in the presence of nitrate or L-arginine as sole N-source and with a light intensity of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1 </sup>for 24, 48 or 72 hours</p>
               </caption>
               <text>
                  <p>Growth and phenotypical appearance of <it>Synechocystis </it>sp. PCC 6803 cells grown in the presence of nitrate or L-arginine as sole N-source and with a light intensity of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1 </sup>for 24, 48 or 72 hours.</p>
               </text>
               <graphic file="1471-2164-8-437-10"/>
            </fig>
            <fig id="F11">
               <title>
                  <p>Figure 11</p>
               </title>
               <caption>
                  <p>Slot-blot transcript analysis of the genes encoding the first putative enzymes of the L-arginine deiminase pathway (<it>sll1336</it>), the L-arginine oxidase/dehydrogenase pathway (<it>slr0782</it>), and the L-arginine decarboxylase pathway (three possible deiminase-encoding genes: <it>sll1683</it>, <it>sll0662</it>, and <it>slr1312</it>) in <it>Synechocystis </it>sp. PCC 6803</p>
               </caption>
               <text>
                  <p><b>Slot-blot transcript analysis of the genes encoding the first putative enzymes of the L-arginine deiminase pathway (<it>sll1336</it>), the L-arginine oxidase/dehydrogenase pathway (<it>slr0782</it>), and the L-arginine decarboxylase pathway (three possible deiminase-encoding genes: <it>sll1683</it>, <it>sll0662</it>, and <it>slr1312</it>) in <it>Synechocystis </it>sp. PCC 6803</b>. <it>Synechocystis </it>sp. PCC 6803 cells were grown for 24, 48, or 72 h with nitrate or L-arginine as sole N-source and with a constant illumination of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1</sup>. Steady state transcript pools were investigated with gene-specific probes of equal length and equal GC % content to assure equal labeling with Dig-dUTP. An <it>rnpB</it>-specific probed was used to assure equal loading. The figure allows for a direct comparison of the various transcript concentrations. Moreover, changes in transcript level can be compared in cells grown with L-arginine (increase or decrease) to that grown with nitrate.</p>
               </text>
               <graphic file="1471-2164-8-437-11"/>
            </fig>
            <p>As shown in Fig. <figr fid="F11">11</figr>, the transcript levels for the L-arginine deiminase (Sll1336) as well as for the L-arginine oxidase/dehydrogenase (Slr0782) were substantially higher than for the three L-arginine decarboxylase isoenzymes. The steady-state transcript levels for these two enzymes were as high in nitrate-grown cells as in L-arginine-grown cells. This suggests that these two genes are transcribed constitutively. The same is true for the transcripts of the subsequent enzymes of the two pathways with the exception of the carbamate kinase transcript (Fig. <figr fid="F12">12</figr> and <figr fid="F13">13</figr>). The mRNA for the carbamate kinase was lower than for the other enzymes and the steady-state transcript level was found to be highly increased in L-arginine-grown cells.</p>
            <fig id="F12">
               <title>
                  <p>Figure 12</p>
               </title>
               <caption>
                  <p>Slot-blot transcript analysis of the genes encoding the putative enzymes of the L-arginine deiminase pathway in <it>Synechocystis </it>sp. PCC 6803</p>
               </caption>
               <text>
                  <p><b>Slot-blot transcript analysis of the genes encoding the putative enzymes of the L-arginine deiminase pathway in <it>Synechocystis </it>sp. PCC 6803</b>. <it>Synechocystis </it>sp. PCC 6803 cells were grown for 24, 48, or 72 h with nitrate or L-arginine as sole N-source and with a constant illumination of 50 photons m<sup>-2 </sup>s<sup>-1</sup>. Steady state transcript pools were investigated with gene-specific probes of equal length and equal GC % content to assure equal labeling with Dig-dUTP. An <it>rnpB</it>-specific probed was used to assure equal loading. The figure allows for the direct comparison of transcript levels between cells grown with L-arginine to that grown with nitrate.</p>
               </text>
               <graphic file="1471-2164-8-437-12"/>
            </fig>
            <fig id="F13">
               <title>
                  <p>Figure 13</p>
               </title>
               <caption>
                  <p>Slot-blot transcript analysis of the genes encoding the putative enzymes of the L-arginine oxidase/dehydrogenase pathway in <it>Synechocystis </it>sp. PCC 6803</p>
               </caption>
               <text>
                  <p><b>Slot-blot transcript analysis of the genes encoding the putative enzymes of the L-arginine oxidase/dehydrogenase pathway in <it>Synechocystis </it>sp. PCC 6803</b>. <it>Synechocystis </it>sp. PCC 6803 cells were grown for 24, 48, or 72 h with nitrate or L-arginine as sole N-source and with a constant illumination of 50 photons m<sup>-2 </sup>s<sup>-1</sup>. Steady state transcript pools were investigated with gene-specific probes of equal length and equal GC% content to assure equal labeling with Dig-dUTP. An <it>rnpB</it>-specific probed was used to assure equal loading. The figure allows for the direct comparison of transcript levels between cells grown with L-arginine to that grown with nitrate.</p>
               </text>
               <graphic file="1471-2164-8-437-13"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The bioinformatic evaluation of 24 cyanobacterial genomes suggests the presence of an L-arginine decarboxylase-, an arginase-, an L-arginine amidinotransferase-, an L-arginine deiminase-, and an L-arginine oxidase/dehydrogenase pathway in the investigated cyanobacteria (Tables <tblr tid="T3">3</tblr> and <tblr tid="T4">4</tblr>, and Fig. <figr fid="F2">2</figr>). All investigated strains contain an L-arginine decarboxylase pathway, which most likely mainly facilitates polyamine biosynthesis. Since extracellularly added putrescine has been shown to be toxic, at least for some cyanobacteria <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>, it is unlikely that this pathway is a major pathway for L-arginine degradation. In addition to the L-arginine decarboxylase pathway, one or two further L-arginine-degrading pathway(s) is (are) present, which is either an arginase pathway, an L-arginine deiminase pathway or an L-arginine oxidase/dehydrogenase pathway. Although an L-arginine amidinotransferase pathway can not be excluded entirely, this pathway is rather unlikely to have a major function in L-arginine degradation, since L-arginine amidinotransferases seem to mainly function in antibiotic and toxin production in prokaryotes <abbrgrp><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp>.</p>
         <p>An interesting result of the bioinformatic analysis is the observation that the cyanobacterial L-arginine deiminases, being present in nine cyanobacterial strains (Table <tblr tid="T4">4</tblr>), are substantially larger than the corresponding enzymes from non-photosynthetic eubacteria (Table <tblr tid="T12">12</tblr>). Further, they seem to be bound either to the cytoplasmic or the thylakoid membrane. In bacteria it has been shown that the L-arginine deiminase pathway is regulated in a rather complex way in dependence of the L-arginine and oxygen concentration, the redox poise, and/or energy status of the cell <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>. On the basis of the larger size and the predicted membrane association of the cyanobacterial L-arginine deiminases, the regulation of the L-arginine deiminase pathway in cyanobacteria maybe even more complex than in bacteria. This has also to be seen under the aspect that this pathway leads to ATP synthesis in the last enzymatic step providing an additional substrate-level phosphorylation site.</p>
         <p>The second rather unexpected observation is the presence of a putative L-arginine oxidase/dehydrogenase pathway in ten cyanobacteria (Table <tblr tid="T4">4</tblr>). The first enzyme of this pathway has similarity to an L-amino acid oxidase, catalyzing the oxidative deamination of basic L-amino acids with a preference for L-arginine and with oxygen as electron acceptor in <it>Synechococcus elongatus </it>PCC 6301 and PCC 7942. This pathway has not yet been investigated in detail. However, preliminary results, which had been obtained with <it>Synechocystis </it>sp. PCC 6803, suggest that the first enzyme of this pathway does not represent an L-arginine oxidase with oxygen as electron acceptor, but rather represents an L-arginine dehydrogenase, which interacts in a complex not yet understood with the electron transport chain. An interaction of amino acid dehydrogenases with the respiratory electron transport chain has previously been shown for <it>E. coli </it><abbrgrp><abbr bid="B57">57</abbr></abbrgrp>.</p>
         <p>In addition to the overview on L-arginine-degrading pathways in 24 cyanobacteria, we have performed a more detailed evaluation of the pathways in <it>Synechocystis </it>sp. PCC 6803. This investigation provided evidence that <it>Synechocystis </it>sp. PCC 6803 has three putative L-arginine-degrading pathways, being an L-arginine decarboxylase pathway, an L-arginine deiminase pathway, and an L-arginine oxidase/dehydrogenase pathway. An arginase pathway does not seem to exist, since the two proteins, originally annotated as arginases, do not possess an arginase activity <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B51">51</abbr></abbrgrp>. Transcript analyses revealed that the mRNA levels for the three isoenzymes of L-arginine decarboxylase (Slr1312, Slr0662, and Sll1683) and also for the agmatinase Sll0228 were rather low in <it>Synechocystis </it>sp. PCC 6803 in nitrate- or L-arginine-grown cells. Thus, this pathway probably has its major function in polyamine biosynthesis. In contrast, the transcript levels for a putative L-arginine deiminase pathway (first enzyme: Sll1336) and an L-arginine oxidase/dehydrogenase pathway (first enzyme: Slr0782) were high whether L-arginine or nitrate was the N-source, suggesting that these two pathways are the major L-arginine-degrading pathways and that they are expressed constitutively. The only exception is the carbamate kinase, whose transcript was found at elevated levels in L-arginine-grown cells. The lack of a substantial up-regulation of these transcripts, when cells were transferred from a nitrate-containing medium to an L-arginine-containing medium and an illumination of 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1 </sup>light, suggests that these pathways, besides having a function in the utilization of extracellular L-arginine, have a role in the complex dynamic metabolism of cyanophycin, which is not yet fully understood <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>. Such a functional L-arginine deiminase pathway would account for the products of L-arginine degradation identified in <it>Synechocystis </it>sp. PCC 6803 <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. The bioinformatic evaluation in combination with the transcript analysis suggests that <it>Synechocystis </it>sp. PCC 6803 has an unusual L-arginine deiminase and an unusual L-arginine oxidase/dehydrogenase as the major L-arginine-degrading enzymes. An extended biochemical investigation of these two enzymes and the corresponding pathways is required before a statement can be made on how these two pathways are integrated in the overall C- and N-metabolism in <it>Synechocystis </it>sp. PCC 6803.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Bioinformatic analyses and tools for the interpretation of genomic DNA sequences</p>
            </st>
            <p>Bacterial genome sequences were obtained from the Kyoto Encyclopedia of Genes and Genomes database (KEGG). Database searches and similarity searches were done as described in Rueckert <it>et al.</it><abbrgrp><abbr bid="B58">58</abbr></abbrgrp> with nucleotide and amino acid sequences using the BlastN- and BlastP-algorithms <abbrgrp><abbr bid="B59">59</abbr></abbrgrp>. Multiple sequence alignments were performed using the DIALIGN2 software <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. The phylogenetic trees were calculated using the neighbor-joining method <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>, which is integrated in the ClustalX software package <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. The results were visualized as a radial tree with the interactive phylogenetic tree plotting program TreeTool <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Cyanobacterial strains, growth conditions, and cell harvest</p>
            </st>
            <p><it>Synechocystis </it>sp. strain PCC 6803 was obtained from the Pasteur Culture Collection of Cyanobacterial Strains, Paris, France. Cells were grown in gas wash bottles with a capacity of 250 ml in a stream of 2% carbon dioxide in air at 30&#176;C. Growth either with nitrate or L-arginine as sole nitrogen source was performed basically according to Stephan <it>et al.</it><abbrgrp><abbr bid="B10">10</abbr></abbrgrp> except that the light intensity has been reduced from 200 to 50 &#956;mol photons m<sup>-2 </sup>s<sup>-1</sup>. Under these conditions the <it>Synechocystis </it>sp. PCC 6803 can grow with L-arginine without a stress phenotype. The standard inoculation corresponded to an absorbance of 0.3 at 750 nm (OD<sub>750 nm</sub>). Growth was determined as OD<sub>750 nm </sub>of <it>Synechocystis </it>sp. PCC 6803 cultures. After 24, 48, and 72 h cells were mixed 1:1 with crushed ice and harvested by centrifugation for 5 min at 4.000 &#215; g in a table top centrifuge. Isolation of total RNA was performed as described previously <abbrgrp><abbr bid="B64">64</abbr></abbrgrp> combined with an on-column DNase digestion step with the RNase-free DNase set from Qiagen (Qiagen, Hilden, Germany).</p>
         </sec>
         <sec>
            <st>
               <p>Quantification of steady-state mRNA pools of selected transcripts with slot-blot RNA hybridization analysis</p>
            </st>
            <p>For slot-blot RNA hybridization experiments, 5 &#956;g RNA were denatured for 10 min at 68&#176;C in a formaldehyde/formamide-containing buffer and transferred to HybondN<sup>+ </sup>membranes (Amersham Pharmacia Biotech, Freiburg, Germany) using the BioRad-Dot-blot SF Microfiltration Apparatus (BioRad) as described in the corresponding manual. RNA was UV cross-linked to the membrane and samples were probed with different PCR-derived digoxygenin-dUTP (Dig-dUTP) labeled gene-specific DNA probes (Table <tblr tid="T14">14</tblr>). Slot-blot RNA detection were performed using the CDP-Star ready-to-use system (Roche, Mannheim, Germany) according to the manufacturer's recommendation. The <it>rnpB </it>probe was used in all experiments to ensure equal loading.</p>
            <tbl id="T14">
               <title>
                  <p>Table 14</p>
               </title>
               <caption>
                  <p>Primers used for amplification of gene-specific DNA probes for slot-blot RNA hybridization.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Name</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Amplified product</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DNA sequence 5'&#8594;3' direction</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll1336</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll1336</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1686 bps</p>
                     </c>
                     <c ca="center">
                        <p>ATGTCGTACTGAGTCGCTTC TGGAGTGCAACATGCTGGAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll0902</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll0902</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>627 bps</p>
                     </c>
                     <c ca="center">
                        <p>TCCTTCACCGCGGCCATGTA CGGCAGACAGTGGAGCACAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1476</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1476</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>986 bps</p>
                     </c>
                     <c ca="center">
                        <p>GGTGGCCAGTTGGACTCGAA ATTCCTGAACAGTGCCTAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll0573</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll0573</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>491 bps</p>
                     </c>
                     <c ca="center">
                        <p>AACGGAAGGCATGATCGGTT AACAGTGAGCGTAGTTGGTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr0782</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr0782</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1325 bps</p>
                     </c>
                     <c ca="center">
                        <p>CCATCCTCGTCCTGTGATTG CCAGTACGAATTGCACCATC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll1077</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>speB2</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1054 bps</p>
                     </c>
                     <c ca="center">
                        <p>CAGCAGGAGGTTGACCAAGG CAGCATGGATATAGGCCGGT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1022</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>argD</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1224 bps</p>
                     </c>
                     <c ca="center">
                        <p>GTTGTTGAATCCGTCGAAGC TTCTGCTTCCGTCACCACTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr0370</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>gabD</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>895 bps</p>
                     </c>
                     <c ca="center">
                        <p>GCCGAGGAATACTTAGCCGA GGTTAGTTGTCCATGCACTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll1683</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>sll1683</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>858 bps</p>
                     </c>
                     <c ca="center">
                        <p>ACCTCTTCCAAGCTGATCTG AGGCAGTGACATCGACGGTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr0662</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr0662</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>739 bps</p>
                     </c>
                     <c ca="center">
                        <p>GTTGGACCATTGACGACAGC CTGTCCAACATATCAGCTCG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1312</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1312</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>853 bps</p>
                     </c>
                     <c ca="center">
                        <p>GCCTCCTGGAGCATTGAAGA CCAGCTTGACCAATTCCACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>
                              <it>slr1469</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>
                              <it>rnpB</it>
                           </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>599 bps</p>
                     </c>
                     <c ca="center">
                        <p>GCGGCCTATGGCTCTAATCA TTGACAGCATGCCACTGGAC</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>SS performed the bioinformatic and the transcript analyses. CR aided the bioinformatic analyses and performed the phylogenetic analyses. EKP provided the knowledge and expertise on L-arginine catabolism and in part wrote the paper. KPM supervised the research and provided tables and figures. DS and all other authors have read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>The fellowship of the International NRW Graduate School in Bioinformatics and Genome Research of the University of Bielefeld for S. Schriek is gratefully acknowledged.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Formation of radioactive citrulline during photosynthetic 14CO2 fixation by blue-green algae</p>
            </title>
            <aug>
               <au>
                  <snm>Linko</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Holm-Hansson</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Bassham</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Calvin</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Exp Bot</source>
            <pubdate>1957</pubdate>
            <volume>8</volume>
            <fpage>147</fpage>
            <lpage>156</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/jxb/8.1.147</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>The biochemistry and molecular regulation of carbon dioxide metabolism in cyanobacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Tabita</snm>
                  <fnm>FR</fnm>
               </au>
            </aug>
            <source>The Molecular Biology of Cyanobacteria</source>
            <publisher>Dordrecht, Boston &amp; London , Kluwer Academic Publishers</publisher>
            <editor>Bryant DA</editor>
            <series>
               <title>
                  <p>Advances in Photosynthesis</p>
               </title>
            </series>
            <pubdate>1994</pubdate>
            <volume>4</volume>
            <fpage>437</fpage>
            <lpage>467</lpage>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Molecular characterization of cyanophycin synthetase, the enzyme catalyzing the biosynthesis of the cyanobacterial reserve material multi-L-arginyl-poly-L-aspartate (cyanophycin)</p>
            </title>
            <aug>
               <au>
                  <snm>Ziegler</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Diener</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Herpin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Richter</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Deutzmann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lockau</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1998</pubdate>
            <volume>254</volume>
            <issue>1</issue>
            <fpage>154</fpage>
            <lpage>159</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1432-1327.1998.2540154.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9652408</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Cyanophycin granules from the blue-green alga <it>Anabaena cylindrica</it>: A reserve material consisting of copolymers of aspartic acid and arginine</p>
            </title>
            <aug>
               <au>
                  <snm>Simon</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1971</pubdate>
            <volume>68</volume>
            <issue>2</issue>
            <fpage>265</fpage>
            <lpage>267</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">388913</pubid>
                  <pubid idtype="pmpid">16591901</pubid>
                  <pubid idtype="doi">10.1073/pnas.68.2.265</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Inclusion bodies in the cyanobacteria: Cyanophycin, polyphosphate, polyhedral bodies</p>
            </title>
            <aug>
               <au>
                  <snm>Simon</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>The Cyanobacteria</source>
            <publisher>Amsterdam, New York, Oxford , Elsevier</publisher>
            <editor>Fay P, van Baalen C</editor>
            <pubdate>1987</pubdate>
            <volume>1</volume>
            <fpage>199</fpage>
            <lpage>225</lpage>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Cyanobacterial cell inclusions</p>
            </title>
            <aug>
               <au>
                  <snm>Allen</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Annu Rev Microbiol</source>
            <pubdate>1984</pubdate>
            <volume>38</volume>
            <fpage>1</fpage>
            <lpage>25</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.mi.38.100184.000245</pubid>
                  <pubid idtype="pmpid" link="fulltext">6437321</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>PII-regulated arginine synthesis controls accumulation of cyanophycin in <it>Synechocystis</it> sp. strain PCC 6803</p>
            </title>
            <aug>
               <au>
                  <snm>Maheswaran</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ziegler</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lockau</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Hagemann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Forchhammer</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2006</pubdate>
            <volume>188</volume>
            <issue>7</issue>
            <fpage>2730</fpage>
            <lpage>2734</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1428389</pubid>
                  <pubid idtype="pmpid" link="fulltext">16547064</pubid>
                  <pubid idtype="doi">10.1128/JB.188.7.2730-2734.2006</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Transient accumulations of cyanophycin in <it>Anabaena cylindrica</it> and <it>Synechocystis</it> 6803</p>
            </title>
            <aug>
               <au>
                  <snm>Mackerras</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>de Chazal</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>GD</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1990</pubdate>
            <volume>136</volume>
            <fpage>2057</fpage>
            <lpage>2065</lpage>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Is cyanophycin involved in the integration of nitrogen and carbon metabolism in the cyanobacteria <it>Anabaena cylindrica</it> and Gloeothece grown on light/dark cycles?</p>
            </title>
            <aug>
               <au>
                  <snm>Mackerras</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Youens</snm>
                  <fnm>BN</fnm>
               </au>
               <au>
                  <snm>Weir</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>GD</fnm>
               </au>
            </aug>
            <source>J Gen Microbiol</source>
            <pubdate>1990</pubdate>
            <volume>136</volume>
            <fpage>2049</fpage>
            <lpage>2056</lpage>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Interrelation between cyanophycin synthesis, L-arginine catabolism and photosynthesis in the cyanobacterium <it>Synechocystis</it> sp. strain PCC 6803</p>
            </title>
            <aug>
               <au>
                  <snm>Stephan</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Ruppel</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Pistorius</snm>
                  <fnm>EK</fnm>
               </au>
            </aug>
            <source>Z Naturforsch [C]</source>
            <pubdate>2000</pubdate>
            <volume>55</volume>
            <issue>11-12</issue>
            <fpage>927</fpage>
            <lpage>942</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">11204198</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Inclusions: Cyanophycin</p>
            </title>
            <aug>
               <au>
                  <snm>Allen</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Methods Enzymol</source>
            <pubdate>1988</pubdate>
            <volume>167</volume>
            <fpage>207</fpage>
            <lpage>213</lpage>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Effect of nitrogen source on cyanophycin synthesis in <it>Synechocystis</it> sp. strain PCC 6308</p>
            </title>
            <aug>
               <au>
                  <snm>Kolodny</snm>
                  <fnm>NH</fnm>
               </au>
               <au>
                  <snm>Bauer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bryce</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Klucevsek</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lane</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Medeiros</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Mercer</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Moin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Petersen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yuen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Wolfson</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2006</pubdate>
            <volume>188</volume>
            <issue>3</issue>
            <fpage>934</fpage>
            <lpage>940</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1347322</pubid>
                  <pubid idtype="pmpid" link="fulltext">16428397</pubid>
                  <pubid idtype="doi">10.1128/JB.188.3.934-940.2006</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Biosynthesis and metabolism of arginine in bacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Cunin</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Glansdorff</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Pierard</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Stalon</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Microbiol Rev</source>
            <pubdate>1986</pubdate>
            <volume>50</volume>
            <issue>3</issue>
            <fpage>314</fpage>
            <lpage>352</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">373073</pubid>
                  <pubid idtype="pmpid" link="fulltext">3534538</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Evolution of Arginine Metabolism</p>
            </title>
            <aug>
               <au>
                  <snm>Stalon</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Evolution of Prokaryotes</source>
            <publisher>London , Academic Publishers Inc.</publisher>
            <pubdate>1985</pubdate>
            <fpage>277</fpage>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Arginine catabolism by microorganisms</p>
            </title>
            <aug>
               <au>
                  <snm>Abdelal</snm>
                  <fnm>AT</fnm>
               </au>
            </aug>
            <source>Annu Rev Microbiol</source>
            <pubdate>1979</pubdate>
            <volume>33</volume>
            <fpage>139</fpage>
            <lpage>168</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.mi.33.100179.001035</pubid>
                  <pubid idtype="pmpid" link="fulltext">386920</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Pathways and regulation of bacterial arginine metabolism and perspectives for obtaining arginine overproducing strains</p>
            </title>
            <aug>
               <au>
                  <snm>Lu</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>Appl Microbiol Biotechnol</source>
            <pubdate>2006</pubdate>
            <volume>70</volume>
            <issue>3</issue>
            <fpage>261</fpage>
            <lpage>272</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00253-005-0308-z</pubid>
                  <pubid idtype="pmpid" link="fulltext">16432742</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Enzymology of arginine metabolism in heterocyst-forming cyanobacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Gupta</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Carr</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>FEMS Microbiol Lett</source>
            <pubdate>1981</pubdate>
            <volume>12</volume>
            <fpage>179</fpage>
            <lpage>181</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1574-6968.1981.tb07637.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Apparent lack of control by repression of arginine metabolism in blue-green algae</p>
            </title>
            <aug>
               <au>
                  <snm>Hood</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Carr</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1971</pubdate>
            <volume>107</volume>
            <issue>1</issue>
            <fpage>365</fpage>
            <lpage>367</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">246924</pubid>
                  <pubid idtype="pmpid" link="fulltext">4998248</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Arginine catabolism in <it>Aphanocapsa</it> 6308</p>
            </title>
            <aug>
               <au>
                  <snm>Weathers</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Chee</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Arch Microbiol</source>
            <pubdate>1978</pubdate>
            <volume>118</volume>
            <issue>1</issue>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00406066</pubid>
                  <pubid idtype="pmpid">100070</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Ornithine cycle in Nostoc PCC 73102. Arginase, OTC and arginine deiminase, and the effects of addition of external arginine, ornithine or citrulline</p>
            </title>
            <aug>
               <au>
                  <snm>Martel</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Jansson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Garcia- Reina</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lindblad</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Arch Microbiol</source>
            <pubdate>1993</pubdate>
            <volume>159</volume>
            <fpage>506</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00249027</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Arginine catabolism in the cyanobacterium <it>Synechocystis</it> sp. strain PCC 6803 involves the urea cycle and arginase pathway</p>
            </title>
            <aug>
               <au>
                  <snm>Quintero</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Muro-Pastor</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Herrero</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Flores</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2000</pubdate>
            <volume>182</volume>
            <issue>4</issue>
            <fpage>1008</fpage>
            <lpage>1015</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">94377</pubid>
                  <pubid idtype="pmpid" link="fulltext">10648527</pubid>
                  <pubid idtype="doi">10.1128/JB.182.4.1008-1015.2000</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Isolation and partial characterization of a L-amino acid oxidase and of photosystem II complexes from the cyanobacterium <it>Synechococcus</it> PCC 7942</p>
            </title>
            <aug>
               <au>
                  <snm>Engels</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Engels</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pistorius</snm>
                  <fnm>EK</fnm>
               </au>
            </aug>
            <source>Bioscience C</source>
            <pubdate>1992</pubdate>
            <volume>47</volume>
            <fpage>859</fpage>
            <lpage>866</lpage>
         </bibl>
         <bibl id="B23">
            <title>
               <p>L-amino acid oxidases with specificity for basic amino acids in cyanobacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Gau</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Heindl</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nodop</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kahmann</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Pistorius</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Z Naturforsch [C]</source>
            <pubdate>2007</pubdate>
            <fpage>273</fpage>
            <lpage>284</lpage>
            <xrefbib>
               <pubid idtype="pmpid">17542496</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Some properties of a basic L-amino acid oxidase from <it>Anacystis nidulans</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Pistorius</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Voss</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1980</pubdate>
            <volume>611</volume>
            <fpage>227</fpage>
            <lpage>240</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">6766743</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A novel putrescine utilization pathway involves gamma-glutamylated intermediates of <it>Escherichia coli</it> K-12</p>
            </title>
            <aug>
               <au>
                  <snm>Kurihara</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Oda</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Koyanagi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kumagai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2005</pubdate>
            <volume>280</volume>
            <issue>6</issue>
            <fpage>4602</fpage>
            <lpage>4608</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M411114200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15590624</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Multiple evolutionary origin of pyridoxal-5'-phosphate-dependent amino acid decarboxylases</p>
            </title>
            <aug>
               <au>
                  <snm>Sandmeier</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Hale</snm>
                  <fnm>TI</fnm>
               </au>
               <au>
                  <snm>Christen</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1994</pubdate>
            <volume>221</volume>
            <issue>3</issue>
            <fpage>997</fpage>
            <lpage>1002</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1432-1033.1994.tb18816.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">8181483</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Polyamines in microorganisms</p>
            </title>
            <aug>
               <au>
                  <snm>Tabor</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Tabor</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Microbiol Rev</source>
            <pubdate>1985</pubdate>
            <volume>49</volume>
            <issue>1</issue>
            <fpage>81</fpage>
            <lpage>99</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">373019</pubid>
                  <pubid idtype="pmpid" link="fulltext">3157043</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Regulation of plant arginase by wounding, jasmonate, and the phytotoxin coronatine</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>McCaig</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Melotto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Howe</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2004</pubdate>
            <volume>279</volume>
            <issue>44</issue>
            <fpage>45998</fpage>
            <lpage>46007</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M407151200</pubid>
                  <pubid idtype="pmpid" link="fulltext">15322128</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Arginine degradation by arginase in mitochondria of soybean seedling cotyledons</p>
            </title>
            <aug>
               <au>
                  <snm>Goldraij</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Polacco</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Planta</source>
            <pubdate>2000</pubdate>
            <volume>210</volume>
            <issue>4</issue>
            <fpage>652</fpage>
            <lpage>658</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s004250050056</pubid>
                  <pubid idtype="pmpid" link="fulltext">10787060</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Cloning and expression of a prokaryotic enzyme, arginine deiminase, from a primitive eukaryote <it>Giardia intestinalis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Knodler</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Sekyere</snm>
                  <fnm>EO</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Schofield</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Edwards</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1998</pubdate>
            <volume>273</volume>
            <issue>8</issue>
            <fpage>4470</fpage>
            <lpage>4477</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.273.8.4470</pubid>
                  <pubid idtype="pmpid" link="fulltext">9468500</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>The pathway of arginine catabolism in the parasitic flagellate <it>Trichomonas vaginalis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Linstead</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cranshaw</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Mol Biochem Parasitol</source>
            <pubdate>1983</pubdate>
            <volume>8</volume>
            <issue>3</issue>
            <fpage>241</fpage>
            <lpage>252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0166-6851(83)90046-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">6312311</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Subcellular localization of the enzymes of the arginine dihydrolase pathway in <it>Trichomonas vaginalis</it> and <it>Tritrichomonas foetus</it></p>
            </title>
            <aug>
               <au>
                  <snm>Yarlett</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lindmark</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Goldberg</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Moharrami</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Bacchi</snm>
                  <fnm>CJ</fnm>
               </au>
            </aug>
            <source>J Eukaryot Microbiol</source>
            <pubdate>1994</pubdate>
            <volume>41</volume>
            <issue>6</issue>
            <fpage>554</fpage>
            <lpage>559</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1550-7408.1994.tb01516.x</pubid>
                  <pubid idtype="pmpid">7866382</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Primary and quaternary structure of the catabolic ornithine carbamoyltransferase from <it>Pseudomonas aeruginosa</it>. Extensive sequence homology with the anabolic ornithine carbamoyltransferases of <it>Escherichia coli</it></p>
            </title>
            <aug>
               <au>
                  <snm>Baur</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Stalon</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Falmagne</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Luethi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Haas</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1987</pubdate>
            <volume>166</volume>
            <issue>1</issue>
            <fpage>111</fpage>
            <lpage>117</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1432-1033.1987.tb13489.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">3109911</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Induction et specificite des enzymes de la nouvelle voie catabolique de l'arginine</p>
            </title>
            <aug>
               <au>
                  <snm>van Thoai</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Thome-Beau</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Olomucki</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1966</pubdate>
            <volume>115</volume>
            <fpage>73</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubid idtype="pmpid">5936244</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Metabolism of basic amino acids in <it>Pseudomonas putida</it>. Intermediates in L-arginine catabolism</p>
            </title>
            <aug>
               <au>
                  <snm>Miller</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Rodwell</snm>
                  <fnm>VW</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1971</pubdate>
            <volume>246</volume>
            <issue>16</issue>
            <fpage>5053</fpage>
            <lpage>5058</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">5570437</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Intermediates and enzymes between alpha-ketoarginine and gamma-guanidinobutyrate in the L-arginine catabolic pathway of Pseudomonas putida</p>
            </title>
            <aug>
               <au>
                  <snm>Vanderbilt</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Gaby</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Rodwell</snm>
                  <fnm>VW</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1975</pubdate>
            <volume>250</volume>
            <issue>14</issue>
            <fpage>5322</fpage>
            <lpage>5329</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">237915</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Phylogeny of related functions: the case of polyamine biosynthetic enzymes</p>
            </title>
            <aug>
               <au>
                  <snm>Sekowska</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Danchin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Risler</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Microbiology</source>
            <pubdate>2000</pubdate>
            <volume>146 ( Pt 8)</volume>
            <fpage>1815</fpage>
            <lpage>1828</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10931887</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>A novel superfamily of enzymes that catalyze the modification of guanidino groups</p>
            </title>
            <aug>
               <au>
                  <snm>Shirai</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Blundell</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Mizuguchi</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Trends Biochem Sci</source>
            <pubdate>2001</pubdate>
            <volume>26</volume>
            <issue>8</issue>
            <fpage>465</fpage>
            <lpage>468</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0968-0004(01)01906-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">11504612</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Roles of conserved residues in the arginase family</p>
            </title>
            <aug>
               <au>
                  <snm>Perozich</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hempel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>SM</fnm>
                  <suf>Jr.</suf>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1998</pubdate>
            <volume>1382</volume>
            <issue>1</issue>
            <fpage>23</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9507056</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Characterization and regulation of the gbuA gene, encoding guanidinobutyrase in the arginine dehydrogenase pathway of <it>Pseudomonas aeruginosa</it> PAO1</p>
            </title>
            <aug>
               <au>
                  <snm>Nakada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Itoh</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <issue>12</issue>
            <fpage>3377</fpage>
            <lpage>3384</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">135087</pubid>
                  <pubid idtype="pmpid" link="fulltext">12029055</pubid>
                  <pubid idtype="doi">10.1128/JB.184.12.3377-3384.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Crystal structures of arginine deiminase with covalent reaction intermediates; implications for catalytic mechanism</p>
            </title>
            <aug>
               <au>
                  <snm>Das</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Butler</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Kwiatkowski</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>AD</fnm>
                  <suf>Jr.</suf>
               </au>
               <au>
                  <snm>Yadav</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Arnold</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Structure</source>
            <pubdate>2004</pubdate>
            <volume>12</volume>
            <issue>4</issue>
            <fpage>657</fpage>
            <lpage>667</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.str.2004.02.017</pubid>
                  <pubid idtype="pmpid" link="fulltext">15062088</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Polymorphism in genes for the enzyme arginine deiminase among Mycoplasma species</p>
            </title>
            <aug>
               <au>
                  <snm>Sugimura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Azuma</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1993</pubdate>
            <volume>61</volume>
            <issue>1</issue>
            <fpage>329</fpage>
            <lpage>331</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">302723</pubid>
                  <pubid idtype="pmpid">8093359</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The amino acid sequences of human and pig L-arginine:glycine amidinotransferase</p>
            </title>
            <aug>
               <au>
                  <snm>Humm</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Huber</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mann</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>1994</pubdate>
            <volume>339</volume>
            <issue>1-2</issue>
            <fpage>101</fpage>
            <lpage>107</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-5793(94)80394-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">8313955</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>The comparative amino acid sequences, substrate specificities and gene or cDNA nucleotide sequences of some prokaryote and eukaryote amidinotransferases: implications for evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Bedekar</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zink</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Sherman</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Line</snm>
                  <fnm>TV</fnm>
               </au>
               <au>
                  <snm>Van Pilsum</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Comp Biochem Physiol B Biochem Mol Biol</source>
            <pubdate>1998</pubdate>
            <volume>119</volume>
            <issue>4</issue>
            <fpage>677</fpage>
            <lpage>690</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0305-0491(98)00043-1</pubid>
                  <pubid idtype="pmpid">9787760</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Functional modeling and phylogenetic distribution of putative cylindrospermopsin biosynthesis enzymes</p>
            </title>
            <aug>
               <au>
                  <snm>Kellmann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mills</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Neilan</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>2006</pubdate>
            <volume>62</volume>
            <issue>3</issue>
            <fpage>267</fpage>
            <lpage>280</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00239-005-0030-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">16508696</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Isolation and characterization of the gene coding for the amidinotransferase involved in the biosynthesis of phaseolotoxin in <it>Pseudomonas syringae</it> pv. phaseolicola</p>
            </title>
            <aug>
               <au>
                  <snm>Hernandez-Guzman</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Alvarez-Morales</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Plant Microbe Interact</source>
            <pubdate>2001</pubdate>
            <volume>14</volume>
            <issue>4</issue>
            <fpage>545</fpage>
            <lpage>554</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1094/MPMI.2001.14.4.545</pubid>
                  <pubid idtype="pmpid" link="fulltext">11310742</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Sequence analysis and expression of the arginine-deiminase and carbamate-kinase genes of <it>Pseudomonas aeruginosa</it></p>
            </title>
            <aug>
               <au>
                  <snm>Baur</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Luethi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Stalon</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mercenier</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Haas</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1989</pubdate>
            <volume>179</volume>
            <issue>1</issue>
            <fpage>53</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1432-1033.1989.tb14520.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">2537202</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>The arcABDC gene cluster, encoding the arginine deiminase pathway of <it>Bacillus licheniformis</it>, and its activation by the arginine repressor argR</p>
            </title>
            <aug>
               <au>
                  <snm>Maghnouj</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>de Sousa Cabral</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Stalon</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Vander Wauven</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1998</pubdate>
            <volume>180</volume>
            <issue>24</issue>
            <fpage>6468</fpage>
            <lpage>6475</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">107747</pubid>
                  <pubid idtype="pmpid" link="fulltext">9851988</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Gene structure, organization, expression, and potential regulatory mechanisms of arginine catabolism in <it>Enterococcus faecalis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Barcelona-Andres</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Marina</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rubio</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2002</pubdate>
            <volume>184</volume>
            <issue>22</issue>
            <fpage>6289</fpage>
            <lpage>6300</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">151947</pubid>
                  <pubid idtype="pmpid" link="fulltext">12399499</pubid>
                  <pubid idtype="doi">10.1128/JB.184.22.6289-6300.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Amino acid transport in taxonomically diverse cyanobacteria and identification of two genes encoding elements of a neutral amino acid permease putatively involved in recapture of leaked hydrophobic amino acids</p>
            </title>
            <aug>
               <au>
                  <snm>Montesinos</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Herrero</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Flores</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1997</pubdate>
            <volume>179</volume>
            <issue>3</issue>
            <fpage>853</fpage>
            <lpage>862</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">178770</pubid>
                  <pubid idtype="pmpid" link="fulltext">9006043</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Identification of genes encoding amino acid permeases by inactivation of selected ORFs from the <it>Synechocystis</it> genomic sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Quintero</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Montesinos</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Herrero</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Flores</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <issue>12</issue>
            <fpage>2034</fpage>
            <lpage>2040</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">311220</pubid>
                  <pubid idtype="pmpid" link="fulltext">11731493</pubid>
                  <pubid idtype="doi">10.1101/gr.196301</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method</p>
            </title>
            <aug>
               <au>
                  <snm>Cserzo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wallin</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>von Heijne</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Elofsson</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Protein Eng</source>
            <pubdate>1997</pubdate>
            <volume>10</volume>
            <issue>6</issue>
            <fpage>673</fpage>
            <lpage>676</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/protein/10.6.673</pubid>
                  <pubid idtype="pmpid" link="fulltext">9278280</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>TMbase - A database of membrane-spanning protein segments</p>
            </title>
            <aug>
               <au>
                  <snm>Hofmann</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Stoffel</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Biol Chem Hoppe-Seyler</source>
            <pubdate>1993</pubdate>
            <volume>374</volume>
            <fpage>166</fpage>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Membrane protein structure prediction: Hydrophobicity analysis and the positive inside rule</p>
            </title>
            <aug>
               <au>
                  <snm>Von Heijne</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1992</pubdate>
            <volume>225</volume>
            <fpage>487</fpage>
            <lpage>494</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0022-2836(92)90934-C</pubid>
                  <pubid idtype="pmpid" link="fulltext">1593632</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Prediction of the occurrence of the ADP-binding beta alpha beta-fold in proteins, using an amino acid sequence fingerprint</p>
            </title>
            <aug>
               <au>
                  <snm>Wierenga</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Terpstra</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hol</snm>
                  <fnm>WG</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1986</pubdate>
            <volume>187</volume>
            <issue>1</issue>
            <fpage>101</fpage>
            <lpage>107</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0022-2836(86)90409-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">3959077</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Polyamines of <it>Anacystis nidulans</it> and metabolism of exogenous spermidine and spermine</p>
            </title>
            <aug>
               <au>
                  <snm>Ramakrishna</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Guarino</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>SS</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1978</pubdate>
            <volume>134</volume>
            <issue>3</issue>
            <fpage>744</fpage>
            <lpage>750</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">222319</pubid>
                  <pubid idtype="pmpid" link="fulltext">96100</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>The aerobic respiratory chain of <it>Escherichia coli</it></p>
            </title>
            <aug>
               <au>
                  <snm>Anraku</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gennis</snm>
                  <fnm>RB</fnm>
               </au>
            </aug>
            <source>Trends Biochem Sci</source>
            <pubdate>1987</pubdate>
            <volume>12</volume>
            <fpage>262</fpage>
            <lpage>266</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0968-0004(87)90131-9</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Genome-wide analysis of the L-methionine biosynthetic pathway in <it>Corynebacterium glutamicum</it> by targeted gene deletion and homologous complementation</p>
            </title>
            <aug>
               <au>
                  <snm>Rueckert</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Puhler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kalinowski</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Biotechnol</source>
            <pubdate>2003</pubdate>
            <volume>104</volume>
            <issue>1-3</issue>
            <fpage>213</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-1656(03)00158-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12948640</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Gapped BLAST and PSI-BLAST: a new generation of protein database search programs</p>
            </title>
            <aug>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Madden</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Schaffer</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>17</issue>
            <fpage>3389</fpage>
            <lpage>3402</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">146917</pubid>
                  <pubid idtype="pmpid" link="fulltext">9254694</pubid>
                  <pubid idtype="doi">10.1093/nar/25.17.3389</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>DIALIGN 2: improvement of the segment-to-segment approach to multiple sequence alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Morgenstern</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1999</pubdate>
            <volume>15</volume>
            <issue>3</issue>
            <fpage>211</fpage>
            <lpage>218</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/15.3.211</pubid>
                  <pubid idtype="pmpid" link="fulltext">10222408</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>The neighbor-joining method: a new method for reconstructing phylogenetic trees</p>
            </title>
            <aug>
               <au>
                  <snm>Saitou</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1987</pubdate>
            <volume>4</volume>
            <issue>4</issue>
            <fpage>406</fpage>
            <lpage>425</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3447015</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Plewniak</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jeanmougin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>24</issue>
            <fpage>4876</fpage>
            <lpage>4882</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">147148</pubid>
                  <pubid idtype="pmpid" link="fulltext">9396791</pubid>
                  <pubid idtype="doi">10.1093/nar/25.24.4876</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>TreeTool</p>
            </title>
            <aug>
               <au>
                  <snm>Maciukenas</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <publisher>Urbana-Campaign , University of Illinois</publisher>
            <edition>1.0</edition>
            <fpage>TreeTool is an interactive tool for displaying, editing, and printing
phylogenetic trees.  The tree is displayed visually on screen, in
various formats, and the user is able to modify the format, structure,
and characteristics of the tree.  Trees may be viewed, compared,
formatted for printing, constructed from smaller trees</fpage>
            <url>http://rdp8.cme.msu.edu/download/programs/TreeTool/</url>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Adaptation to iron deficiency: A comparison between the cyanobacterium <it>Synechococcus elongatus</it> PCC 7942 wild-type and a DpsA-free mutant</p>
            </title>
            <aug>
               <au>
                  <snm>Michel</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Berry</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hifney</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Pistorius</snm>
                  <fnm>EK</fnm>
               </au>
            </aug>
            <source>Photosynth Res</source>
            <pubdate>2003</pubdate>
            <volume>75</volume>
            <fpage>71</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1022459919040</pubid>
                  <pubid idtype="pmpid">16245095</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Web Services at the European Bioinformatics Institute</p>
            </title>
            <aug>
               <au>
                  <snm>Labarga</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Valentin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Andersson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lopez</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2007</pubdate>
            <volume>Web Services Issue 2007</volume>
         </bibl>
      </refgrp>
   </bm>
</art>
