<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2164-7-185</ui>
   <ji>1471-2164</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>The pseudo-mitochondrial genome influences mistakes in heteroplasmy interpretation</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Parr</snm>
               <mi>L</mi>
               <fnm>Ryan</fnm>
               <insr iid="I1"/>
               <email>Ryan.Parr@genesisgenomics.com</email>
            </au>
            <au id="A2">
               <snm>Maki</snm>
               <fnm>Jennifer</fnm>
               <insr iid="I1"/>
               <email>Jennifer.Maki@genesisgenomics.com</email>
            </au>
            <au id="A3">
               <snm>Reguly</snm>
               <fnm>Brian</fnm>
               <insr iid="I1"/>
               <email>Brian.Reguly@genesisgenomics.com</email>
            </au>
            <au id="A4">
               <snm>Dakubo</snm>
               <mi>D</mi>
               <fnm>Gabriel</fnm>
               <insr iid="I1"/>
               <email>Gabriel.Dakubo@genesisgenomics.com</email>
            </au>
            <au id="A5">
               <snm>Aguirre</snm>
               <fnm>Andrea</fnm>
               <insr iid="I1"/>
               <email>Andrea.Aguirre@genesisgenomics.com</email>
            </au>
            <au id="A6">
               <snm>Wittock</snm>
               <fnm>Roy</fnm>
               <insr iid="I1"/>
               <email>Roy.Wittock@genesisgenomics.com</email>
            </au>
            <au id="A7">
               <snm>Robinson</snm>
               <fnm>Kerry</fnm>
               <insr iid="I1"/>
               <email>Kerry.Robinson@genesisgenomics.com</email>
            </au>
            <au id="A8">
               <snm>Jakupciak</snm>
               <mi>P</mi>
               <fnm>John</fnm>
               <insr iid="I2"/>
               <email>john.jakupciak@nist.gov</email>
            </au>
            <au id="A9">
               <snm>Thayer</snm>
               <mi>E</mi>
               <fnm>Robert</fnm>
               <insr iid="I1"/>
               <email>Robert.Thayer@genesisgenomics.com</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Genesis Genomics Inc, 1294 Balmoral Street, Thunder Bay, Ontario, P7B 5Z5, Canada</p>
            </ins>
            <ins id="I2">
               <p>Biochemical Science Division, National Institute of Standards and Technology, Gaithersburg, MD 20899, USA</p>
            </ins>
         </insg>
         <source>BMC Genomics</source>
         <issn>1471-2164</issn>
         <pubdate>2006</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>185</fpage>
         <url>http://www.biomedcentral.com/1471-2164/7/185</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16859552</pubid>
               <pubid idtype="doi">10.1186/1471-2164-7-185</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>19</day>
               <month>4</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>21</day>
               <month>7</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>21</day>
               <month>7</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Parr et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Nuclear mitochondrial pseudogenes (numts) are a potential source of contamination during mitochondrial DNA PCR amplification. This possibility warrants careful experimental design and cautious interpretation of heteroplasmic results.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Here we report the cloning and sequencing of numts loci, amplified from human tissue and rho-zero (<it>&#961;</it><sup>0</sup>) cells (control) with primers known to amplify the mitochondrial genome. This paper is the first to fully sequence 46 paralogous nuclear DNA fragments that represent the entire mitochondrial genome. This is a surprisingly small number due primarily to the primer sets used in this study, because prior to this, BLAST searches have suggested that nuclear DNA harbors between 400 to 1,500 paralogous mitochondrial DNA fragments. Our results indicate that multiple numts were amplified simultaneously with the mitochondrial genome and increased the load of pseudogene signal in PCR reactions. Further, the entire mitochondrial genome was represented by multiple copies of paralogous nuclear sequences.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>These findings suggest that mitochondrial genome disease-associated biomarkers must be rigorously authenticated to preclude any affiliation with paralogous nuclear pseudogenes. Importantly, the common perception that mitochondrial template "swamps" numts loci precluding detectable amplification, depends on the region of the mitochondrial genome targeted by the PCR reaction and the number of pseudogene loci that may co-amplify. Cloning and relevant sequencing data will facilitate the correct interpretation. This is the first complete, wet-lab characterization of numts that represent the entire mitochondrial genome.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The unique maternal inheritance pattern of mitochondrial DNA (mtDNA), its small genome size, accelerated mutation rate, lack of recombination, and multiple copy number per cell, in comparison to nuclear DNA, are ideal biological traits for investigating evolution, population genetics and for forensic and medical applications. Thus, the mitochondrial genome has been used as a biosensor for the timing and movement of human populations in antiquity <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. MtDNA analysis is routinely used in forensic biology to type biological material when degradation prevents nuclear STR amplification <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. In addition, the entire mitochondrial molecule has potential medical utility because it can serve as a repository of cancer mutations and as a biosensor indicative of genetic alterations <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>.</p>
         <p>Frequently, identifying legitimate mtDNA mutations is confounded by heteroplasmy, a condition in which wild-type and mutant mitochondrial genomes co-exist in a cell. The interpretation of heteroplasmy can further be confounded by the widespread integration of portions of the mitochondrial genome into the nuclear genome <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. These homologous, yet divergent nuclear and mtDNA sequences can be co-amplified in PCR reactions intended to replicate targeted mtDNA sequences only. Although this problem has previously been considered to be muted because of the high copy number of mtDNA over corresponding nuclear loci, caution is warranted <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. For example, there are specific regions of the mitochondrial genome that have corresponding nuclear mitochondrial pseudogenes (numts) distributed across multiple chromosomes. Hence, there are regions of the mitochondrial genome that have a high nuclear copy number, which are not completely "swamped" during amplification. We report that some heteroplasmies detected in prostate cancer samples are a result of co-amplification of these multiple loci.</p>
         <p>A large number of manuscripts addressing errors related to the interpretation of mtDNA and mtDNA heteroplasmy has been published <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. Notably not all these errors are due to pseudogene co-amplification; however, mistakes from pseudogenes may increase with improved sequencing methods and highly sensitive re-sequencing microarray technologies that have a lower detection limit than traditional sequencing and which readily detect low-level heteroplasmy <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B26">26</abbr></abbrgrp>. In some cases, if the heteroplasmy is inherited, it substantially increases the power of mutation detection, which becomes an important aspect since heteroplasmy has been reported as an early indication of disease <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. In addition, if the disease process invokes mitochondrial depletion, this could increase nuclear pseudogene signal in reactions as a result of reduced mitochondrial genome copy number <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Loss of mitochondria has been described in several human cancers <abbrgrp><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>. As well, the number of mitochondria and mtDNA copy number vary for different cell types <abbrgrp><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>. These important matters relating to sequence interpretation have been generally neglected, in part, due to the lack of numt reference material, which would help investigators determine the relevance of detected mtDNA sequence variations. Hence, the need to validate somatic mitochondrial mutations is a pressing one.</p>
         <p>Heteroplasmic issues have already complicated data obtained from other species. For example, in elephant hair, low mtDNA content is the reason why numts were co-amplified and misinterpreted as authentic mtDNA. In contrast, numts were not detected in DNA derived from elephant blood due to the presence of mitochondria-rich platelets <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. Moreover, the hominid, <it>Gorilla</it>, is well known for significant numt interference with mitochondrial sequences, highlighting the need for diligence when interpreting human mtDNA heteroplasmy <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>. Not surprisingly, the effort for using mitochondrial cytochrome c oxidase as a primate "barcode" is plagued by numt amplification as well <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>.</p>
         <p>Further, laser capture microscopy has improved the ability to separate and analyze cancer cells, but because of the decreased amounts of sample DNA, many primer pairs are required to obtain a robust amplification of the entire mitochondrial genome <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Moreover, a sufficient number of cells must be captured to avoid incorporation errors associated with low template quantity <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. This will also be relevant to studies that use formalin-fixed paraffin embedded samples <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. The use of many primers means that smaller amplicons will be synthesized translating into a higher risk of co-amplification of numts and the potential misinterpretation of heteroplasmic calls.</p>
         <p>There is limited <it>in silico </it>and wet-lab evidence indicating that fragments of the human mitochondrial genome are embedded in the nuclear DNA archive <abbrgrp><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp>. These findings emphasize the critical need to minimize erroneous interpretation of heteroplasmy, a vital necessity for precise forensic discrimination, evolutionary studies, and potential diagnostics. We provide evidence of numts for the entire mitochondrial genome by the amplification, cloning, and identification of numts from rho-zero (<it>&#961;</it><sup>0</sup>) cells and clinical cancer specimens. Here we present results from overlapping primers, which co-amplified nuclear embedded, paralogous mitochondrial sequence. Surprisingly, our data shows a relatively small number (when compared to hypothetical sequence information obtained from BLAST searches) of multiple nuclear loci that co-amplify with the mitochondrial genome. These findings demonstrate that accurate interpretation of heteroplasmy not only requires careful primer design and testing, but also indicates that a compendium of the sequence information from multiple-copy number numts is an important reference tool that will facilitate correct mtDNA interpretation and support reliable mitochondrial genome sequencing data.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p><it>&#961;</it><sup>0 </sup>cells lack mtDNA</p>
            </st>
            <p>Rho-zero cells were evaluated for the presence of mtDNA. To ensure that total DNA extracted from <it>&#961;</it><sup>0 </sup>cells were indeed devoid of mtDNA, we first performed Southern blot analyses on DNA extracts from <it>&#961;</it><sup>0 </sup>cells. Blood was used as a positive control. No full length mitochondrial genome signal was observed in <it>&#961;</it><sup>0 </sup>lanes when the blots were probed with mtDNA-specific probes (Figure <figr fid="F1">1a</figr>). We next performed PCR on the DNA extracts with primers specific to the mitochondrial coding regions. Again, there were no amplifications observed in the <it>&#961;</it><sup>0 </sup>templates, while DNA isolated from blood was amplified, as expected (data not shown). We used RT-PCR to provide further evidence that <it>&#961;</it><sup>0 </sup>cells are indeed devoid of mtDNA <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. RT-PCR analysis was performed on RNA samples from <it>&#961;</it><sup>0 </sup>cells and normal human skin tissue (epithelial cells) samples with primers to OXPHOS genes and a nuclear gene (positive control), 5-aminolevulinate synthase (hALAS) (Table <tblr tid="T1">1</tblr>). Whereas the hALAS primers amplified nuclear targets in template from <it>&#961;</it><sup>0 </sup>and epithelial cells, there was no observable product with mtDNA primers for the <it>&#961;</it><sup>0 </sup>cDNA template (Figure <figr fid="F1">1b</figr>), independently confirming the absence of mtDNA in these cells.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>&#961;0 cells<sup/>cells do not contain mtDNA</p>
               </caption>
               <text>
                  <p><b/><b>&#961;0 cells do not contain mtDNA.</b> a. Southern blot analysis of total DNA extracted from blood (bld) and &#961;0 cells and probed with a full length mtDNA probe.  Note the absence of hybridization to &#961;0 extracts. Lad is a DIG-labeled DNA molecular weight marker III (Roche).  b. PCR amplification of cDNA from &#961;0 and epithelial cells (EC). Note the amplification of &#961;0 cDNA with primers to the nuclear gene hALAS, whereas primers to ND1, ATPase6, and CYTB failed to amplify &#961;0 cDNA, although they all amplified cDNA from EC.  Lad is a 100bp DNA size standard (Fermentas life sciences). </p>
               </text>
               <graphic file="1471-2164-7-185-1"/>
            </fig>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Sequences of four primer sets used in RT-PCR.</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Designation</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer sequence (5'-3')</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hALASF</p>
                     </c>
                     <c ca="left">
                        <p>CCACTGGAAGAGCTGTGTGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hALASR</p>
                     </c>
                     <c ca="left">
                        <p>ACCCTCCAACACAACCAAAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1F</p>
                     </c>
                     <c ca="left">
                        <p>GAGCAGTAGCCCAAACAATC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1R</p>
                     </c>
                     <c ca="left">
                        <p>GGGTTCGGTTGGTCTCTGCTAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ATP6F</p>
                     </c>
                     <c ca="left">
                        <p>CCATAAAATTATGAGCGGGCACAGTGATT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ATP6R</p>
                     </c>
                     <c ca="left">
                        <p>GGAAGGTTAATGGTTGATATTGCTAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CYTBF</p>
                     </c>
                     <c ca="left">
                        <p>CTAGCAACACTCCACCTCCTAT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CYTBR</p>
                     </c>
                     <c ca="left">
                        <p>GTAAGCCGAGGGCGTCTTTGCTTG</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Co-amplification of numts and mtDNA</p>
            </st>
            <p>Amplification of the complete mitochondrial genome was performed on human formalin fixed and paraffin embedded (FFPE) prostate cancer samples using a set of 34 primers (Table <tblr tid="T2">2</tblr>). Due to the amount and quality of DNA recovered, the average amplicon size was limited to 625 bp. Surprisingly, 24 (71%) of the primer sets co-amplified mitochondrial pseudogenes (Figure <figr fid="F2">2</figr>, and data not shown). A similar ratio was previously reported by an independent group using 38 primers (26/38 or 68%) <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In an effort to fully characterize numts that represent the entire mitochondrial genome, we redesigned the remaining 10 primers to co-amplify nuclear loci. Thus, we amplified template from <it>&#961;</it><sup>0 </sup>cells and subsequently identified (via sequencing) the cloned fragments from the nucleus. A region of the D-loop (base pairs 16211-420 and 15-711) was recalcitrant to co-amplification using our mitochondrial primers. Therefore, two chromosome 17 specific primers were designed to capture this D-loop fragment (Table <tblr tid="T2">2</tblr>). Hence, a total of 36 primer sets were used to recover the entire mitochondrial genome from the nucleus. The sequences representative of the entire mitochondrial genome are provided as an additional material (<supplr sid="S1">additional file 1</supplr>). Figure <figr fid="F3">3</figr> is an example of an alignment to rCRS of three numt clones recovered using primer set 1488F/2084R (Table <tblr tid="T2">2</tblr>). These three clones were recovered form three separate chromosomes (Chr11 &#8211; NT_009237, Chr5 &#8211; NT_006713, and Chr3 &#8211; NT_005612). Similar alignment of our consensus cloned sequences enabled the assembly of a pseudo-mitochondrial genome (Figure <figr fid="F4">4</figr>).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Numts co-amplify from clinical samples</p>
               </caption>
               <text>
                  <p><b/><b>Numts co-amplify from clinical samples.</b> A representative gel picture showing amplification of clinical samples with primers that also amplify &#961;0 template is shown. Unlabelled lanes are the clinical samples.  Subsequent analysis of sequences from this amplification (see Figure 5) revealed the presence of pseudogene contamination.</p>
               </text>
               <graphic file="1471-2164-7-185-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Example of an alignment of three clones</p>
               </caption>
               <text>
                  <p><b>Example of an alignment of three clones. </b>Example of an alignment of three clones (clones G C11. A1, G C3. A1 and G C5.C1) recovered from three chromosomes (Chr11 - NT_009237, Chr5 - NT_006713, and Chr3 - NT_005612) to the rCRS is shown.<b/></p>
               </text>
               <graphic file="1471-2164-7-185-3"/>
            </fig>
            <suppl id="S1">
               <title>
                  <p>Additional File 1</p>
               </title>
               <text>
                  <p>Sequences of numt clones. The chromosomal locations and sequences of numts amplified using our primers</p>
               </text>
               <file name="1471-2164-7-185-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>The following chromosomes were represented in the data: 1, 2, 3, 4, 5, 7, 8, 9, 11, 16, 17, 20 and X. The number of paralogous sequences, in some instances, was lower than the number predicted from BLAST searches (Figure <figr fid="F3">3</figr>, <figr fid="F5">5</figr>). We demonstrate that there are only a limited number of multiple copy numts that potentially contribute to a heteroplasmic signal. Subsequently, we systematically inspected heteroplasmic sites observed in sequences from the prostate cancer samples for numt contribution using our cloned <it>&#961;</it><sup>0 </sup>data as a reference. We discovered false heteroplasmic sites occurred when there was co-amplification of multiple numt loci with the same nucleotide at that particular site. Base pairs 1709, 1711 and 1719 in one specific amplicon (1488&#8211;2084, 16S rRNA) illustrate this point. The amplification of this specific region of the mitochondrial genome also co-amplified numts on chromosomes 3, 5 and 11 (Figures <figr fid="F3">3</figr>, <figr fid="F6">6</figr>). All three chromosomes have an A as opposed to a G, which correspond to mitochondrial positions 1709 and 1719. Using automated DNA sequencing, these multi-copy numts were detected as heteroplasmies at positions 1709 and 1719 (Figure <figr fid="F6">6</figr>). At position 1711, chromosomes 5 and 11 have a C as does the tissue; however, chromosome 3 has a T. A weak heteroplasmic signal is evident by a minute T peak, but because of the poor detection limit of fluorescent sequencing, this peak is virtually equivalent to background (Figure <figr fid="F6">6</figr>). Heteroplasmic signals were detected for other sites as well. For instance, the primer pair for the amplicon (3230&#8211;3893) co-amplified homologous numts on 5 different chromosomes (2, 4, 16, 17 and X). This region is evident in the pseudo-mitochondrial genome assembly from our clones (Figure <figr fid="F4">4</figr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>5' genome location (according to rCRS) and primer sequences for 36 primers including 34 (#3&#8211;36) used to amplify formalin fixed, paraffin embedded tissue. Primers in bold (1, 2) indicate chromosome (Chr) 17 specific primers redesigned to capture rest of D-loop fragment. The region spanned by 15971&#8211;16410 was split into two separate amplicons for the <it>&#961; </it><sup>0 </sup>amplification (15673&#8211;16009 and 15777&#8211;16398).</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer Sequence (5'-3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Mitochondria Position</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Chr</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Accession Number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Nuclear Position</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>16319F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>ATC GCT CAT GGT AGA TAG CAC</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>16319-446</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>337395&#8211;338087</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>446R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>TGT TAG TTG AGG GGT GAC TGTT</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>374F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>AAT CCA ACT CAA CCA GAG CCC A</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>371&#8211;461</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>338011&#8211;338101</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>781R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>TGA GCT GCA CTA ATG CGT GC</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <it>Nuclear Gap</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>338102&#8211;338279</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>574&#8211;783</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>338280&#8211;338489</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>615F</p>
                     </c>
                     <c ca="center">
                        <p>ATG TTT AGA CGG GCT CAC ATC ACC</p>
                     </c>
                     <c ca="center">
                        <p>651&#8211;1247</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_009237.17">NT_009237.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9318994-9318400</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1247R</p>
                     </c>
                     <c ca="center">
                        <p>CAA GAG GTG GTG AGG TTG ATC G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>1051F</p>
                     </c>
                     <c ca="center">
                        <p>ACA ATA GCT AAG ACC CAA ACT GGG AT</p>
                     </c>
                     <c ca="center">
                        <p>1062&#8211;1639</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_009237.17">NT_009237.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9318585-9318008</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1644R</p>
                     </c>
                     <c ca="center">
                        <p>CTC CTA AGT GTA AGT TGG GTG CTT TG</p>
                     </c>
                     <c ca="center">
                        <p>1068&#8211;1618</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_006713.14">NT_006713.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30541827-30541277</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>1488F</p>
                     </c>
                     <c ca="center">
                        <p>CGT CAC CCT CCT CAA GTA TAC TTC</p>
                     </c>
                     <c ca="center">
                        <p>1497&#8211;2049</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_009237.17">NT_009237.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9318150-9317598</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2084R</p>
                     </c>
                     <c ca="center">
                        <p>TAC AAG GGG ATT TAG AGG GTT CTG TG</p>
                     </c>
                     <c ca="center">
                        <p>1497&#8211;2049</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_006713.14">NT_006713.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30541398-30540846</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1497&#8211;2049</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_005612.14">NT_005612.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2832399-2832340</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>1938F</p>
                     </c>
                     <c ca="center">
                        <p>AGA GCA CAC CCG TCT ATG TAG CAA</p>
                     </c>
                     <c ca="center">
                        <p>1938&#8211;2612</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_009237.17">NT_009237.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9317709-9317035</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>2612R</p>
                     </c>
                     <c ca="center">
                        <p>GGA ACA AGT GAT TAT GCT ACC TTT GCA C</p>
                     </c>
                     <c ca="center">
                        <p>1938&#8211;2612</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_005612.14">NT_005612.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2831958-2831284</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1939&#8211;2612</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>339611-340281</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1940&#8211;2612</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023678.15">NT_023678.15</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>902509-901844</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>1971&#8211;2612</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_006713.14">NT_006713.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>30540924-30540284</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2417F</p>
                     </c>
                     <c ca="center">
                        <p>CAC TGT CAA CCC AAC ACA GGC AT</p>
                     </c>
                     <c ca="center">
                        <p>2402&#8211;3078</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_011362.9">NT_011362.9</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>20987219-20986564</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3101R</p>
                     </c>
                     <c ca="center">
                        <p>TAG AAA CCG ACC TGG ATT ACT CCG</p>
                     </c>
                     <c ca="center">
                        <p>2417&#8211;3076</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>340090-340749</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>3021F</p>
                     </c>
                     <c ca="center">
                        <p>CGC TAT TAA AGG TTC GTT TGT TC</p>
                     </c>
                     <c ca="center">
                        <p>3070&#8211;3673</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>340743-341346</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3695R</p>
                     </c>
                     <c ca="center">
                        <p>ATC AGG GCG TAG TTT GAG TTT G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>3230F</p>
                     </c>
                     <c ca="center">
                        <p>GTT AAG ATG GCA GAG CCC GGT AA</p>
                     </c>
                     <c ca="center">
                        <p>3253&#8211;3859</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_016354.17">NT_016354.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>80880160-80879559</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3893R</p>
                     </c>
                     <c ca="center">
                        <p>GTT CGG TTG GTC TCT GCT AGT GT</p>
                     </c>
                     <c ca="center">
                        <p>3253&#8211;3870</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_005058.14">NT_005058.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>9588111-9587524</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3296&#8211;3870</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_037887.4">NT_037887.4</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>3360917-3360343</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3323&#8211;3870</p>
                     </c>
                     <c ca="center">
                        <p>X</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_011630.14">NT_011630.14</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2761822-2761281</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>3347&#8211;3870</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>341020-341543</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>3728F</p>
                     </c>
                     <c ca="center">
                        <p>CAT ATG AAG TCA CCC TAG CCA TC</p>
                     </c>
                     <c ca="center">
                        <p>3814&#8211;4391</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_010718.15">NT_010718.15</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>19103293-19103865</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>4417R</p>
                     </c>
                     <c ca="center">
                        <p>TTT AGC TGA CCT TAC TTT AGG ATG GG</p>
                     </c>
                     <c ca="center">
                        <p>3816&#8211;4391</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>341489-342064</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>4337F</p>
                     </c>
                     <c ca="center">
                        <p>ATG AGA ATC GAA CCC ATC CCT GAG</p>
                     </c>
                     <c ca="center">
                        <p>4361&#8211;5010</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>43543-44192</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>5035R</p>
                     </c>
                     <c ca="center">
                        <p>CAT CCT ATG TGG GTA ATT GAG GAG T</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>4867F</p>
                     </c>
                     <c ca="center">
                        <p>GAC AAA AAC TAG CCC CCA TCT CAA</p>
                     </c>
                     <c ca="center">
                        <p>4866&#8211;5554</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>44048&#8211;44736</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>5646R</p>
                     </c>
                     <c ca="center">
                        <p>GCT TAA TTA AAG TGG CTG ATT TGC GT</p>
                     </c>
                     <c ca="center">
                        <p>5169&#8211;5632</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_005403.15">NT_005403.15</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>62851661-62852120</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>5468F</p>
                     </c>
                     <c ca="center">
                        <p>CAC GCT ACT CCT ACC TAT CTC</p>
                     </c>
                     <c ca="center">
                        <p>5508&#8211;6124</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>343174&#8211;343794</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6145R</p>
                     </c>
                     <c ca="center">
                        <p>CAG TTG CCA AAG CCT CCG ATT ATG</p>
                     </c>
                     <c ca="center">
                        <p>5511&#8211;6121</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>44693&#8211;45303</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>5867F</p>
                     </c>
                     <c ca="center">
                        <p>CAA TGC TTC ACT CAG CCA TTT TAC C</p>
                     </c>
                     <c ca="center">
                        <p>5892&#8211;6481</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>45074&#8211;45663</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>6482R</p>
                     </c>
                     <c ca="center">
                        <p>GAC TGC TGT GAT TAG GAC GG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>6418F</p>
                     </c>
                     <c ca="center">
                        <p>AAC CCC CTG CCA TAA CCC AAT AC</p>
                     </c>
                     <c ca="center">
                        <p>6441&#8211;7056</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>45623-46239</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>7082R</p>
                     </c>
                     <c ca="center">
                        <p>GAA GCC TCC TAT GAT GGC AAA TAC AG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>6911F</p>
                     </c>
                     <c ca="center">
                        <p>TGC AGT GCT CTG AGC CCT AGG ATT</p>
                     </c>
                     <c ca="center">
                        <p>6914&#8211;7521</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>46097-46704</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>7554R</p>
                     </c>
                     <c ca="center">
                        <p>CTT TGA CAA AGT TAT GAA ATG GTT TTT CTA ATA</p>
                     </c>
                     <c ca="center">
                        <p>6935&#8211;7521</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1804907-1804321</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>7400F</p>
                     </c>
                     <c ca="center">
                        <p>CCC ACC CTA CCA CAC ATT CGA A</p>
                     </c>
                     <c ca="center">
                        <p>7453&#8211;8005</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>46636&#8211;47188</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>8029R</p>
                     </c>
                     <c ca="center">
                        <p>GGC TTC AAT CGG GAG TAC TAC TCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>18</p>
                     </c>
                     <c ca="center">
                        <p>7829F</p>
                     </c>
                     <c ca="center">
                        <p>CGC ATC CTT TAC ATA ACA GAC GAG G</p>
                     </c>
                     <c ca="center">
                        <p>7853&#8211;8472</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>47036&#8211;47622</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>8441R</p>
                     </c>
                     <c ca="center">
                        <p>GTT GGG TGA TGA GGA ATA GTG TAA GG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>8346F</p>
                     </c>
                     <c ca="center">
                        <p>CAACACCTCTTTACAGTGAAATGCCC</p>
                     </c>
                     <c ca="center">
                        <p>8471&#8211;8941</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>47652&#8211;48122</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>8959R</p>
                     </c>
                     <c ca="center">
                        <p>CGATAATAACTAGTATGGGGAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>8814F</p>
                     </c>
                     <c ca="center">
                        <p>CCA ACT ATC TAT AAA CCT AGC C</p>
                     </c>
                     <c ca="center">
                        <p>8814&#8211;9427</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_077913.2">NT_077913.2</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>47995&#8211;48594</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>9413R</p>
                     </c>
                     <c ca="center">
                        <p>GCC TTG GTA TGT GCT TTC TCG TGT</p>
                     </c>
                     <c ca="center">
                        <p>8816&#8211;9375</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1803025-1802466</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>21</p>
                     </c>
                     <c ca="center">
                        <p>9247F</p>
                     </c>
                     <c ca="center">
                        <p>GCC CAT GAC CCC TAA CAG G</p>
                     </c>
                     <c ca="center">
                        <p>9268&#8211;9845</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1802573-1801994</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>9868R</p>
                     </c>
                     <c ca="center">
                        <p>CGG ATG AAG CAG ATA GTG AGG</p>
                     </c>
                     <c ca="center">
                        <p>9545&#8211;9859</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_079592.1">NT_079592.1</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>56744603-56744909</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>9711F</p>
                     </c>
                     <c ca="center">
                        <p>CTG GGT CTC TAT TTT ACC CTC C</p>
                     </c>
                     <c ca="center">
                        <p>9730&#8211;10300</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1802112-1801539</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>10285R</p>
                     </c>
                     <c ca="center">
                        <p>GGT AGG GGT AAA AGG AGG GCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>10198F</p>
                     </c>
                     <c ca="center">
                        <p>CCC GCG TCC CTT TCT CCA T</p>
                     </c>
                     <c ca="center">
                        <p>10206&#8211;10768</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1801633-1801071</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>10766R</p>
                     </c>
                     <c ca="center">
                        <p>TTA GCA TTG GAG TAG GTT TAG G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>24</p>
                     </c>
                     <c ca="center">
                        <p>10696F</p>
                     </c>
                     <c ca="center">
                        <p>CCC TAC TAG TCT CAA TCT CCA A</p>
                     </c>
                     <c ca="center">
                        <p>10694&#8211;11509</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_008470.17">NT_008470.17</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2194293&#8211;2194999</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>11426R</p>
                     </c>
                     <c ca="center">
                        <p>CTT CGA CAT GGG CTT TAG GGA G</p>
                     </c>
                     <c ca="center">
                        <p>10751&#8211;11426</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36678748-36678073</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c ca="center">
                        <p>11210F</p>
                     </c>
                     <c ca="center">
                        <p>TTC TAC ACC CTA GTA GGC TCC CTT</p>
                     </c>
                     <c ca="center">
                        <p>11234&#8211;11786</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36678265-36677713</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>11813R</p>
                     </c>
                     <c ca="center">
                        <p>GTA GAG TTT GAA GTC CTT GAG AGA GG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>26</p>
                     </c>
                     <c ca="center">
                        <p>11629F</p>
                     </c>
                     <c ca="center">
                        <p>AAT CAG CCA CAT AGC CCT CGT AG</p>
                     </c>
                     <c ca="center">
                        <p>11651&#8211;12205</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36677848-36677294</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12231R</p>
                     </c>
                     <c ca="center">
                        <p>GTT AGC AGT TCT TGT GAG CTT TCT CG</p>
                     </c>
                     <c ca="center">
                        <p>11841&#8211;12206</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1799998-1799633</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>27</p>
                     </c>
                     <c ca="center">
                        <p>12096F</p>
                     </c>
                     <c ca="center">
                        <p>TCC TAT CCC TCA ACC CCG ACA T</p>
                     </c>
                     <c ca="center">
                        <p>12118&#8211;12681</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36677381-36676818</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12709R</p>
                     </c>
                     <c ca="center">
                        <p>GGA AGA TGA GTA GAT ATT TGA AGA ACT G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>28</p>
                     </c>
                     <c ca="center">
                        <p>12528F</p>
                     </c>
                     <c ca="center">
                        <p>GAA CTG ACA CTG AGC CAC AAC C</p>
                     </c>
                     <c ca="center">
                        <p>12550&#8211;13070</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1799289-1798769</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>13096R</p>
                     </c>
                     <c ca="center">
                        <p>CAA CTA TAG TGC TTG AGT GGA GTA GG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>29</p>
                     </c>
                     <c ca="center">
                        <p>12882F</p>
                     </c>
                     <c ca="center">
                        <p>CAT CCT CGC CTT AGC ATG ATT TAT CC</p>
                     </c>
                     <c ca="center">
                        <p>12908&#8211;13493</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36676591-36676006</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>13516R</p>
                     </c>
                     <c ca="center">
                        <p>GGT CTT TGG AGT AGA AAC CTG TG</p>
                     </c>
                     <c ca="center">
                        <p>12908&#8211;13493</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1798931-1798346</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>30</p>
                     </c>
                     <c ca="center">
                        <p>13239F</p>
                     </c>
                     <c ca="center">
                        <p>CGT AGC CTT CTC CAC TTC AAG TC</p>
                     </c>
                     <c ca="center">
                        <p>13262&#8211;13827</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023148.12">NT_023148.12</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2217633-2218198</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>13851R</p>
                     </c>
                     <c ca="center">
                        <p>GTT GAG GTC TAG GGC TGT TAG AAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>31</p>
                     </c>
                     <c ca="center">
                        <p>13354F</p>
                     </c>
                     <c ca="center">
                        <p>TTT ATG TGC TCC GGG TCC ATC AT</p>
                     </c>
                     <c ca="center">
                        <p>13377&#8211;13935</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023148.12">NT_023148.12</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2217748-2218306</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>13957R</p>
                     </c>
                     <c ca="center">
                        <p>CTA GAT AGG GGA TTG TGC GGT G</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>32</p>
                     </c>
                     <c ca="center">
                        <p>13838F</p>
                     </c>
                     <c ca="center">
                        <p>CCC TAG ACC TCA ACT ACC TAA CC</p>
                     </c>
                     <c ca="center">
                        <p>13895&#8211;14454</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023148.12">NT_023148.12</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2218266-2218823</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>14458R</p>
                     </c>
                     <c ca="center">
                        <p>GAT GGC TAT TGA GGA GTA TCC T</p>
                     </c>
                     <c ca="center">
                        <p>14324&#8211;14535</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36675175-36674964</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>33</p>
                     </c>
                     <c ca="center">
                        <p>14339F</p>
                     </c>
                     <c ca="center">
                        <p>ACC CCA TCA TAC TCT TTC ACC C</p>
                     </c>
                     <c ca="center">
                        <p>14550&#8211;15042</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1797288-1796796</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>15052R</p>
                     </c>
                     <c ca="center">
                        <p>TAG GCC TCG CCC GAT GTG TA</p>
                     </c>
                     <c ca="center">
                        <p>14604&#8211;15051</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_034772.5">NT_034772.5</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>36674895-36674448</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c ca="center">
                        <p>14971F</p>
                     </c>
                     <c ca="center">
                        <p>TGG CTG AAT CAT CCG CTA CCT T</p>
                     </c>
                     <c ca="center">
                        <p>15041&#8211;15785</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>336116-336858</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>15786R</p>
                     </c>
                     <c ca="center">
                        <p>AAA GGG TAG CTT ACT GGT TGT CC</p>
                     </c>
                     <c ca="center">
                        <p>15345&#8211;15774</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023148.12">NT_023148.12</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2219715-2220144</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>35</p>
                     </c>
                     <c ca="center">
                        <p>15673F</p>
                     </c>
                     <c ca="center">
                        <p>ATC CAA ACA ACA AAG CAT AAT ATT TC</p>
                     </c>
                     <c ca="center">
                        <p>15672&#8211;15994</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_023148.12">NT_023148.12</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>2220042-2220364</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>16009R</p>
                     </c>
                     <c ca="center">
                        <p>AAT TAG AAT CTT AGC TTT GGG TG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>36</p>
                     </c>
                     <c ca="center">
                        <p>15777F</p>
                     </c>
                     <c ca="center">
                        <p>GCT ACC CCT TCA TCA CCT TC</p>
                     </c>
                     <c ca="center">
                        <p>15785&#8211;16388</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="NT_024862.13">NT_024862.13</ext-link>
                        </p>
                     </c>
                     <c ca="center">
                        <p>336858-337463</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>16398R</p>
                     </c>
                     <c ca="center">
                        <p>CAA CGG ACC ACT ATC TGA GGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>The distribution of numt clones.</p>
               </caption>
               <text>
                  <p><b>The distribution of numt clones. </b>The distribution of numt clones (based on our primers) across the rCRS reveals regions of the rCRS with multiple numts copies. The pseudo-mitochondrial genome assembled from consensus numt sequences.<b/>The distribution of numt clones across the rCRS reveals sites that could be problematic when primers are designed to targets in these regions. Clone name, chromosomal location and rCRS positions are indicated above each clone<b>.</b></p>
               </text>
               <graphic file="1471-2164-7-185-4"/>
            </fig>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>
                     <b>Our primers recovered lower number of paralogous sequences compared to BLAST searches.</b>
                  </p>
               </caption>
               <text>
                  <p><b>Our primers recovered lower number of paralogous sequences compared to BLAST searches. </b>A BLAST search using the rCRS region covered by the three clones (Figure 3a)<b/>returns more numts representative of this region<b/>(25)<b/>than the three  obtained by our cloning data.</p>
               </text>
               <graphic file="1471-2164-7-185-5"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Multiple numt copies exist in the genome</p>
            </st>
            <p>To cross-validate our cloned data, we analyzed genomic DNA from <it>&#961;</it><sup>0 </sup>cells, blood, and human placenta using mitochondrial primers that co-amplified nuclear loci in the prostate cancer specimens. In blood and human placenta samples, a single mtDNA amplicon was consistently observed (Figure <figr fid="F7">7</figr>, and data not shown). Although sequence analysis of the prostate specimens detected numts, their signals were below the detection limit of agarose gel electrophoresis. In contrast, several primers consistently amplified numts from <it>&#961;</it><sup>0 </sup>cells generating high molecular weight amplifications in addition to the expected mtDNA fragments (Figure <figr fid="F7">7</figr>). These findings confirm the presence of multiple numts loci in the genome and translate into real concern that numts are present in amplifications that produce more that one band or different size amplicons.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>
                     <b>A &#8220;piggyback&#8221; effect resulting from chromosomal copy number and shared divergent sites is demonstrated in a patient sample.</b>
                  </p>
               </caption>
               <text>
                  <p><b>A &#8220;piggyback&#8221; effect resulting from chromosomal copy number and shared divergent sites is demonstrated in a patient sample. </b>The chromatogram is from a patient for whom heteroplasmy at positions 1709 and 1719 were later noted to<b/>be homologous to three chromosomes (3, 5, and 11), suggesting a possible co-amplification of numts in this instance.</p>
               </text>
               <graphic file="1471-2164-7-185-6"/>
            </fig>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>
                     <b>Multiple numt copies are present in the nucleus</b>
                  </p>
               </caption>
               <text>
                  <p><b>Multiple numt copies are present in the nucleus.</b> PCR amplification of total DNA extracted from <it>?</it><sup>0</sup> and blood (bld) cells with primers targeting ND1, ATPase6 and CYTB genes. In contrast to the single amplicons obtained from blood, template from <it>?</it><sup>0</sup> contains additional high molecular weight amplicons.  Lad is a 100bp DNA size standard (Fermentas life sciences).</p>
               </text>
               <graphic file="1471-2164-7-185-7"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Survey of mitochondrial genome mutations associated with disease suggests caution</p>
            </st>
            <p>Based on our findings that false heteroplasmic sites occurred when there was co-amplification of multiple numt loci with the same nucleotide at that particular site, we compared our cloning data to possible disease associated mutations listed on MITOMAP <abbrgrp><abbr bid="B52">52</abbr></abbrgrp> and common sites were noted. In addition, a BLAST search was performed for these sites and hits held in common between the marker and cloning information were scored as well. Numerous commonalities were noted, which is cause for concern (Table <tblr tid="T3">3</tblr>).</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p/>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Locus</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Disease</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Allele</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Hom/Het</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>BLAST hits</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Cloning data</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Leu</p>
                     </c>
                     <c ca="left">
                        <p>MM/CPEO</p>
                     </c>
                     <c ca="left">
                        <p><b>T</b>3250<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>C = 16; A = 1</p>
                     </c>
                     <c ca="left">
                        <p>C = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Leu</p>
                     </c>
                     <c ca="left">
                        <p>CPEO</p>
                     </c>
                     <c ca="left">
                        <p><b>C</b>3254<b>T</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>T = 18; A = 2</p>
                     </c>
                     <c ca="left">
                        <p>T = 2, 4 and 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Leu</p>
                     </c>
                     <c ca="left">
                        <p>MELAS</p>
                     </c>
                     <c ca="left">
                        <p><b>T</b>3291<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>C = 17</p>
                     </c>
                     <c ca="left">
                        <p>C = 2, 4 and 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1</p>
                     </c>
                     <c ca="left">
                        <p>NIDDM; LHON; PEO</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>3316<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 17</p>
                     </c>
                     <c ca="left">
                        <p>A = 2, 4, 16, 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1</p>
                     </c>
                     <c ca="left">
                        <p>LHON</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>3496<b>T</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>T = 14; A = 2</p>
                     </c>
                     <c ca="left">
                        <p>T = X, 2, 4, 16, &amp; 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1</p>
                     </c>
                     <c ca="left">
                        <p>MELAS</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>3697<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>A = 3; C = 1</p>
                     </c>
                     <c ca="left">
                        <p>A = 2 &amp; 4; G = X, 16, 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND1</p>
                     </c>
                     <c ca="left">
                        <p>Adult-Onset Dystonia</p>
                     </c>
                     <c ca="left">
                        <p><b>A</b>3796<b>G</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>G = 6</p>
                     </c>
                     <c ca="left">
                        <p>A = 2,4 &amp; 17; G = X &amp; 16</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>ADPD/Hearing Loss &amp;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gln</p>
                     </c>
                     <c ca="left">
                        <p>Migrane</p>
                     </c>
                     <c ca="left">
                        <p><b>T</b>4336<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>+/+</p>
                     </c>
                     <c ca="left">
                        <p>C = 1</p>
                     </c>
                     <c ca="left">
                        <p>C = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND2</p>
                     </c>
                     <c ca="left">
                        <p>AD;PD</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>5460<b>T</b>/<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/+</p>
                     </c>
                     <c ca="left">
                        <p>T = 5; A = 9</p>
                     </c>
                     <c ca="left">
                        <p>G = 1 (2); T = 2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asn</p>
                     </c>
                     <c ca="left">
                        <p>CPEO/MM</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>5703<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>A = 24</p>
                     </c>
                     <c ca="left">
                        <p>A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>COI</p>
                     </c>
                     <c ca="left">
                        <p>PCA</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>5913<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 18; T = 1</p>
                     </c>
                     <c ca="left">
                        <p>G = 1(2); A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Myogloinuria; Exercise</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CO1</p>
                     </c>
                     <c ca="left">
                        <p>Intolerance</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>5920<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>A = 0</p>
                     </c>
                     <c ca="left">
                        <p>G = 1 (2); A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CO1</p>
                     </c>
                     <c ca="left">
                        <p>PCA</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>5973<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 3</p>
                     </c>
                     <c ca="left">
                        <p>G = 1(2); A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>COI</p>
                     </c>
                     <c ca="left">
                        <p>PCA</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>6081<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 1; T = 1</p>
                     </c>
                     <c ca="left">
                        <p>G = 1 (2); A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ser</p>
                     </c>
                     <c ca="left">
                        <p>MM/Exercise Intolerance</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>7497<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/+</p>
                     </c>
                     <c ca="left">
                        <p>A = 14</p>
                     </c>
                     <c ca="left">
                        <p>A = 5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ATP6</p>
                     </c>
                     <c ca="left">
                        <p>LDYT</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>8950<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 2</p>
                     </c>
                     <c ca="left">
                        <p>A = 5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ATP6</p>
                     </c>
                     <c ca="left">
                        <p>Leigh Disease</p>
                     </c>
                     <c ca="left">
                        <p><b>T</b>9185<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>-/+</p>
                     </c>
                     <c ca="left">
                        <p>C = 1</p>
                     </c>
                     <c ca="left">
                        <p>C = 5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND4</p>
                     </c>
                     <c ca="left">
                        <p>MELAS</p>
                     </c>
                     <c ca="left">
                        <p><b>A</b>11084<b>G</b></p>
                     </c>
                     <c ca="left">
                        <p>+/+</p>
                     </c>
                     <c ca="left">
                        <p>G = 9</p>
                     </c>
                     <c ca="left">
                        <p>G = 9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>His</p>
                     </c>
                     <c ca="left">
                        <p>MICM</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>12192<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 9</p>
                     </c>
                     <c ca="left">
                        <p>G = 5 (3); A = 2(5)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ND5</p>
                     </c>
                     <c ca="left">
                        <p>LHON</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>13708<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 15</p>
                     </c>
                     <c ca="left">
                        <p>A = 5 &amp; 9</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Paracrystalline Inclusions</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CYTB</p>
                     </c>
                     <c ca="left">
                        <p>with Exercise Intolerance</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>15497<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 2</p>
                     </c>
                     <c ca="left">
                        <p>A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Thr</p>
                     </c>
                     <c ca="left">
                        <p>Multiple Sclerosis</p>
                     </c>
                     <c ca="left">
                        <p><b>G</b>15927<b>A</b></p>
                     </c>
                     <c ca="left">
                        <p>+/-</p>
                     </c>
                     <c ca="left">
                        <p>A = 5</p>
                     </c>
                     <c ca="left">
                        <p>G = 5; A = 17</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Type 2 Diabetes;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D-Loop</p>
                     </c>
                     <c ca="left">
                        <p>Cardiomyopathy</p>
                     </c>
                     <c ca="left">
                        <p><b>T</b>16189<b>C</b></p>
                     </c>
                     <c ca="left">
                        <p>+/+</p>
                     </c>
                     <c ca="left">
                        <p>C = 0</p>
                     </c>
                     <c ca="left">
                        <p>C = 17</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><b>Hom: </b>homoplasmy; <b>Het: </b>heteroplasmy;<b>BLAST hits: </b>number of times a unique numt nucleotide location was returned with a BLAST search; <b>Cloning data: </b>designates chromosome(s) location of nucleotide from cloning data; <b>AD: </b>Alzeimer's Disease; <b>ADPD: </b>Alzeimer's and Parkinson's Disease; <b>PD: </b>Parkinson's Disease; <b>CPEO: </b>Chronic Progressive External Opthalmoplegia; <b>PEO: </b>Progressive External Opthalmoplegia; <b>LDYT: </b>Leber's hereditary optic neuropathy and Dystonia; <b>MELAS: </b>Mitochondrial Encephalomyopathy, Lactic Acidosis and Stroke-like episodes; <b>LHON: </b>Leber's Hereditary Optic Neuropathy; <b>MICM: </b>Maternally Inherited Cardiomyopathy; <b>MM: </b>Mitochondrial Myopathy;<b>NIDDM: </b>Non-Insulin Dependent Diabetes; <b>PCA: </b>Prostate Cancer.</p>
               </tblfn>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In this study, we recovered and assembled the entire mitochondrial genome from nuclear loci. Moreover, this "pseudo-mitochondrial genome" involves numts from over half of the human complement of chromosomes, including the X chromosome. This suggests a widespread allocation of numts in the human nuclear genome. Surprisingly, this distribution was achieved with primers routinely used to amplify mtDNA, yet designed without consideration for numts. Seventy-one percent (24/34) of the primers co-amplified numts in prostate cancer tissue samples. This validates prior suggestions that numts are a potential source of misinformation and serves to illustrate the ease of co-amplification of both mtDNA and nuclear embedded paralogous mitochondrial DNA sequences <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Our data demonstrate that contrary to a consensus of opinions that the copy number of the mitochondrial genome "swamps" the signal from numts loci, there are circumstances which favor PCR recovery of numts, such as multiple pseudogene copy number <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. For instance, heteroplasmic mutations had been associated with late-onset Alzheimer's disease <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B53">53</abbr></abbrgrp>; however, these false heteroplasmies resulted from co-amplification of numts <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. Indeed, human numts perplexed ancient DNA studies as well when it was reported that DNA had been recovered and amplified from a Cretaceous dinosaur bone <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. This sequence corresponded to a human numt containing cytochrome <it>b </it>sequence <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>, probably from reagent or sample contamination.</p>
         <p>Direct pseudogene contribution is not always obvious and can confound suggested mtDNA biomarkers. For example, one set of primers in our data set amplifies tRNA<sup>leu </sup>and ND1 (3230&#8211;3893). Subsequent cloning data identified co-amplification of paralogous numts on five chromosomes with this amplicon. Of specific interest are bases 3316, 3496, 3697 and 3796, which are reported as potential disease associated sites <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. These sites are problematic since the reported base changes are consistent with pseudogene presentation in our data. Further, results from new sequencing technologies have suggested that homoplasmic signals may indeed be heteroplasmic in nature <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. In addition, the heteroplasmic patterns seen at bps 3697 and 3796 are mirrored by the nuclear pseudogene patterns (Table <tblr tid="T3">3</tblr>).</p>
         <p>Re-examination of the raw data from the above studies could address if the disease mutations are actually due to co-amplified numts. Potential markers must be thoroughly investigated to preclude the inclusion of false mutations in the interpretation of mtDNA mutations. BLAST searches of nuclear pseudogenes belie the possibility of widespread integration and/or replication of these sequences, since primers may amplify homologous numts embedded elsewhere in the genome. Thus, high copy numbers for these nuclear segments can produce potential misleading heteroplasmic signals.</p>
         <p>Comparative marker studies require the same conditions and primers for meaningful results. For example, proposed MELAS sites T3250C and T3291C (tRNA<sup>leu</sup>) have paralogous nuclear sites <abbrgrp><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr></abbrgrp>. Follow-up work by Akanuma <it>et al</it>. (2000) <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>, demonstrate a corollary numt associated site for T3250C, but not T3291C. A BLAST search shows that these competing sequences are on separate chromosomes (17 and 20) indicating comparison of dissimilar data. In addition, the cloning data here identifies similar regions on chromosomes 2, 4 and 17 (Table <tblr tid="T3">3</tblr>). Clearly there are numerous paralogous loci for mitochondrial tRNA<sup>leu</sup>, the amplification of which depends on location and homology of primer sets.</p>
         <p>Because of this association in our data, we compared our cloning results to the suggested mitochondrial genome disease associated sites listed on MITOMAP <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Results suggest that many mutations require meticulous scrutiny because of paralogous nuclear commonalities. Although many of these mutations may well be actual disease markers, the possibility of numt association may confound detection. For example, proposed prostate cancer mutations (<b>G</b>5913<b>A</b>, <b>G</b>5973<b>A </b>and <b>G</b>6081<b>A</b>) are identified, by cloning data, as resident on chromosomes 1 (2 homologous copies) and 17 even though the authors exercised precautionary measures by scanning a database of known nuclear pseudogenes <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B62">62</abbr></abbrgrp>. A locus on chromosome 6 was identified as a potential co-amplification product, yet chromosomes 1 and 17 were not detected. Co-amplification of numts is primer dependent, which may explain the differences seen here; however, database limitations and the absence of extensive wet-lab numt data obscure the meaning of the marker. Particularly suspicious are those sites which demonstrate heteroplasmy in both normal and disease tissue. This may reflect a consistent pattern of numt amplification, an unintended characteristic of primer design. A subset of the marker work prior to the seminal numt work of Lopez <it>et al</it>. (1994) <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> may need clarification as well. For example, an ND2 lesion associated with Alzheimer's and Parkinson's diseases (<b>G</b>5460<b>T</b>/<b>A) </b>has modulated T and A nucleotides. Both mutations are seen in a BLAST search of numts. Moreover, our cloning data also identifies a G at this point, but not a T, again suggesting the relevance of primer selection; nevertheless, all possible modulations are described in this early work (see Kosel 1994. <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>), yet it remains a primary reference for this lesion.</p>
         <p>If the use of mitochondrial DNA and in particular somatic mitochondrial genome mutations has important utility and medical merit, much of the data requires critical follow-up from a pseudogene perspective. Amplification of <it>&#961;</it><sup>0 </sup>DNA template with primers to identify and eliminate those which co-amplify nuclear pseudogenes is a vital and necessary procedure <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. For example, mitochondrial PCR protocols were simultaneously run on clinical samples and nucleic acid recovered from <it>&#961;</it><sup>0 </sup>cells to identify and exclude co-amplification of numts in work by Coskun <it>et al</it>. <abbrgrp><abbr bid="B64">64</abbr></abbrgrp>. Alternatively, data may be screened by amplification and sequencing of <it>&#961;</it><sup>0 </sup>derived DNA and conflicting sites then backed out of actual data generated with identical primers; however, this approach is labor-intensive <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. Phylogenetic analysis of the data would also help distinguish polymorphisms from authentic mutations <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. In general, and unfortunately the advice by Parfait <it>et al</it>. has been largely ignored <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Our surprising results are not limited to short amplicons, but are also detected in much larger amplicons. For example, the overlapping amplification of chromosome 5 from bp 8816 to 15051 cautions against assuming that long amplicons are pseudogene free. These possibilities and characteristics of the nuclear genome must be considered when using mitochondrial sequence data for population, forensic or disease studies. Although designing and testing primers to avoid co-amplification of numts is a good laboratory practice, compilation of numts representative of the entire mitochondrial genome is valuable to catalog and characterize the overall nuclear burden of these sequences.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Amplification of overlapping numts paralogous to the mitochondrial genome indicates that co-amplification of nuclear mitochondrial pseudogenes is a real problem for accurate sequence interpretation. Not only is co-amplification dependent on the particular amplicon used, but the copy number of these loci is also important. Only certain positions across the mitochondrial genome are associated with multiple copies of numts. Mitochondrial DNA heteroplasmy should be interpreted with caution since they can be the result of nuclear/cytoplasmic co-amplification. Herein, we have demonstrated the robust amplification of numts. This paper is the first to fully sequence the 46 paralogous DNA fragments that represent the entire mitochondrial genome using 36 primer pairs. This is a surprisingly low number, but reveals that only a limited number of paralogous numts are relevant when considering if heteroplasmic call are authentic mutations. Compilation of a complete data set of numt sequences will help others distinguish paralogous nuclear based heteroplasmy in forensic, population and medical applications.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Nucleic acid extraction</p>
            </st>
            <p>All research involving human tissue was approved by the Thunder Bay Regional Health Sciences Centre Ethics Committee in accordance with the Tri-Council Policy Statement for Research Involving Humans <url>http://www.nserc.ca/programs/ethics.htm</url>. Archived formalin fixed and paraffin embedded (FFPE) prostatectomy samples were laser capture microdissected (LCM) and DNA isolated by proteinase K digestion. DNA was isolated from blood using the UltraClean&#8482; DNA BloodSpin kit (<it>MO BIO </it>laboratories, Inc). Human placenta DNA was purchased from Sigma-Aldrich (D4642). <it>&#961;</it><sup>0</sup>cells were prepared from a human osteocarcoma cell line 143B (ATCC CRL-8303) treated with ethidium bromide to deplete cytoplasmic mitochondrial DNA(kindly provided by Eric Shoubridge) <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. Cells were grown to confluence in high glucose DMEM with pyruvate, L-glutamine, uridine (50 &#956;g/ml) and 5% FBS. At confluence cultures were harvested and DNA was extracted using QIAmp DNA Mini Kit.</p>
         </sec>
         <sec>
            <st>
               <p>Amplification, cloning and sequencing</p>
            </st>
            <p>Template from FFPE tissue samples and <it>&#961;</it><sup>0 </sup>cells were amplified using 34 mitochondrial and 2 chromosome 17 primers. Using TaKaRa LA Taq DNA polymerase (Takara Bio Inc.), PCR reactions were performed using the following conditions: 1X LA PCR Buffer II (Mg<sup>2+</sup>plus), 0.4 mM each dNTP mixture, 1X BSA (New England Biolabs Inc.), 0.6 &#956;M each primer, 1.25 Units LA Taq, 0.5% Ficoll 400 and 1 mM tartrazine (20,195-2, Aldrich). Total reaction volume was 25 &#956;l. Cycling parameters were 94&#176;C for 2 minutes, followed by 40 cycles of 94&#176;C for 20 seconds, 30 seconds annealing at primer-specific optimized temperatures, and 72&#176;C for 90 seconds. Cycling was performed on a DNA Engine Tetrad 2 (Bio-Rad, Hercules, CA). PCR products were purified, cloned and sequenced at Lark&#8482; Technologies using in-house standard operating procedures (Houston, Texas). In general, 40 clones from each <it>&#961;</it><sup>0 </sup>amplicon were selected and sequenced in both forward and reverse directions.</p>
         </sec>
         <sec>
            <st>
               <p>Analysis</p>
            </st>
            <p>Sequences were analyzed using the Phred-Phrap-Consed software package <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. The sequences were then grouped based on similarity and a megaBLAST search of NCBI database was performed (using default parameters) to identify all the nuclear co-ordinates of the fragments. This enabled the chromosomal location and nuclear copy number of each amplicon to be determined. Pairwise sequence alignment was performed between the revised Cambridge Reference Sequence (rCRS)<abbrgrp><abbr bid="B67">67</abbr></abbrgrp> and the <it>&#961;</it><sup>0 </sup>clones from the suite of amplicons covering the entire mitochondrial genome using the Sequencher&#8482; software(Gene Codes Corporation).</p>
         </sec>
         <sec>
            <st>
               <p>Southern Blotting</p>
            </st>
            <p>Mitochondrial genomes were cut with <it>Pvu</it>II from 2 ug of total DNA extracted from normal blood and <it>&#961;</it><sup>0 </sup>cells. Digested product was electrophoresed through a 0.4% agarose gel and blotted onto a membrane (Hybond-N<sup>+</sup>, Roche Applied Sciences). Probes were generated from full length mtDNA (16.5 kb) by random primer labeling using the DIG System (Roche Diagnostics). Blots were incubated with probe, washed, blocked, incubated with anti-digoxigenin-AP fragments (Roche Applied Science) and reacted with a chemiluminescent substrate (CDP-Star<sup>&#174;</sup>) and exposed to X-ray film (Kodak) as recommended by the DIG Application Manual for Filter Hybridization (Roche Diagnostics, 2000).</p>
         </sec>
         <sec>
            <st>
               <p>PCR</p>
            </st>
            <p>For reverse transcriptase PCR analysis, total RNA was extracted from <it>&#961;</it><sup>0 </sup>cells and a snap frozen skin sample using standard protocols outlined in the RNeasy Micro Kit manual (Qiagen). A DNase1 treatment step was included in the RNA extraction process to ensure the complete removal of all genomic DNA. We assessed RNA quantity and quality with the ND-1000 spectrophotometer (NanoDrop<sup>&#174; </sup>technologies) and by gel electrophoresis. First strand DNA was synthesized with the Omniscript<sup>&#174; </sup>RT (Qiagen) kit. 2 ul of the cDNA was amplified with primer sets to coding mitochondrial genes and a nuclear gene, 5-aminolaevulinate synthase (hALAS) (Table <tblr tid="T3">3</tblr>), using the PCR conditions described above except the annealing temperature for these primers was 54&#176;C.</p>
            <p>To examine for multiple copy numts, 50 ng of genomic DNA from <it>&#961;</it><sup>0 </sup>cells, blood and human placenta were amplified as described above, using primer sets to OXPHOS genes,.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RLP conceived of and supervised the study, and drafted the manuscript, JM, BR AA, and KR conducted experiments and participated in sequence alignment and data analysis, RW co-coordinated sample collection, GDD conducted experiments and helped draft the manuscript, JPJ provided intellectual insight and helped draft the manuscript, RET designed experiment and helped draft manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Eric Shoubridge for <it>&#961;</it><sup>0 </sup>cells and Lark Technologies for cloning and sequencing. Financial support for this study was provided to Genesis Genomics Inc. by Industry Canada (FedNor), National Research Council-Industrial Research Assistance Program (NRC-IRAP), and Northern Ontario Heritage Fund Corporation (NOHFC).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The DNA revolution in population genetics</p>
            </title>
            <aug>
               <au>
                  <snm>Cavalli-Sforza</snm>
                  <fnm>LL</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <issue>2</issue>
            <fpage>60</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0168-9525(97)01327-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">9520599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Mitochondrial DNA and Human Evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Pakendorf</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Stoneking</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Annu Rev Genomics Hum Genet</source>
            <pubdate>2005</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16124858</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Forensics and mitochondrial DNA: applications, debates, and foundations</p>
            </title>
            <aug>
               <au>
                  <snm>Budowle</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Allard</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Chakraborty</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Annu Rev Genomics Hum Genet</source>
            <pubdate>2003</pubdate>
            <volume>4</volume>
            <fpage>119</fpage>
            <lpage>141</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.genom.4.070802.110352</pubid>
                  <pubid idtype="pmpid" link="fulltext">14527299</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Mitochondrial DNA as a potential tool for early cancer detection</p>
            </title>
            <aug>
               <au>
                  <snm>Parr</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Dakubo</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Thayer</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>McKenney</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Birch-Machin</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Hum Genomics</source>
            <pubdate>2006</pubdate>
            <volume>2</volume>
            <issue>4</issue>
            <fpage>252</fpage>
            <lpage>257</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16460650</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Facile detection of mitochondrial DNA mutations in tumors and bodily fluids</p>
            </title>
            <aug>
               <au>
                  <snm>Fliss</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Usadel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Caballero</snm>
                  <fnm>OL</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Buta</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Eleff</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Jen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sidransky</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>287</volume>
            <issue>5460</issue>
            <fpage>2017</fpage>
            <lpage>2019</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.287.5460.2017</pubid>
                  <pubid idtype="pmpid" link="fulltext">10720328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>On respiratory impairment in cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Warburg</snm>
                  <fnm>O</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1956</pubdate>
            <volume>124</volume>
            <issue>3215</issue>
            <fpage>269</fpage>
            <lpage>270</lpage>
            <xrefbib>
               <pubid idtype="pmpid">13351639</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Mitochondrial defects in cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Carew</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Mol Cancer</source>
            <pubdate>2002</pubdate>
            <volume>1</volume>
            <issue>1</issue>
            <fpage>9</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">149412</pubid>
                  <pubid idtype="pmpid" link="fulltext">12513701</pubid>
                  <pubid idtype="doi">10.1186/1476-4598-1-9</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Mitochondrial DNA alterations in cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Copeland</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Wachsman</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Penta</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Cancer Invest</source>
            <pubdate>2002</pubdate>
            <volume>20</volume>
            <issue>4</issue>
            <fpage>557</fpage>
            <lpage>569</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1081/CNV-120002155</pubid>
                  <pubid idtype="pmpid" link="fulltext">12094550</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Mitochondrial DNA in human malignancy</p>
            </title>
            <aug>
               <au>
                  <snm>Penta</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Wachsman</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Copeland</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>Mutat Res</source>
            <pubdate>2001</pubdate>
            <volume>488</volume>
            <issue>2</issue>
            <fpage>119</fpage>
            <lpage>133</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1383-5742(01)00053-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">11344040</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Mitochondrial DNA mutations in human disease</p>
            </title>
            <aug>
               <au>
                  <snm>Taylor</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Turnbull</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Nat Rev Genet</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>5</issue>
            <fpage>389</fpage>
            <lpage>402</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrg1606</pubid>
                  <pubid idtype="pmpid" link="fulltext">15861210</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Mitochondrial DNA as a cancer biomarker</p>
            </title>
            <aug>
               <au>
                  <snm>Jakupciak</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Markowitz</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Ally</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Coble</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Srivastava</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Barker</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Sidransky</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>CD</fnm>
               </au>
            </aug>
            <source>J Mol Diagn</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <issue>2</issue>
            <fpage>258</fpage>
            <lpage>267</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15858150</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Standards for validation of cancer biomarkers</p>
            </title>
            <aug>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Atha</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Jakupciak</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Cancer Biomarkers</source>
            <pubdate>2005</pubdate>
            <volume>1</volume>
            <fpage>233</fpage>
            <lpage>239</lpage>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Mitochondrial DNA mutations in human neoplasia</p>
            </title>
            <aug>
               <au>
                  <snm>Czarnecka</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Golik</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bartnik</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Appl Genet</source>
            <pubdate>2006</pubdate>
            <volume>47</volume>
            <issue>1</issue>
            <fpage>67</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16424612</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Numt, a recent transfer and tandem amplification of mitochondrial DNA to the nuclear genome of the domestic cat</p>
            </title>
            <aug>
               <au>
                  <snm>Lopez</snm>
                  <fnm>JV</fnm>
               </au>
               <au>
                  <snm>Yuhki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Masuda</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Modi</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>O'Brien</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1994</pubdate>
            <volume>39</volume>
            <issue>2</issue>
            <fpage>174</fpage>
            <lpage>190</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7932781</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Rates of DNA duplication and mitochondrial DNA insertion in the human genome</p>
            </title>
            <aug>
               <au>
                  <snm>Bensasson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Feldman</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Petrov</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>2003</pubdate>
            <volume>57</volume>
            <issue>3</issue>
            <fpage>343</fpage>
            <lpage>354</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00239-003-2485-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">14629044</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Co-amplification of nuclear pseudogenes and assessment of heteroplasmy of mitochondrial DNA mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Parfait</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rustin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Munnich</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rotig</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1998</pubdate>
            <volume>247</volume>
            <issue>1</issue>
            <fpage>57</fpage>
            <lpage>59</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1998.8666</pubid>
                  <pubid idtype="pmpid" link="fulltext">9636653</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Mutations in mitochondrial cytochrome c oxidase genes segregate with late-onset Alzheimer disease</p>
            </title>
            <aug>
               <au>
                  <snm>Davis</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Herrnstadt</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ghosh</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Fahy</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Shinobu</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Galasko</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Thal</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Beal</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Howell</snm>
                  <fnm>N</fnm>
               </au>
               <etal/>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <issue>9</issue>
            <fpage>4526</fpage>
            <lpage>4531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">20756</pubid>
                  <pubid idtype="pmpid" link="fulltext">9114023</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.9.4526</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Apparent mtDNA heteroplasmy in Alzheimer's disease patients and in normals due to PCR amplification of nucleus-embedded mtDNA pseudogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Hirano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shtilbans</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mayeux</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Davidson</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>DiMauro</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Knowles</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Schon</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <issue>26</issue>
            <fpage>14894</fpage>
            <lpage>14899</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">25134</pubid>
                  <pubid idtype="pmpid" link="fulltext">9405710</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.26.14894</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Evidence that two reports of mtDNA cytochrome c oxidase "mutations" in Alzheimer's disease are based on nDNA pseudogenes of recent evolutionary origin</p>
            </title>
            <aug>
               <au>
                  <snm>Davis</snm>
                  <fnm>JN</fnm>
                  <suf>2nd</suf>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>WD</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1998</pubdate>
            <volume>244</volume>
            <issue>3</issue>
            <fpage>877</fpage>
            <lpage>883</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1998.8353</pubid>
                  <pubid idtype="pmpid" link="fulltext">9535760</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Problems in FBI mtDNA database</p>
            </title>
            <aug>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Salas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bravi</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2004</pubdate>
            <volume>305</volume>
            <issue>5689</issue>
            <fpage>1402</fpage>
            <lpage>1404</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.305.5689.1402b</pubid>
                  <pubid idtype="pmpid" link="fulltext">15353782</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>A call for mtDNA data quality control in forensic science</p>
            </title>
            <aug>
               <au>
                  <snm>Yao</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Bravi</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>Forensic Sci Int</source>
            <pubdate>2004</pubdate>
            <volume>141</volume>
            <issue>1</issue>
            <fpage>1</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.forsciint.2003.12.004</pubid>
                  <pubid idtype="pmpid" link="fulltext">15066707</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>A critical reassessment of the role of mitochondria in tumorigenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Salas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yao</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Macaulay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Vega</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Carracedo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>PLoS Med</source>
            <pubdate>2005</pubdate>
            <volume>2</volume>
            <issue>11</issue>
            <fpage>e296</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1240051</pubid>
                  <pubid idtype="pmpid" link="fulltext">16187796</pubid>
                  <pubid idtype="doi">10.1371/journal.pmed.0020296</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>A practical guide to mitochondrial DNA error prevention in clinical, forensic, and population genetics</p>
            </title>
            <aug>
               <au>
                  <snm>Salas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Carracedo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Macaulay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2005</pubdate>
            <volume>335</volume>
            <issue>3</issue>
            <fpage>891</fpage>
            <lpage>899</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2005.07.161</pubid>
                  <pubid idtype="pmpid" link="fulltext">16102729</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Phantom mutation hotspots in human mitochondrial DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Brandstatter</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sanger</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lutz-Bonengel</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Parson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Beraud-Colomb</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wen</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Kong</snm>
                  <fnm>QP</fnm>
               </au>
               <au>
                  <snm>Bravi</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>Electrophoresis</source>
            <pubdate>2005</pubdate>
            <volume>26</volume>
            <issue>18</issue>
            <fpage>3414</fpage>
            <lpage>3429</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/elps.200500307</pubid>
                  <pubid idtype="pmpid" link="fulltext">16167362</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>A reappraisal of complete mtDNA variation in East Asian families with hearing impairment</p>
            </title>
            <aug>
               <au>
                  <snm>Yao</snm>
                  <fnm>YG</fnm>
               </au>
               <au>
                  <snm>Salas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bravi</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2006</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16528519</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The Human MitoChip: a high-throughput sequencing microarray for mitochondrial mutation detection</p>
            </title>
            <aug>
               <au>
                  <snm>Maitra</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gillespie</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Mambo</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fukushima</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Hoque</snm>
                  <fnm>MO</fnm>
               </au>
               <au>
                  <snm>Shah</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Goggins</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Califano</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sidransky</snm>
                  <fnm>D</fnm>
               </au>
               <etal/>
            </aug>
            <source>Genome Res</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <issue>5</issue>
            <fpage>812</fpage>
            <lpage>819</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">479107</pubid>
                  <pubid idtype="pmpid" link="fulltext">15123581</pubid>
                  <pubid idtype="doi">10.1101/gr.2228504</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Mitochondrial diabetes: investigation and identification of a novel mutation</p>
            </title>
            <aug>
               <au>
                  <snm>Lynn</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wardell</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Chinnery</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Turnbull</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Diabetes</source>
            <pubdate>1998</pubdate>
            <volume>47</volume>
            <issue>11</issue>
            <fpage>1800</fpage>
            <lpage>1802</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9792552</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Mitochondrial DNA and disease</p>
            </title>
            <aug>
               <au>
                  <snm>Dimauro</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Davidzon</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Ann Med</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <issue>3</issue>
            <fpage>222</fpage>
            <lpage>232</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/07853890510007368</pubid>
                  <pubid idtype="pmpid" link="fulltext">16019721</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Accurate detection and quantitation of heteroplasmic mitochondrial point mutations by pyrosequencing</p>
            </title>
            <aug>
               <au>
                  <snm>White</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Durston</snm>
                  <fnm>VJ</fnm>
               </au>
               <au>
                  <snm>Seller</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fratter</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Harvey</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Cross</snm>
                  <fnm>NC</fnm>
               </au>
            </aug>
            <source>Genet Test</source>
            <pubdate>2005</pubdate>
            <volume>9</volume>
            <issue>3</issue>
            <fpage>190</fpage>
            <lpage>199</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/gte.2005.9.190</pubid>
                  <pubid idtype="pmpid" link="fulltext">16225398</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Mitochondrial DNA analysis in clinical laboratory diagnostics</p>
            </title>
            <aug>
               <au>
                  <snm>Wong</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Boles</snm>
                  <fnm>RG</fnm>
               </au>
            </aug>
            <source>Clin Chim Acta</source>
            <pubdate>2005</pubdate>
            <volume>354</volume>
            <issue>1&#8211;2</issue>
            <fpage>1</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cccn.2004.11.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">15748595</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Extremely high levels of human mitochondrial DNA heteroplasmy in single hair roots</p>
            </title>
            <aug>
               <au>
                  <snm>Grzybowski</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Electrophoresis</source>
            <pubdate>2000</pubdate>
            <volume>21</volume>
            <issue>3</issue>
            <fpage>548</fpage>
            <lpage>553</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1522-2683(20000201)21:3&lt;548::AID-ELPS548>3.0.CO;2-U</pubid>
                  <pubid idtype="pmpid" link="fulltext">10726758</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Mitochondrial DNA depletion analysis by pseudogene ratioing</p>
            </title>
            <aug>
               <au>
                  <snm>Swerdlow</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Redpath</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Binder</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>JN</fnm>
                  <suf>2nd</suf>
               </au>
               <au>
                  <snm>VandenBerg</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>J Neurosci Methods</source>
            <pubdate>2006</pubdate>
            <volume>150</volume>
            <issue>2</issue>
            <fpage>265</fpage>
            <lpage>271</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jneumeth.2005.06.023</pubid>
                  <pubid idtype="pmpid" link="fulltext">16118020</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Mitochondrial DNA mutations and mitochondrial DNA depletion in gastric cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Hung</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>AF</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Chi</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>HC</fnm>
               </au>
            </aug>
            <source>Genes Chromosomes Cancer</source>
            <pubdate>2005</pubdate>
            <volume>44</volume>
            <issue>1</issue>
            <fpage>19</fpage>
            <lpage>28</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/gcc.20213</pubid>
                  <pubid idtype="pmpid" link="fulltext">15892105</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Mitochondrial DNA mutations and mitochondrial DNA depletion in breast cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Tseng</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Chi</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Hsu</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>HC</fnm>
               </au>
            </aug>
            <source>Genes Chromosomes Cancer</source>
            <pubdate>2006</pubdate>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Mitochondrial DNA determines androgen dependence in prostate cancer cell lines</p>
            </title>
            <aug>
               <au>
                  <snm>Higuchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kudo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>TT</fnm>
               </au>
               <au>
                  <snm>Sasaki</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shirakawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sawyer</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Gotoh</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2006</pubdate>
            <volume>25</volume>
            <issue>10</issue>
            <fpage>1437</fpage>
            <lpage>1445</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1209190</pubid>
                  <pubid idtype="pmpid" link="fulltext">16278679</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Mitochondrial Genome Instability and mtDNA Depletion in Human Cancers</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Chi</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Tam</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>YH</fnm>
               </au>
            </aug>
            <source>Ann N Y Acad Sci</source>
            <pubdate>2005</pubdate>
            <volume>1042</volume>
            <fpage>109</fpage>
            <lpage>122</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1196/annals.1338.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">15965052</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell</p>
            </title>
            <aug>
               <au>
                  <snm>Satoh</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kuroiwa</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Exp Cell Res</source>
            <pubdate>1991</pubdate>
            <volume>196</volume>
            <issue>1</issue>
            <fpage>137</fpage>
            <lpage>140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-4827(91)90467-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">1715276</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Analysis of mtDNA copy number and composition of single mitochondrial particles using flow cytometry and PCR</p>
            </title>
            <aug>
               <au>
                  <snm>Cavelier</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Johannisson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gyllensten</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Exp Cell Res</source>
            <pubdate>2000</pubdate>
            <volume>259</volume>
            <issue>1</issue>
            <fpage>79</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/excr.2000.4949</pubid>
                  <pubid idtype="pmpid" link="fulltext">10942580</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells</p>
            </title>
            <aug>
               <au>
                  <snm>Robin</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Cell Physiol</source>
            <pubdate>1988</pubdate>
            <volume>136</volume>
            <issue>3</issue>
            <fpage>507</fpage>
            <lpage>513</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jcp.1041360316</pubid>
                  <pubid idtype="pmpid">3170646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Nuclear insertion sequences of mitochondrial DNA predominate in hair but not in blood of elephants</p>
            </title>
            <aug>
               <au>
                  <snm>Greenwood</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Paabo</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>1999</pubdate>
            <volume>8</volume>
            <issue>1</issue>
            <fpage>133</fpage>
            <lpage>137</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294X.1999.00507.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9919702</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Unreliable mtDNA data due to nuclear insertions: a cautionary tale from analysis of humans and other great apes</p>
            </title>
            <aug>
               <au>
                  <snm>Thalmann</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Hebler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Poinar</snm>
                  <fnm>HN</fnm>
               </au>
               <au>
                  <snm>Paabo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Vigilant</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2004</pubdate>
            <volume>13</volume>
            <issue>2</issue>
            <fpage>321</fpage>
            <lpage>335</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294X.2003.02070.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14717890</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>The problems and promise of DNA barcodes for species diagnosis of primate biomaterials</p>
            </title>
            <aug>
               <au>
                  <snm>Lorenz</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Hanner</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Philos Trans R Soc Lond B Biol Sci</source>
            <pubdate>2005</pubdate>
            <volume>360</volume>
            <issue>1462</issue>
            <fpage>1869</fpage>
            <lpage>1877</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1098/rstb.2005.1718</pubid>
                  <pubid idtype="pmpid" link="fulltext">16214744</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Somatic Mitochondrial DNA Mutations in Prostate Cancer and Normal Appearing Adjacent Glands in Comparison to Age-Matched Prostate Samples without Malignant Histology</p>
            </title>
            <aug>
               <au>
                  <snm>Parr</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Dakubo</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Crandall</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Maki</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reguly</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Aguirre</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wittock</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Robinson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Alexander</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Birch-Machin</snm>
                  <fnm>MA</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Mol Diagn</source>
            <pubdate>2006</pubdate>
            <volume>8</volume>
            <issue>3</issue>
            <fpage>312</fpage>
            <lpage>319</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16825503</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>A high frequency of sequence alterations is due to formalin fixation of archival specimens</p>
            </title>
            <aug>
               <au>
                  <snm>Williams</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ponten</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Moberg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Soderkvist</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Uhlen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ponten</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sitbon</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lundeberg</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>1999</pubdate>
            <volume>155</volume>
            <issue>5</issue>
            <fpage>1467</fpage>
            <lpage>1471</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10550302</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Effect of fixatives and tissue processing on the content and integrity of nucleic acids</p>
            </title>
            <aug>
               <au>
                  <snm>Srinivasan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sedmak</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jewell</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2002</pubdate>
            <volume>161</volume>
            <issue>6</issue>
            <fpage>1961</fpage>
            <lpage>1971</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12466110</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Structure and chromosomal distribution of human mitochondrial pseudogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Tourmen</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Baris</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Dessen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Jacques</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Malthiery</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Reynier</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>2002</pubdate>
            <volume>80</volume>
            <issue>1</issue>
            <fpage>71</fpage>
            <lpage>77</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.2002.6798</pubid>
                  <pubid idtype="pmpid" link="fulltext">12079285</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Continued colonization of the human genome by mitochondrial DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Ricchetti</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tekaia</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Dujon</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>PLoS Biol</source>
            <pubdate>2004</pubdate>
            <volume>2</volume>
            <issue>9</issue>
            <fpage>E273</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">515365</pubid>
                  <pubid idtype="pmpid" link="fulltext">15361937</pubid>
                  <pubid idtype="doi">10.1371/journal.pbio.0020273</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>NUMTs in sequenced eukaryotic genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Richly</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Leister</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2004</pubdate>
            <volume>21</volume>
            <issue>6</issue>
            <fpage>1081</fpage>
            <lpage>1084</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msh110</pubid>
                  <pubid idtype="pmpid" link="fulltext">15014143</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Mitochondrial DNA-like sequences in the nucleus (NUMTs): insights into our African origins and the mechanism of foreign DNA integration</p>
            </title>
            <aug>
               <au>
                  <snm>Mishmar</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Ruiz-Pesini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Brandon</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Hum Mutat</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <issue>2</issue>
            <fpage>125</fpage>
            <lpage>133</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/humu.10304</pubid>
                  <pubid idtype="pmpid" link="fulltext">14722916</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Pattern of organization of human mitochondrial pseudogenes in the nuclear genome</p>
            </title>
            <aug>
               <au>
                  <snm>Woischnik</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Moraes</snm>
                  <fnm>CT</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2002</pubdate>
            <volume>12</volume>
            <issue>6</issue>
            <fpage>885</fpage>
            <lpage>893</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1383742</pubid>
                  <pubid idtype="pmpid" link="fulltext">12045142</pubid>
                  <pubid idtype="doi">10.1101/gr.227202. Article published online before print in May 2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>A quick, direct method that can differentiate expressed mitochondrial genes from their nuclear pseudogenes</p>
            </title>
            <aug>
               <au>
                  <snm>Collura</snm>
                  <fnm>RV</fnm>
               </au>
               <au>
                  <snm>Auerbach</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>CB</fnm>
               </au>
            </aug>
            <source>Curr Biol</source>
            <pubdate>1996</pubdate>
            <volume>6</volume>
            <issue>10</issue>
            <fpage>1337</fpage>
            <lpage>1339</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0960-9822(02)70720-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">8939570</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>MITOMAP: a human mitochondrial genome database &#8211; 2004 update</p>
            </title>
            <aug>
               <au>
                  <snm>Brandon</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Lott</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Nguyen</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Spolim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Navathe</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Baldi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <issue>Database</issue>
            <fpage>D611</fpage>
            <lpage>613</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">540033</pubid>
                  <pubid idtype="pmpid" link="fulltext">15608272</pubid>
                  <pubid idtype="doi">10.1093/nar/gki079</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Multiplex fluorescence-based primer extension method for quantitative mutation analysis of mitochondrial DNA and its diagnostic application for Alzheimer's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Fahy</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Nazarbaghi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Zomorrodi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Herrnstadt</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Ghosh</snm>
                  <fnm>SS</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>15</issue>
            <fpage>3102</fpage>
            <lpage>3109</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">146869</pubid>
                  <pubid idtype="pmpid" link="fulltext">9224611</pubid>
                  <pubid idtype="doi">10.1093/nar/25.15.3102</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Ancient mtDNA sequences in the human nuclear genome: a potential source of errors in identifying pathogenic mutations</p>
            </title>
            <aug>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Stugard</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Murdock</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schurr</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>MD</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <issue>26</issue>
            <fpage>14900</fpage>
            <lpage>14905</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">25135</pubid>
                  <pubid idtype="pmpid" link="fulltext">9405711</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.26.14900</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>A novel mitochondrial DNA-like sequence in the human nuclear genome</p>
            </title>
            <aug>
               <au>
                  <snm>Herrnstadt</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Clevenger</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Ghosh</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fahy</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Howell</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RE</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>1999</pubdate>
            <volume>60</volume>
            <issue>1</issue>
            <fpage>67</fpage>
            <lpage>77</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/geno.1999.5907</pubid>
                  <pubid idtype="pmpid" link="fulltext">10458912</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>DNA sequence from Cretaceous period bone fragments</p>
            </title>
            <aug>
               <au>
                  <snm>Woodward</snm>
                  <fnm>SR</fnm>
               </au>
               <au>
                  <snm>Weyand</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Bunnell</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1994</pubdate>
            <volume>266</volume>
            <issue>5188</issue>
            <fpage>1229</fpage>
            <lpage>1232</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7973705</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Insertions and duplications of mtDNA in the nuclear genomes of Old World monkeys and hominoids</p>
            </title>
            <aug>
               <au>
                  <snm>Collura</snm>
                  <fnm>RV</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>CB</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1995</pubdate>
            <volume>378</volume>
            <issue>6556</issue>
            <fpage>485</fpage>
            <lpage>489</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/378485a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">7477403</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Diagnosis of mitochondrial disease: assessment of mitochondrial DNA heteroplasmy in blood</p>
            </title>
            <aug>
               <au>
                  <snm>Taylor</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Morris</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Edwardson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Turnbull</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1998</pubdate>
            <volume>251</volume>
            <issue>3</issue>
            <fpage>883</fpage>
            <lpage>887</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1998.9553</pubid>
                  <pubid idtype="pmpid" link="fulltext">9791004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>A novel point mutation in the mitochondrial tRNA(Leu)(UUR) gene in a family with mitochondrial myopathy</p>
            </title>
            <aug>
               <au>
                  <snm>Goto</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tojo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tohyama</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Horai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Ann Neurol</source>
            <pubdate>1992</pubdate>
            <volume>31</volume>
            <issue>6</issue>
            <fpage>672</fpage>
            <lpage>675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ana.410310617</pubid>
                  <pubid idtype="pmpid">1514779</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>A new point mutation at nucleotide pair 3291 of the mitochondrial tRNA(Leu(UUR)) gene in a patient with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS)</p>
            </title>
            <aug>
               <au>
                  <snm>Goto</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tsugane</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tanabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Horai</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1994</pubdate>
            <volume>202</volume>
            <issue>3</issue>
            <fpage>1624</fpage>
            <lpage>1630</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1994.2119</pubid>
                  <pubid idtype="pmpid" link="fulltext">7520241</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Two pathogenic point mutations exist in the authentic mitochondrial genome, not in the nuclear pseudogene</p>
            </title>
            <aug>
               <au>
                  <snm>Akanuma</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Muraki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Komaki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nonaka</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Goto</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Hum Genet</source>
            <pubdate>2000</pubdate>
            <volume>45</volume>
            <issue>6</issue>
            <fpage>337</fpage>
            <lpage>341</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s100380070004</pubid>
                  <pubid idtype="pmpid">11185741</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>mtDNA mutations increase tumorigenicity in prostate cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Petros</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Baumann</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Ruiz-Pesini</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Amin</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>CQ</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Issa</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Flanders</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Hosseini</snm>
                  <fnm>SH</fnm>
               </au>
               <etal/>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <issue>3</issue>
            <fpage>719</fpage>
            <lpage>724</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">545582</pubid>
                  <pubid idtype="pmpid" link="fulltext">15647368</pubid>
                  <pubid idtype="doi">10.1073/pnas.0408894102</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>No association of mutations at nucleotide 5460 of mitochondrial NADH dehydrogenase with Alzheimer's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Kosel</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Egensperger</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mehraein</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Graeber</snm>
                  <fnm>MB</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1994</pubdate>
            <volume>203</volume>
            <issue>2</issue>
            <fpage>745</fpage>
            <lpage>749</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1994.2245</pubid>
                  <pubid idtype="pmpid" link="fulltext">8093052</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Alzheimer's brains harbor somatic mtDNA control-region mutations that suppress mitochondrial transcription and replication</p>
            </title>
            <aug>
               <au>
                  <snm>Coskun</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Beal</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <issue>29</issue>
            <fpage>10726</fpage>
            <lpage>10731</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">490002</pubid>
                  <pubid idtype="pmpid" link="fulltext">15247418</pubid>
                  <pubid idtype="doi">10.1073/pnas.0403649101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation</p>
            </title>
            <aug>
               <au>
                  <snm>King</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Attardi</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1989</pubdate>
            <volume>246</volume>
            <issue>4929</issue>
            <fpage>500</fpage>
            <lpage>503</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2814477</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing</p>
            </title>
            <aug>
               <au>
                  <snm>Nickerson</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Tobe</snm>
                  <fnm>VO</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>14</issue>
            <fpage>2745</fpage>
            <lpage>2751</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">146817</pubid>
                  <pubid idtype="pmpid" link="fulltext">9207020</pubid>
                  <pubid idtype="doi">10.1093/nar/25.14.2745</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Andrews</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Kubacka</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Chinnery</snm>
                  <fnm>PF</fnm>
               </au>
               <au>
                  <snm>Lightowlers</snm>
                  <fnm>RN</fnm>
               </au>
               <au>
                  <snm>Turnbull</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Howell</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>1999</pubdate>
            <volume>23</volume>
            <issue>2</issue>
            <fpage>147</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/13779</pubid>
                  <pubid idtype="pmpid" link="fulltext">10508508</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
