<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
	<ui>1471-2164-5-54</ui>
	<ji>1471-2164</ji>
	<fm>
		<dochead>Research article</dochead>
		<bibl>
			<title>
				<p>From biomedicine to natural history research: EST resources for ambystomatid salamanders</p>
			</title>
			<aug>
				<au id="A1" ce="yes">
					<snm>Putta</snm>
					<fnm>Srikrishna</fnm>
					<insr iid="I1"/>
					<email>sputt2@uky.edu</email>
				</au>
				<au id="A2" ce="yes">
					<snm>Smith</snm>
					<mi>J</mi>
					<fnm>Jeramiah</fnm>
					<insr iid="I1"/>
					<email>jjsmit3@uky.edu</email>
				</au>
				<au id="A3" ce="yes">
					<snm>Walker</snm>
					<mi>A</mi>
					<fnm>John</fnm>
					<insr iid="I1"/>
					<email>jawalk2@uky.edu</email>
				</au>
				<au id="A4">
					<snm>Rondet</snm>
					<fnm>Mathieu</fnm>
					<insr iid="I2"/>
					<email>mrondet@uci.edu</email>
				</au>
				<au id="A5">
					<snm>Weisrock</snm>
					<mi>W</mi>
					<fnm>David</fnm>
					<insr iid="I1"/>
					<email>weisrock@uky.edu</email>
				</au>
				<au id="A6">
					<snm>Monaghan</snm>
					<fnm>James</fnm>
					<insr iid="I1"/>
					<email>james.monaghan@uky.edu</email>
				</au>
				<au id="A7">
					<snm>Samuels</snm>
					<mi>K</mi>
					<fnm>Amy</fnm>
					<insr iid="I1"/>
					<email>aksamu2@uky.edu</email>
				</au>
				<au id="A8">
					<snm>Kump</snm>
					<fnm>Kevin</fnm>
					<insr iid="I1"/>
					<email>kevinkump@gmail.com</email>
				</au>
				<au id="A9">
					<snm>King</snm>
					<mi>C</mi>
					<fnm>David</fnm>
					<insr iid="I3"/>
					<email>dck163@psu.edu</email>
				</au>
				<au id="A10">
					<snm>Maness</snm>
					<mi>J</mi>
					<fnm>Nicholas</fnm>
					<insr iid="I4"/>
					<email>njmaness@wisc.edu</email>
				</au>
				<au id="A11">
					<snm>Habermann</snm>
					<fnm>Bianca</fnm>
					<insr iid="I5"/>
					<email>habermann@mpi-cbg.de</email>
				</au>
				<au id="A12">
					<snm>Tanaka</snm>
					<fnm>Elly</fnm>
					<insr iid="I6"/>
					<email>tanaka@mpi-cbg.de</email>
				</au>
				<au id="A13">
					<snm>Bryant</snm>
					<mi>V</mi>
					<fnm>Susan</fnm>
					<insr iid="I2"/>
					<email>svbryant@uci.edu</email>
				</au>
				<au id="A14">
					<snm>Gardiner</snm>
					<mi>M</mi>
					<fnm>David</fnm>
					<insr iid="I2"/>
					<email>dmgardin@uci.edu</email>
				</au>
				<au id="A15">
					<snm>Parichy</snm>
					<mi>M</mi>
					<fnm>David</fnm>
					<insr iid="I7"/>
					<email>dparichy@mail.utexas.edu</email>
				</au>
				<au id="A16" ca="yes">
					<snm>Voss</snm>
					<fnm>S Randal</fnm>
					<insr iid="I1"/>
					<email>srvoss@uky.edu</email>
				</au>
			</aug>
			<insg>
				<ins id="I1">
					<p>Department of Biology, University of Kentucky, Lexington, KY 40506, USA</p>
				</ins>
				<ins id="I2">
					<p>Department of Developmental and Cell Biology and the Developmental Biology Center, University of California, Irvine, CA 92697, USA</p>
				</ins>
				<ins id="I3">
					<p>The Life Sciences Consortium, 519 Wartik Laboratory, Penn State University, University Park, PA 16802, USA</p>
				</ins>
				<ins id="I4">
					<p>Department of Zoology, University of Wisconsin-Madison, 250 N. Mills, Madison, WI 53706, USA</p>
				</ins>
				<ins id="I5">
					<p>Scionics Computer Innovation GmbH, Pfotenhauerstrasse 110, 01307 Dresden, Germany</p>
				</ins>
				<ins id="I6">
					<p>Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany</p>
				</ins>
				<ins id="I7">
					<p>Section of Integrative Biology and Section of Molecular, Cell and Developmental Biology, Institute for Cellular and Molecular Biology, University of Texas, Austin, TX 78712, USA</p>
				</ins>
			</insg>
			<source>BMC Genomics</source>
			<issn>1471-2164</issn>
			<pubdate>2004</pubdate>
			<volume>5</volume>
			<issue>1</issue>
			<fpage>54</fpage>
			<url>http://www.biomedcentral.com/1471-2164/5/54</url>
			<xrefbib>
				<pubidlist><pubid idtype="pmpid">15310388</pubid><pubid idtype="doi">10.1186/1471-2164-5-54</pubid>
				</pubidlist></xrefbib>
		</bibl>
		<history>
			<rec>
				<date>
					<day>19</day>
					<month>7</month>
					<year>2004</year>
				</date>
			</rec>
			<acc>
				<date>
					<day>13</day>
					<month>8</month>
					<year>2004</year>
				</date>
			</acc>
			<pub>
				<date>
					<day>13</day>
					<month>8</month>
					<year>2004</year>
				</date>
			</pub>
		</history>
		<cpyrt>
			<year>2004</year>
			<collab>Putta et al; licensee BioMed Central Ltd.</collab>
			<note>This is an open-access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
		</cpyrt>
		<abs>
			<sec>
				<st>
					<p>Abstract</p>
				</st>
				<sec>
					<st>
						<p>Background</p>
					</st>
					<p>Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (<it>Ambystoma mexicanum</it>) and Eastern tiger salamander (<it>A. tigrinum tigrinum</it>), species with deep and diverse research histories.</p>
				</sec>
				<sec>
					<st>
						<p>Results</p>
					</st>
					<p>Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for <it>A. mexicanum </it>were processed to yield 35,413 and 20,599 high quality ESTs for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, respectively. Because the <it>A. t. tigrinum </it>ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human &#8211; <it>Ambystoma </it>synteny group with marker loci, and extended PCR primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>orthologues to a related tiger salamander species.</p>
				</sec>
				<sec>
					<st>
						<p>Conclusions</p>
					</st>
					<p>Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research.</p>
				</sec>
			</sec>
		</abs>
	</fm>
	<bdy>
		<sec>
			<st>
				<p>Background</p>
			</st>
			<p>Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. Expressed sequence tags (EST) are particularly useful genomic resources because they enable multiple lines of research and can be generated for any organism: ESTs allow the identification of molecular probes for developmental studies, provide clones for DNA microchip construction, reveal candidate genes for mutant phenotypes, and facilitate studies of genome structure and evolution. Furthermore, ESTs provide raw material from which strain-specific polymorphisms can be identified for use in population and quantitative genetic analyses. The utility of such resources can be tailored to target novel characteristics of organisms when ESTs are isolated from cell types and tissues that are actively being used by a particular research community, so as to bias the collection of sequences towards genes of special interest. Finally, EST resources produced for model organisms can greatly facilitate comparative and evolutionary studies when their uses are extended to other, closely related taxa.</p>
			<p>Salamanders (urodele amphibians) are traditional model organisms whose popularity was unsurpassed early in the 20<sup>th </sup>century. At their pinnacle, salamanders were the primary model for early vertebrate development. Embryological studies in particular revealed many basic mechanisms of development, including organizer and inducer regions of developing embryos <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Salamanders continue to be important vertebrate model organisms for regeneration because they have by far the greatest capacity to regenerate complex body parts in the adult phase. In contrast to mammals, which are not able to regenerate entire structures or organ systems upon injury or amputation, adult salamanders regenerate their limbs, tail, lens, retina, spinal cord, heart musculature, and jaw <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. In addition, salamanders are the model of choice in a diversity of areas, including vision, embryogenesis, heart development, olfaction, chromosome structure, evolution, ecology, science education, and conservation biology <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. All of these disciplines are in need of genomic resources as fewer than 4100 salamander nucleotide sequences had been deposited in GenBank as of 3/10/04.</p>
			<p>Here we describe results from an EST project for two ambystomatid salamanders: the Mexican axolotl, <it>Ambystoma mexicanum </it>and the eastern tiger salamander, <it>A. tigrinum tigrinum</it>. These two species are members of the Tiger Salamander Complex <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, a group of closely related species and subspecies that are widely distributed in North America. Phylogenetic reconstruction suggests that these species probably arose from a common ancestor about 10&#8211;15 million years ago <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. <it>Ambystoma mexicanum </it>has a long research history of over 100 years and is now principally supplied to the research community by the Axolotl Colony <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, while <it>A. t. tigrinum </it>is obtained from natural populations in the eastern United States. Although closely related with equally large genomes (32 &#215; 10<sup>9 </sup>bp)<abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, these two species and others of the Complex differ dramatically in life history: <it>A. mexicanum </it>is a paedomorphic species that retains many larval features and lives in water throughout it's life cycle while <it>A. t. tigrinum </it>undergoes a metamorphosis that is typical of many amphibians. Like many other traditional model organisms of the last century, interest in these two species declined during the rise of genetic models like the fly, zebrafish, and mouse <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. However, "early" model organisms such as salamanders are beginning to re-attract attention as genome resources can rapidly be developed to exploit the unique features that originally identified their utility for research. We make this point below by showing how the development of ESTs for these two species is enabling research in several areas. Furthermore, we emphasize the value of developing resources in model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research programs.</p>
		</sec>
		<sec>
			<st>
				<p>Results and Discussion</p>
			</st>
			<sec>
				<st>
					<p>Selection of libraries for EST sequencing</p>
				</st>
				<p>Eleven cDNA libraries were constructed using a variety of tissues (Table <tblr tid="T1">1</tblr>). Pilot sequencing of randomly selected clones revealed that the majority of the non-normalized libraries were moderate to highly redundant for relatively few transcripts. For example, hemoglobin-like transcripts represented 15&#8211;25% of the sampled clones from cDNA libraries V1, V2, and V6. Accordingly, we chose to focus our sequencing efforts on the non-normalized MATH library as well as the normalized AG library, which had lower levels of redundancy (5.5 and 0.25% globins, respectively). By concentrating our sequencing efforts on these two libraries we obtained transcripts deriving primarily from regenerating larval tissues in <it>A. mexicanum </it>and several non-regenerating larval tissues in <it>A. t. tigrinum</it>.</p>
				<tbl id="T1">
					<title>
						<p>Table 1</p>
					</title>
					<caption>
						<p>Tissues selected to make cDNA libraries.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="center">
								<p>
									<b>ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Tissue</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>cDNAs sequenced</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>GARD</p>
							</c>
							<c ca="center">
								<p>limb blastema</p>
							</c>
							<c ca="center">
								<p>1029</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>MATH</p>
							</c>
							<c ca="center">
								<p>limb blastema</p>
							</c>
							<c ca="center">
								<p>16244</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V1</p>
							</c>
							<c ca="center">
								<p>tail blastema</p>
							</c>
							<c ca="center">
								<p>1422</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V2</p>
							</c>
							<c ca="center">
								<p>brain</p>
							</c>
							<c ca="center">
								<p>3196</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V3</p>
							</c>
							<c ca="center">
								<p>liver</p>
							</c>
							<c ca="center">
								<p>792</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V4</p>
							</c>
							<c ca="center">
								<p>spleen</p>
							</c>
							<c ca="center">
								<p>337</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V5</p>
							</c>
							<c ca="center">
								<p>heart</p>
							</c>
							<c ca="center">
								<p>38</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V6</p>
							</c>
							<c ca="center">
								<p>gill</p>
							</c>
							<c ca="center">
								<p>3039</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>V7</p>
							</c>
							<c ca="center">
								<p>stage 22 embryo</p>
							</c>
							<c ca="center">
								<p>96</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>AG</p>
							</c>
							<c ca="center">
								<p>liver, gonad, lung, kidney, heart, gill</p>
							</c>
							<c ca="center">
								<p>19871</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Further information is found in Methods and Materials.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>EST sequencing and clustering</p>
				</st>
				<p>A total of 46,064 cDNA clones were sequenced, yielding 39,982 high quality sequences for <it>A. mexicanum </it>and <it>A. t. tigrinum </it>(Table <tblr tid="T2">2</tblr>). Of these, 3,745 corresponded to mtDNA and were removed from the dataset; complete mtDNA genome data for these and other ambystomatid species will be reported elsewhere. The remaining nuclear ESTs for each species were clustered and assembled separately. We included in our <it>A. mexicanum </it>assembly an additional 16,030 high quality ESTs that were generated recently for regenerating tail and neurula stage embryos <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Thus, a total of 32,891 and 19,376 ESTs were clustered for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, respectively. Using PaCE clustering and CAP3 assembly, a similar number of EST clusters and contigs were identified for each species (Table <tblr tid="T2">2</tblr>). Overall contig totals were 11,190 and 9,901 for <it>A. mexicanum </it>and <it>A. t. tigrinum </it>respectively. Thus, although 13,515 more <it>A. mexicanum </it>ESTs were assembled, a roughly equivalent number of contigs were obtained for both species. This indicates that EST development was more efficient for <it>A. t. tigrinum, </it>presumably because ESTs were obtained primarily from the normalized AG library; indeed, there were approximately twice as many ESTs on average per <it>A. mexicanum </it>contig (Table <tblr tid="T2">2</tblr>). Thus, our EST project yielded an approximately equivalent number of contigs for <it>A. mexicanum </it>and <it>A. t. tigrinum</it>, and overall we identified &gt; 21,000 different contigs. Assuming that 20% of the contigs correspond to redundant loci, which has been found generally in large EST projects <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, we identified transcripts for approximately 17,000 different ambystomatid loci. If ambystomatid salamanders have approximately the same number of loci as other vertebrates (e.g. <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>), we have isolated roughly half the expected number of genes in the genome.</p>
				<tbl id="T2">
					<title>
						<p>Table 2</p>
					</title>
					<caption>
						<p>EST summary and assembly results.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>cDNA clones sequenced</p>
							</c>
							<c ca="left">
								<p>21830</p>
							</c>
							<c ca="left">
								<p>24234</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>high-quality sequences</p>
							</c>
							<c ca="left">
								<p>19383</p>
							</c>
							<c ca="left">
								<p>20599</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>mt DNA sequence</p>
							</c>
							<c ca="left">
								<p>2522</p>
							</c>
							<c ca="left">
								<p>1223</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>seqs submitted to NCBI</p>
							</c>
							<c ca="left">
								<p>16861</p>
							</c>
							<c ca="left">
								<p>19376</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>sequences assembled</p>
							</c>
							<c ca="left">
								<p>32891<sup>a</sup></p>
							</c>
							<c ca="left">
								<p>19376</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>PaCE clusters</p>
							</c>
							<c ca="left">
								<p>11381</p>
							</c>
							<c ca="left">
								<p>10226</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>ESTs in contigs</p>
							</c>
							<c ca="left">
								<p>25457</p>
							</c>
							<c ca="left">
								<p>12676</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>contigs</p>
							</c>
							<c ca="left">
								<p>3756</p>
							</c>
							<c ca="left">
								<p>3201</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>singlets</p>
							</c>
							<c ca="left">
								<p>7434</p>
							</c>
							<c ca="left">
								<p>6700</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>putative transcripts</p>
							</c>
							<c ca="left">
								<p>11190</p>
							</c>
							<c ca="left">
								<p>9901</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p><sup>a</sup>Includes 16,030 ESTs from [20].</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Identification of vertebrate sequences similar to <it>Ambystoma </it>contigs</p>
				</st>
				<p>We searched all contigs against several vertebrate databases to identify sequences that exhibited significant sequence similarity. As our objective was to reliably annotate as many contigs as possible, we first searched against 19,804 sequences in the NCBI human RefSeq database (Figure <figr fid="F1">1</figr>), which is actively reviewed and curated by biologists. This search revealed 5619 and 4973 "best hit" matches for the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>EST datasets at a BLASTX threshold of <it>E </it>= 10<sup>-7</sup>. The majority of contigs were supported at more stringent E-value thresholds (Table <tblr tid="T3">3</tblr>). Non-matching contigs were subsequently searched against the Non-Redundant (nr) Protein database and <it>Xenopus tropicalus </it>and <it>X. laevis </it>UNIGENE ESTs (Figure <figr fid="F1">1</figr>). These later two searches yielded a few hundred more 'best hit' matches, however a relatively large number of ESTs from both ambystomatid species were not similar to any sequences from the databases above. Presumably, these non-matching sequences were obtained from the non-coding regions of transcripts or they contain protein-coding sequences that are novel to salamander. Although the majority are probably of the former type, we did identify 3,273 sequences from the non-matching set that had open reading frames (ORFs) of at least 200 bp, and 911 of these were greater than 300 bp.</p>
				<fig id="F1">
					<title>
						<p>Figure 1</p>
					</title>
					<caption>
						<p>Results of BLASTX and TBLASTX searches to identify best BLAST hits for <it>Ambystoma </it>contigs searched against NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases</p>
					</caption>
					<text>
						<p><b>Results of BLASTX and TBLASTX searches to identify best BLAST hits for <it>Ambystoma </it>contigs searched against NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases</b>.</p>
					</text>
					<graphic file="1471-2164-5-54-1"/>
				</fig>
				<tbl id="T3">
					<title>
						<p>Table 3</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>contig search of NCBI human RefSeq, nr, and <it>Xenopus </it>Unigene databases.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p># BLASTX Best Matches</p>
							</c>
							<c ca="left">
								<p>
									<ul>6283</ul>
								</p>
							</c>
							<c ca="left">
								<p>
									<ul>5545</ul>
								</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-100</sup></p>
							</c>
							<c ca="left">
								<p>630</p>
							</c>
							<c ca="left">
								<p>870</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-50 </sup>&gt; E<sup>-100</sup></p>
							</c>
							<c ca="left">
								<p>2015</p>
							</c>
							<c ca="left">
								<p>1990</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-20 </sup>&gt; E<sup>-50</sup></p>
							</c>
							<c ca="left">
								<p>2153</p>
							</c>
							<c ca="left">
								<p>1595</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-10 </sup>&gt; E<sup>-20</sup></p>
							</c>
							<c ca="left">
								<p>967</p>
							</c>
							<c ca="left">
								<p>745</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>&lt; E<sup>-7 </sup>&gt; E<sup>-10</sup></p>
							</c>
							<c ca="left">
								<p>518</p>
							</c>
							<c ca="left">
								<p>345</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<p>The distribution of ESTs among contigs can provide perspective on gene expression when clones are randomly sequenced from non-normalized cDNA libraries. In general, frequently sampled transcripts may be expressed at higher levels. We identified the 20 contigs from <it>A. mexicanum </it>and <it>A. t. tigrinum </it>that contained the most assembled ESTs (Table <tblr tid="T4">4</tblr>). The largest <it>A. t. tigrinum </it>contigs contained fewer ESTs than the largest <it>A. mexicanum </it>contigs, probably because fewer overall <it>A. t. tigrinum </it>clones were sequenced, with the majority selected from a normalized library. However, we note that the contig with the most ESTs was identified for <it>A. t. tigrinum: </it>delta globin. In both species, transcripts corresponding to globin genes were sampled more frequently than all other loci. This may reflect the fact that amphibians, unlike mammals, have nucleated red blood cells that are transcriptionally active. In addition to globin transcripts, a few other house-keeping genes were identified in common from both species, however the majority of the contigs were unique to each list. Overall, the strategy of sequencing cDNAs from a diverse collection of tissues (from normalized and non-normalized libraries) yielded different sets of highly redundant contigs. Only 25% and 28% of the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs, respectively, were identified in common (Figure <figr fid="F2">2</figr>). We also note that several hundred contigs were identified in common between Xenopus and <it>Ambystoma</it>; this will help facilitate comparative studies among these amphibian models.</p>
				<tbl id="T4">
					<title>
						<p>Table 4</p>
					</title>
					<caption>
						<p>Top 20 contigs with the most assembled ESTs.</p>
					</caption>
					<tblbdy cols="4">
						<r>
							<c ca="center">
								<p>
									<b>Contig ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b># ESTs</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Best Human Match</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="4">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4615_Contig1</p>
							</c>
							<c ca="center">
								<p>415</p>
							</c>
							<c ca="left">
								<p>(NM_000519) delta globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_600_Contig1</p>
							</c>
							<c ca="center">
								<p>354</p>
							</c>
							<c ca="left">
								<p>(NM_182985) ring finger protein 36 isoform a</p>
							</c>
							<c ca="center">
								<p>E<sup>-110</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6279_Contig1</p>
							</c>
							<c ca="center">
								<p>337</p>
							</c>
							<c ca="left">
								<p>(NM_000559) A-gamma globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-32</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_10867_Contig1</p>
							</c>
							<c ca="center">
								<p>320</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5357_Contig1</p>
							</c>
							<c ca="center">
								<p>307</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-37</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9285_Contig3</p>
							</c>
							<c ca="center">
								<p>285</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_7987_Contig3</p>
							</c>
							<c ca="center">
								<p>252</p>
							</c>
							<c ca="left">
								<p>(NM_001402) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9285_Contig1</p>
							</c>
							<c ca="center">
								<p>240</p>
							</c>
							<c ca="left">
								<p>(NM_001101) beta actin; beta cytoskeletal actin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9279_Contig3</p>
							</c>
							<c ca="center">
								<p>218</p>
							</c>
							<c ca="left">
								<p>(NM_000223) keratin 12</p>
							</c>
							<c ca="center">
								<p>E<sup>-113</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_11203_Contig1</p>
							</c>
							<c ca="center">
								<p>181</p>
							</c>
							<c ca="left">
								<p>(NM_002032) ferritin, heavy polypeptide 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-70</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig2</p>
							</c>
							<c ca="center">
								<p>152</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C</p>
							</c>
							<c ca="center">
								<p>E<sup>-131</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3193_Contig1</p>
							</c>
							<c ca="center">
								<p>145</p>
							</c>
							<c ca="left">
								<p>(NM_004499) heterogeneous nuclear ribonucleoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-90</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig7</p>
							</c>
							<c ca="center">
								<p>134</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C</p>
							</c>
							<c ca="center">
								<p>E<sup>-131</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5005_Contig3</p>
							</c>
							<c ca="center">
								<p>132</p>
							</c>
							<c ca="left">
								<p>(NM_031263) heterogeneous nuclear ribonucleoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-124</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6225_Contig1</p>
							</c>
							<c ca="center">
								<p>125</p>
							</c>
							<c ca="left">
								<p>(NM_001152) solute carrier family 25, member 5</p>
							</c>
							<c ca="center">
								<p>E<sup>-151</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1066_Contig1</p>
							</c>
							<c ca="center">
								<p>122</p>
							</c>
							<c ca="left">
								<p>[31015660] IMAGE:6953586</p>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8737_Contig4</p>
							</c>
							<c ca="center">
								<p>114</p>
							</c>
							<c ca="left">
								<p>(NM_058242) keratin 6C; keratin, epidermal type II</p>
							</c>
							<c ca="center">
								<p>E<sup>-132</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8187_Contig2</p>
							</c>
							<c ca="center">
								<p>113</p>
							</c>
							<c ca="left">
								<p>(NM_005507) cofilin 1 (non-muscle)</p>
							</c>
							<c ca="center">
								<p>E<sup>-65</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_2761_Contig1</p>
							</c>
							<c ca="center">
								<p>109</p>
							</c>
							<c ca="left">
								<p>(NM_001961) eukaryotic translation elongation factor2</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9187_Contig1</p>
							</c>
							<c ca="center">
								<p>105</p>
							</c>
							<c ca="left">
								<p>(NM_007355) heat shock 90 kDa protein 1, beta</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="center">
								<p>
									<b>
										<it>A. t. tigrinum</it>
									</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6298_Contig1</p>
							</c>
							<c ca="center">
								<p>654</p>
							</c>
							<c ca="left">
								<p>(NM_000519) delta globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10099_Contig2</p>
							</c>
							<c ca="center">
								<p>193</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6470_Contig1</p>
							</c>
							<c ca="center">
								<p>167</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_9728_Contig2</p>
							</c>
							<c ca="center">
								<p>142</p>
							</c>
							<c ca="left">
								<p>(NM_000477) albumin precursor</p>
							</c>
							<c ca="center">
								<p>E<sup>-140</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6594_Contig1</p>
							</c>
							<c ca="center">
								<p>117</p>
							</c>
							<c ca="left">
								<p>(NM_001402) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5960_Contig1</p>
							</c>
							<c ca="center">
								<p>91</p>
							</c>
							<c ca="left">
								<p>(NM_001101) beta actin; beta cytoskeletal actin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7383_Contig1</p>
							</c>
							<c ca="center">
								<p>77</p>
							</c>
							<c ca="left">
								<p>(NM_001614) actin, gamma 1 propeptide</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6645_Contig1</p>
							</c>
							<c ca="center">
								<p>76</p>
							</c>
							<c ca="left">
								<p>(NM_001063) transferrin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7226_Contig4</p>
							</c>
							<c ca="center">
								<p>74</p>
							</c>
							<c ca="left">
								<p>(NM_006009) tubulin, alpha 3</p>
							</c>
							<c ca="center">
								<p>E<sup>-160</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7191_Contig1</p>
							</c>
							<c ca="center">
								<p>67</p>
							</c>
							<c ca="left">
								<p>(NM_019016) keratin 24</p>
							</c>
							<c ca="center">
								<p>E<sup>-89</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10121_Contig1</p>
							</c>
							<c ca="center">
								<p>64</p>
							</c>
							<c ca="left">
								<p>(NM_005141) fibrinogen, beta chain preproprotein</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6705_Contig1</p>
							</c>
							<c ca="center">
								<p>63</p>
							</c>
							<c ca="left">
								<p>(NM_000558) alpha 1 globin</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7854_Contig1</p>
							</c>
							<c ca="center">
								<p>62</p>
							</c>
							<c ca="left">
								<p>(NM_021870) fibrinogen, gamma chain isoform</p>
							</c>
							<c ca="center">
								<p>E<sup>-121</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6139_Contig1</p>
							</c>
							<c ca="center">
								<p>52</p>
							</c>
							<c ca="left">
								<p>(NM_001404) eukaryotic translation elongation f1</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7226_Contig2</p>
							</c>
							<c ca="center">
								<p>51</p>
							</c>
							<c ca="left">
								<p>(NM_006009) tubulin, alpha 3</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_10231_Contig1</p>
							</c>
							<c ca="center">
								<p>44</p>
							</c>
							<c ca="left">
								<p>(NM_003018) surfactant, pulmonary-associated prot.</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6619_Contig1</p>
							</c>
							<c ca="center">
								<p>36</p>
							</c>
							<c ca="left">
								<p>(NM_000041) apolipoprotein E</p>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7232_Contig2</p>
							</c>
							<c ca="center">
								<p>35</p>
							</c>
							<c ca="left">
								<p>(NM_003651) cold shock domain protein A</p>
							</c>
							<c ca="center">
								<p>E<sup>-46</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5768_Contig1</p>
							</c>
							<c ca="center">
								<p>34</p>
							</c>
							<c ca="left">
								<p>(NM_003380) vimentin</p>
							</c>
							<c ca="center">
								<p>E<sup>-177</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_9784_Contig3</p>
							</c>
							<c ca="center">
								<p>32</p>
							</c>
							<c ca="left">
								<p>|XP_218445.1| similar to RIKEN cDNA 1810065E05</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<fig id="F2">
					<title>
						<p>Figure 2</p>
					</title>
					<caption>
						<p>Venn diagram of BLAST comparisons among amphibian EST projects</p>
					</caption>
					<text>
						<p><b>Venn diagram of BLAST comparisons among amphibian EST projects. </b>Values provided are numbers of reciprocal best BLAST hits (<it>E&lt;</it>10<sup>-20</sup>) among quality masked <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies and a publicly available <it>X. tropicalis </it>EST assembly <url>http://www.sanger.ac.uk/Projects/X_tropicalis</url></p>
					</text>
					<graphic file="1471-2164-5-54-2"/>
				</fig>
			</sec>
			<sec>
				<st>
					<p>Functional annotation</p>
				</st>
				<p>For the 10,592 contigs that showed significant similarity to sequences from the human RefSeq database, we obtained Gene Ontology (23) information to describe ESTs in functional terms. Although there are hundreds of possible annotations, we chose a list of descriptors for molecular and biological processes that we believe are of interest for research programs currently utilizing salamanders as model organisms (Table <tblr tid="T5">5</tblr>). In all searches, we counted each match between a contig and a RefSeq sequence as identifying a different ambystomatid gene, even when different contigs matched the same RefSeq reference. In almost all cases, approximately the same number of matches was found per functional descriptor for both species. This was not simply because the same loci were being identified for both species, as only 20% of the total number of searched contigs shared sufficient identity (BLASTN; <it>E&lt;</it>10<sup>-80 </sup>or <it>E&lt;</it>10<sup>-20</sup>) to be potential homologues. In this sense, the sequencing effort between these two species was complementary in yielding a more diverse collection of ESTs that were highly similar to human gene sequences.</p>
				<tbl id="T5">
					<title>
						<p>Table 5</p>
					</title>
					<caption>
						<p>Functional annotation of contigs</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>
									<b>
										<it>A. mex</it>
									</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>
										<it>A. t. tig</it>
									</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Molecular Function (0016209)</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>antioxidant (0016209)</p>
							</c>
							<c ca="center">
								<p>25</p>
							</c>
							<c ca="center">
								<p>29</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>binding (0005488)</p>
							</c>
							<c ca="center">
								<p>3117</p>
							</c>
							<c ca="center">
								<p>2578</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>chaparone (0003754)</p>
							</c>
							<c ca="center">
								<p>100</p>
							</c>
							<c ca="center">
								<p>85</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>enzyme regulation (003023)</p>
							</c>
							<c ca="center">
								<p>193</p>
							</c>
							<c ca="center">
								<p>223</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>motor (0003774)</p>
							</c>
							<c ca="center">
								<p>73</p>
							</c>
							<c ca="center">
								<p>75</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>signal transduction (0004871)</p>
							</c>
							<c ca="center">
								<p>344</p>
							</c>
							<c ca="center">
								<p>375</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>structural protein (0005198)</p>
							</c>
							<c ca="center">
								<p>501</p>
							</c>
							<c ca="center">
								<p>411</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>transcriptional reg. (0030528)</p>
							</c>
							<c ca="center">
								<p>296</p>
							</c>
							<c ca="center">
								<p>221</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>translational reg. (0045182)</p>
							</c>
							<c ca="center">
								<p>94</p>
							</c>
							<c ca="center">
								<p>59</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>bone remodeling (0046849)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>circulation (0008015)</p>
							</c>
							<c ca="center">
								<p>23</p>
							</c>
							<c ca="center">
								<p>78</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>immune response (000695)</p>
							</c>
							<c ca="center">
								<p>182</p>
							</c>
							<c ca="center">
								<p>263</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>respiratory ex. (0009605)</p>
							</c>
							<c ca="center">
								<p>254</p>
							</c>
							<c ca="center">
								<p>288</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>respiratory in. (0009719)</p>
							</c>
							<c ca="center">
								<p>72</p>
							</c>
							<c ca="center">
								<p>58</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>stress (0006950)</p>
							</c>
							<c ca="center">
								<p>263</p>
							</c>
							<c ca="center">
								<p>320</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<b>Biological Process (0008150)</b>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Cellular (0009987)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>activation (0001775)</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
							<c ca="center">
								<p>6</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>aging and death (0008219)</p>
							</c>
							<c ca="center">
								<p>158</p>
							</c>
							<c ca="center">
								<p>148</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>communication (0007154)</p>
							</c>
							<c ca="center">
								<p>701</p>
							</c>
							<c ca="center">
								<p>696</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>differentiation (0030154)</p>
							</c>
							<c ca="center">
								<p>31</p>
							</c>
							<c ca="center">
								<p>20</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>extracellular mat. (0043062)</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
							<c ca="center">
								<p>4</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>growth and main. (0008151)</p>
							</c>
							<c ca="center">
								<p>1731</p>
							</c>
							<c ca="center">
								<p>1445</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>migration (0016477)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>14</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>motility (0006928)</p>
							</c>
							<c ca="center">
								<p>163</p>
							</c>
							<c ca="center">
								<p>154</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Developmental (0007275)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>aging (0007568)</p>
							</c>
							<c ca="center">
								<p>32</p>
							</c>
							<c ca="center">
								<p>21</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>embryonic (0009790)</p>
							</c>
							<c ca="center">
								<p>6</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>growth (0040007)</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>morphogenesis (0009653)</p>
							</c>
							<c ca="center">
								<p>350</p>
							</c>
							<c ca="center">
								<p>272</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>pigment (0048066)</p>
							</c>
							<c ca="center">
								<p>13</p>
							</c>
							<c ca="center">
								<p>26</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>post embryonic (0009791)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>13</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>reproduction (0000003)</p>
							</c>
							<c ca="center">
								<p>42</p>
							</c>
							<c ca="center">
								<p>27</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>
									<ul>Physiological (0007582)</ul>
								</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>coagulation (0050817)</p>
							</c>
							<c ca="center">
								<p>22</p>
							</c>
							<c ca="center">
								<p>73</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>death and aging (0016265)</p>
							</c>
							<c ca="center">
								<p>159</p>
							</c>
							<c ca="center">
								<p>148</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>homeostasis (0042592)</p>
							</c>
							<c ca="center">
								<p>22</p>
							</c>
							<c ca="center">
								<p>27</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>metabolism (0008152)</p>
							</c>
							<c ca="center">
								<p>3059</p>
							</c>
							<c ca="center">
								<p>2513</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>secretion (0046903)</p>
							</c>
							<c ca="center">
								<p>9</p>
							</c>
							<c ca="center">
								<p>16</p>
							</c>
						</r>
						<r>
							<c indent="1" ca="left">
								<p>sex differentiation (0007548)</p>
							</c>
							<c ca="center">
								<p>3</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Numbers in parentheses reference GO numbers [23].</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Informatic searches for regeneration probes</p>
				</st>
				<p>The value of a salamander model to regeneration research will ultimately rest on the ease in which data and results can be cross-referenced to other vertebrate models. For example, differences in the ability of mammals and salamanders to regenerate spinal cord may reflect differences in the way cells of the ependymal layer respond to injury. As is observed in salamanders, ependymal cells in adult mammals also proliferate and differentiate after spinal cord injury (SCI) <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>; immediately after contusion injury in adult rat, ependymal cell numbers increase and proliferation continues for at least 4 days [<abbrgrp><abbr bid="B26">26</abbr></abbrgrp>; but see <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>]. Rat ependymal cells share some of the same gene expression and protein properties of embryonic stem cells <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, however no new neurons have been observed to derive from these cells <it>in vivo </it>after SCI <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Thus, although endogenous neural progenitors of the ependymal layer may have latent regenerative potential in adult mammals, this potential is not realized. Several recently completed microarray analyses of spinal cord injury in rat now make it possible to cross-reference information between amphibians and mammals. For example, we searched the complete list of significantly up and down regulated genes from Carmel et al. <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and Song et al. <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> against all <it>Ambystoma </it>ESTs. Based upon amino acid sequence similarity of translated ESTs (TBLASTX; <it>E</it>&lt;10<sup>-7</sup>), we identified DNA sequences corresponding to 69 of these 164 SCI rat genes (Table <tblr tid="T6">6</tblr>). It is likely that we have sequence corresponding to other presumptive orthologues from this list as many of our ESTs only contain a portion of the coding sequence or the untranslated regions (UTR), and in many cases our searches identified closely related gene family members. Thus, many of the genes that show interesting expression patterns after SCI in rat can now be examined in salamander.</p>
				<tbl id="T6">
					<title>
						<p>Table 6</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>contigs that show sequence similarity to rat spinal cord injury genes.</p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>
									<b>Ambystoma Contig ID</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>RAT cDNA clone</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_7440_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1150557|c-myc, exon 2</p>
							</c>
							<c ca="center">
								<p>E<sup>-29</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4624_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1468968| brain acyl-CoA synthtase II</p>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4083_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_4_G20_ab1</p>
							</c>
							<c ca="left">
								<p>gi|1552375| SKR6 gene, a CB1 cannabinoid recept.</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT009B_B04</p>
							</c>
							<c ca="left">
								<p>gi|17352488| cyclin ania-6a</p>
							</c>
							<c ca="center">
								<p>E<sup>-46</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_3719_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-114</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8423_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1778068| binding zyginI</p>
							</c>
							<c ca="center">
								<p>E<sup>-102</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7064_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1836160| Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3225_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|1906612| Rattus norvegicus CXC chemokine</p>
							</c>
							<c ca="center">
								<p>E<sup>-68</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_13_F03_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-38</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL285B_A06</p>
							</c>
							<c ca="left">
								<p>gi|203042| (Na+, K+)-ATPase-beta-2 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6994_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-65</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL014B_F12</p>
							</c>
							<c ca="left">
								<p>gi|203048| plasma membrane Ca2+ ATPase-isoform 2</p>
							</c>
							<c ca="center">
								<p>E<sup>-112</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_5_F07_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-92</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1251_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|203167| GTP-binding protein (G-alpha-i1)</p>
							</c>
							<c ca="center">
								<p>E<sup>-110</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_3_P14_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-152</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_22_B01_ab1</p>
							</c>
							<c ca="left">
								<p>gi|203336| catechol-O-methyltransferase</p>
							</c>
							<c ca="center">
								<p>E<sup>-47</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_17_N04_ab1</p>
							</c>
							<c ca="left">
								<p>gi|203467| voltage-gated K+ channel protein (RK5)</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v1_p8_c16_triplex5ld_</p>
							</c>
							<c ca="left">
								<p>gi|203583| cytosolic retinol-binding protein (CRBP)</p>
							</c>
							<c ca="center">
								<p>E<sup>-77</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6321_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-18</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_5399_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|204647| heme oxygenase gene</p>
							</c>
							<c ca="center">
								<p>E<sup>-67</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2577_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-67</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4647_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|204664| heat shock protein 27 (Hsp27)</p>
							</c>
							<c ca="center">
								<p>E<sup>-83</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_12_M05_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-51</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL285C_F02</p>
							</c>
							<c ca="left">
								<p>gi|205404| metabotropic glutamate receptor 3</p>
							</c>
							<c ca="center">
								<p>E<sup>-41</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_2_B24_ab1</p>
							</c>
							<c ca="left">
								<p>gi|205508| myelin/oligodendrocyte glycoprotein</p>
							</c>
							<c ca="center">
								<p>E<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5740_V2_p10_M20_TriplEx5ld_</p>
							</c>
							<c ca="left">
								<p>gi|205531| metallothionein-2 and metallothionein 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_V2_p5_A2_TriplEx5ld_</p>
							</c>
							<c ca="left">
								<p>gi|205537| microtubule-associated protein 1A</p>
							</c>
							<c ca="center">
								<p>E<sup>-59</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_1645_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|205633| Na, K-ATPase alpha-2 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-149</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig328</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig45</p>
							</c>
							<c ca="left">
								<p>gi|205683| smallest neurofilament protein (NF-L)</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT016A_A09</p>
							</c>
							<c ca="left">
								<p>gi|205693| nerve growth factor-induced (NGFI-A)</p>
							</c>
							<c ca="center">
								<p>E<sup>-95</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_I09_Ag2_p9_K24_M13R</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT007A_E07</p>
							</c>
							<c ca="left">
								<p>gi|205754| neuronal protein (NP25)</p>
							</c>
							<c ca="center">
								<p>E<sup>-64</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_7148_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-57</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9504_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|206161| peripheral-type benzodiazepine receptor</p>
							</c>
							<c ca="center">
								<p>E<sup>-73</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL016B_B02</p>
							</c>
							<c ca="left">
								<p>gi|206166| protein kinase C type III</p>
							</c>
							<c ca="center">
								<p>E<sup>-36</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_981_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-27</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_19_k3_t3_</p>
							</c>
							<c ca="left">
								<p>gi|206170| brain type II Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-117</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v11_p42_j20_t3_049_ab1 gi|207138| norvegicus syntaxin B</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>1e<sup>-079</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_h19_t3_</p>
							</c>
							<c ca="left">
								<p>gi|207473| neural receptor protein-tyrosine kinase</p>
							</c>
							<c ca="center">
								<p>E<sup>-40</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig336</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_E10_Ag2_p18_O19_M13</p>
							</c>
							<c ca="left">
								<p>gi|2116627| SNAP-25A</p>
							</c>
							<c ca="center">
								<p>E<sup>-123</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_211_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|220713| calcineurin A alpha</p>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_7_K14_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-87</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT014A_G03</p>
							</c>
							<c ca="left">
								<p>gi|220839| platelet-derived growth factor A chain</p>
							</c>
							<c ca="center">
								<p>E<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_9_M15_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-56</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_19_M06_ab1</p>
							</c>
							<c ca="left">
								<p>gi|2501807| brain digoxin carrier protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-55</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig100</p>
							</c>
							<c ca="left">
								<p>gi|2746069| MAP-kinase phosphatase (cpg21)</p>
							</c>
							<c ca="center">
								<p>E<sup>-108</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_A16_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-70</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8345_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|2832312| survival motor neuron (smn)</p>
							</c>
							<c ca="center">
								<p>E<sup>-40</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8032_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-49</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3580_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|294567| heat shock protein 70 (HSP70)</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8592_Contig2</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-161</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_17_N08_ab1</p>
							</c>
							<c ca="left">
								<p>gi|2961528| carboxyl-terminal PDZ</p>
							</c>
							<c ca="center">
								<p>E<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL286C_D09</p>
							</c>
							<c ca="left">
								<p>gi|298325| sodium-dependent neurotransmitter tran.</p>
							</c>
							<c ca="center">
								<p>E<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig95</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig461</p>
							</c>
							<c ca="left">
								<p>gi|2996031| brain finger protein (BFP)</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_O19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-23</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_E16_Ag2_p8_O20_M13R</p>
							</c>
							<c ca="left">
								<p>gi|3135196| Ca2+/calmodulin-dependent</p>
							</c>
							<c ca="center">
								<p>E<sup>-33</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig188</p>
							</c>
							<c ca="left">
								<p>gi|3252500| CC chemokine receptor protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_6961_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|3319323| suppressor of cytokine signaling-3</p>
							</c>
							<c ca="center">
								<p>E<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_p15_t3_</p>
							</c>
							<c ca="left">
								<p>gi|349552| P-selectin</p>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_218_Contig2</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-99</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_Contig506</p>
							</c>
							<c ca="left">
								<p>gi|3707306| Normalized rat embryo, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-14</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_I16_Ag2_p5_N7_M13R</p>
							</c>
							<c ca="left">
								<p>gi|3711670| Normalized rat muscle, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_V1_p1_a10_Triplex5Ld</p>
							</c>
							<c ca="left">
								<p>gi|3727094| Normalized rat ovary, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_v2_p1_D20_triplex5ld</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT005B_F02</p>
							</c>
							<c ca="left">
								<p>gi|3811504| Normalized rat brain, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_22_I04_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Ag2_p34_N23_M13R</p>
							</c>
							<c ca="left">
								<p>gi|405556| adenylyl cyclase-activated serotonin</p>
							</c>
							<c ca="center">
								<p>E<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_1_H02_ab1</p>
							</c>
							<c ca="left">
								<p>gi|4103371| putative potassium channel TWIK</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4589_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|4135567| Normalized rat embryo, cDNA clone</p>
							</c>
							<c ca="center">
								<p>E<sup>-32</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Contig220</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4093_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|4228395| cDNA clone UI-R-A0-bc-h-02-0-UI</p>
							</c>
							<c ca="center">
								<p>E<sup>-104</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_21_2_m7_t3_</p>
							</c>
							<c ca="left">
								<p>gi|425471| nuclear factor kappa B p105 subunit</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_8535_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v6_p1_j6_triplex5_1ld_</p>
							</c>
							<c ca="left">
								<p>gi|430718| Sprague Dawley inducible nitric oxide</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_15_D22_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-41</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_3498_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|436934| Sprague Dawley protein kinase C rec.</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_6648_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL279A_B12</p>
							</c>
							<c ca="left">
								<p>gi|464196| phosphodiesterase I</p>
							</c>
							<c ca="center">
								<p>E<sup>-49</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_25_P03_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-75</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_8708_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|466438| 40kDa ribosomal protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-168</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5877_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-168</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_14_a9_t3_</p>
							</c>
							<c ca="left">
								<p>gi|493208| stress activated protein kinase alpha II</p>
							</c>
							<c ca="center">
								<p>E<sup>-51</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_11_A13_ab1</p>
							</c>
							<c ca="left">
								<p>gi|517393| tau microtubule-associated protein</p>
							</c>
							<c ca="center">
								<p>E<sup>-44</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_12_J14_ab1</p>
							</c>
							<c ca="left">
								<p>gi|55933| c-fos</p>
							</c>
							<c ca="center">
								<p>E<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_nm_21_2_l13_t3_</p>
							</c>
							<c ca="left">
								<p>gi|56822| major synaptic vesicel protein p38</p>
							</c>
							<c ca="center">
								<p>E<sup>-39</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2065_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-50</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_10965_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|56828| nuclear oncoprotein p53</p>
							</c>
							<c ca="center">
								<p>E<sup>-75</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5315_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-66</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_4245_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|56909| pJunB gene</p>
							</c>
							<c ca="center">
								<p>E<sup>-50</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_G05_Ag2_p9_G8_M13R</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT013D_C12</p>
							</c>
							<c ca="left">
								<p>gi|56919| region fragment for protein kinase C</p>
							</c>
							<c ca="center">
								<p>E<sup>-33</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_21_H19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9585_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|57007| ras-related mRNA rab3</p>
							</c>
							<c ca="center">
								<p>E<sup>-61</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_4885_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-63</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_1_M03_ab1</p>
							</c>
							<c ca="left">
								<p>gi|57238| silencer factor B</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_NT008B_D05</p>
							</c>
							<c ca="left">
								<p>gi|57341| transforming growth factor-beta 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_24_I16_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexCluster_9533_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|57479| vimentin</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_5768_Contig1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_BL283B_A11</p>
							</c>
							<c ca="left">
								<p>gi|596053| immediate early gene transcription</p>
							</c>
							<c ca="center">
								<p>E<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_13_J19_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-16</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v6_p4_j2_triplex5_1ld_</p>
							</c>
							<c ca="left">
								<p>gi|790632| macrophage inflammatory protein-1alpha</p>
							</c>
							<c ca="center">
								<p>E<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigCluster_2146_Contig1</p>
							</c>
							<c ca="left">
								<p>gi|951175| limbic system-associated membrane prot.</p>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>MexSingletonClusters_v11_p54_o4_t3_</p>
							</c>
							<c ca="left">
								<p>gi|971274| neurodegeneration associated protein 1</p>
							</c>
							<c ca="center">
								<p>E<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>TigSingletonClusters_Salamander_2_J12_ab1</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>E<sup>-11</sup></p>
							</c>
						</r>
					</tblbdy>
				</tbl>
				<p>Similar gene expression programs may underlie regeneration of vertebrate appendages such as fish fins and tetrapod limbs. Regeneration could depend on reiterative expression of genes that function in patterning, morphogenesis, and metabolism during normal development and homeostasis. Or, regeneration could depend in part on novel genes that function exclusively in this process. We investigated these alternatives by searching <it>A. mexicanum </it>limb regeneration ESTs against UNIGENE zebrafish fin regeneration ESTs (Figure <figr fid="F3">3</figr>). This search identified 1357 significant BLAST hits (TBLASTX; <it>E</it>&lt;10<sup>-7</sup>) that corresponded to 1058 unique zebrafish ESTs. We then asked whether any of these potential regeneration homologues were represented uniquely in limb and fin regeneration databases (and not in databases derived from other zebrafish tissues). A search of the 1058 zebrafish ESTs against &gt; 400,000 zebrafish ESTs that were sampled from non-regenerating tissues revealed 43 that were unique to the zebrafish regeneration database (Table <tblr tid="T7">7</tblr>). Conceivably, these 43 ESTs may represent transcripts important to appendage regeneration. For example, our search identified several genes (e.g. <it>hspc128</it>, pre-<it>B-cell colony enhancing factor 1</it>, <it>galectin 4</it>, <it>galectin 8</it>) that may be expressed in progenitor cells that proliferate and differentiate during appendage regeneration. Overall, our results suggest that regeneration is achieved largely through the reiterative expression of genes having additional functions in other developmental contexts, however a small number of genes may be expressed uniquely during appendage regeneration.</p>
				<fig id="F3">
					<title>
						<p>Figure 3</p>
					</title>
					<caption>
						<p>Results of BLASTN and TBLASTX searches to identify best BLAST hits for <it>A. mexicanum </it>regeneration ESTs searched against zebrafish EST databases</p>
					</caption>
					<text>
						<p><b>Results of BLASTN and TBLASTX searches to identify best BLAST hits for <it>A. mexicanum </it>regeneration ESTs searched against zebrafish EST databases. </b>A total of 14,961 <it>A. mexicanum </it>limb regeneration ESTs were assembled into 4485 contigs for this search.</p>
					</text>
					<graphic file="1471-2164-5-54-3"/>
				</fig>
				<tbl id="T7">
					<title>
						<p>Table 7</p>
					</title>
					<caption>
						<p><it>Ambystoma </it>limb regeneration contigs that show sequence similarity to zebrafish fin regeneration ESTs</p>
					</caption>
					<tblbdy cols="5">
						<r>
							<c ca="left">
								<p>
									<b>Mex. Contigs</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Human ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Zfish ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="5">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig94</p>
							</c>
							<c ca="center">
								<p>gi|10835079|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-63</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319632</p>
							</c>
							<c ca="center">
								<p>1e<sup>-58</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_30_a11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|32306539|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-58</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312602</p>
							</c>
							<c ca="center">
								<p>1e<sup>-35</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig615</p>
							</c>
							<c ca="center">
								<p>gi|4502693|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-70</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313407</p>
							</c>
							<c ca="center">
								<p>1e<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_23_l13_t3_</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-31</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_9_e22_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4758788|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-98</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309914</p>
							</c>
							<c ca="center">
								<p>1e<sup>-29</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_8_l17_t3_</p>
							</c>
							<c ca="center">
								<p>gi|21361310|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-16</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313396</p>
							</c>
							<c ca="center">
								<p>1e<sup>-27</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig531</p>
							</c>
							<c ca="center">
								<p>gi|13775198|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-27</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309680</p>
							</c>
							<c ca="center">
								<p>1e<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig152</p>
							</c>
							<c ca="center">
								<p>gi|5453712|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-32</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239884</p>
							</c>
							<c ca="center">
								<p>1e<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_32h_j20_t3_</p>
							</c>
							<c ca="center">
								<p>gi|39777601|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-79</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136499</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1011</p>
							</c>
							<c ca="center">
								<p>gi|39752675|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136499</p>
							</c>
							<c ca="center">
								<p>1e<sup>-24</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p50_b24_t3_</p>
							</c>
							<c ca="center">
								<p>gi|41208832|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-36</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319219</p>
							</c>
							<c ca="center">
								<p>1e<sup>-23</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig589</p>
							</c>
							<c ca="center">
								<p>gi|4506505|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-56</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312662</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig785</p>
							</c>
							<c ca="center">
								<p>gi|33695095|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-61</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12264765</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig157</p>
							</c>
							<c ca="center">
								<p>gi|21361122|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-138</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313094</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p42_j20_t3_049_ab1</p>
							</c>
							<c ca="center">
								<p>gi|47591841|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-100</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12137806</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig610</p>
							</c>
							<c ca="center">
								<p>gi|10801345|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-114</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310326</p>
							</c>
							<c ca="center">
								<p>1e<sup>-20</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_27_o1_t3_</p>
							</c>
							<c ca="center">
								<p>gi|7706429|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-72</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310422</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig439</p>
							</c>
							<c ca="center">
								<p>gi|4504799|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_31_d5_t3_</p>
							</c>
							<c ca="center">
								<p>gi|8923956|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-50</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12264745</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p41_h12_t3_026_ab1</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig129</p>
							</c>
							<c ca="center">
								<p>gi|34932414|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-103</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313534</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_14_j21_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4505325|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-42</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12136571</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1321</p>
							</c>
							<c ca="center">
								<p>gi|4501857|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-80</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_19_k3_t3_</p>
							</c>
							<c ca="center">
								<p>gi|26051212|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-106</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12137637</p>
							</c>
							<c ca="center">
								<p>1e<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig488</p>
							</c>
							<c ca="center">
								<p>gi|4557525|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-105</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12311975</p>
							</c>
							<c ca="center">
								<p>1e<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_k19_t3_</p>
							</c>
							<c ca="center">
								<p>gi|16950607|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-43</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12196214</p>
							</c>
							<c ca="center">
								<p>1e<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig195</p>
							</c>
							<c ca="center">
								<p>gi|4557231|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-99</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309233</p>
							</c>
							<c ca="center">
								<p>1e<sup>-14</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_14_h19_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4503787|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-86</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p51_d20_t3_</p>
							</c>
							<c ca="center">
								<p>gi|30520322|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-19</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12321150</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g3-n14</p>
							</c>
							<c ca="center">
								<p>gi|13654278|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-23</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12318856</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_29_f2_t3_</p>
							</c>
							<c ca="center">
								<p>gi|4506517|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312662</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g4-h23</p>
							</c>
							<c ca="center">
								<p>gi|24111250|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-33</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312651</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Math_p2_A2_T3_</p>
							</c>
							<c ca="center">
								<p>No human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12078998</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_f4_t3_</p>
							</c>
							<c ca="center">
								<p>gi|41148476|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-67</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319663</p>
							</c>
							<c ca="center">
								<p>1e<sup>-13</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig952</p>
							</c>
							<c ca="center">
								<p>gi|21264558|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-61</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12318843</p>
							</c>
							<c ca="center">
								<p>1e<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g4-g21</p>
							</c>
							<c ca="center">
								<p>gi|11995474|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-65</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12192716</p>
							</c>
							<c ca="center">
								<p>1e<sup>-12</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig854</p>
							</c>
							<c ca="center">
								<p>gi|8922789|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-117</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12313534</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1105</p>
							</c>
							<c ca="center">
								<p>gi|6912638||</p>
							</c>
							<c ca="center">
								<p>1e<sup>-83</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12079967</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_26_f7_t3_</p>
							</c>
							<c ca="center">
								<p>gi|30181238|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-83</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12319880</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig949</p>
							</c>
							<c ca="center">
								<p>gi|21284385|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-68</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12290856</p>
							</c>
							<c ca="center">
								<p>1e<sup>-11</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>g3-n3</p>
							</c>
							<c ca="center">
								<p>gi|18490991|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-64</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320832</p>
							</c>
							<c ca="center">
								<p>1e<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p41_m16_t3_007_ab1</p>
							</c>
							<c ca="center">
								<p>gi|4885661|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-33</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-10</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig653</p>
							</c>
							<c ca="center">
								<p>gi|4505047|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-124</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239868</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Contig1349</p>
							</c>
							<c ca="center">
								<p>gi|9665259|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-46</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320840</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6h12</p>
							</c>
							<c ca="center">
								<p>gi|31317231|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-43</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12321311</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p43h_i14_t3_070_ab1</p>
							</c>
							<c ca="center">
								<p>No Human Hit</p>
							</c>
							<c>
								<p/>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12320916</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_d11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|7661790|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-35</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12196146</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_35h_k22_t3_</p>
							</c>
							<c ca="center">
								<p>gi|5031977|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-124</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12242267</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>v11_p48_g2_t3_087_ab1</p>
							</c>
							<c ca="center">
								<p>gi|11496277|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-60</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312396</p>
							</c>
							<c ca="center">
								<p>1e<sup>-09</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_30_e11_t3_</p>
							</c>
							<c ca="center">
								<p>gi|32483357|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-56</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12309103</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_28_f23_t3_</p>
							</c>
							<c ca="center">
								<p>gi|42544191|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-25</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12239884</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_12_p16_t3_</p>
							</c>
							<c ca="center">
								<p>gi|21361553|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-21</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12310912</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>nm_32h_a8_t3_</p>
							</c>
							<c ca="center">
								<p>gi|11386179|</p>
							</c>
							<c ca="center">
								<p>1e<sup>-22</sup></p>
							</c>
							<c ca="center">
								<p>gnl|UG|Dr#S12312152</p>
							</c>
							<c ca="center">
								<p>1e<sup>-08</sup></p>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p>Human RefSeq sequence ID's are provided to allow cross-referencing.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>DNA sequence polymorphisms within and between <it>A. mexicanum </it>and <it>A. t. tigrinum</it></p>
				</st>
				<p>The identification of single nucleotide polymorphisms (SNPs) within and between orthologous sequences of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>is needed to develop DNA markers for genome mapping <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>, quantitative genetic analysis <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>, and population genetics <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. We estimated within species polymorphism for both species by calculating the frequency of SNPs among ESTs within the 20 largest contigs (Table <tblr tid="T4">4</tblr>). These analyses considered a total of 30,638 base positions for <it>A. mexicanum </it>and 18,765 base positions for <it>A. t. tigrinum</it>. Two classes of polymorphism were considered in this analysis: those occurring at moderate (identified in 10&#8211;30% of the EST sequences) and high frequencies (identified in at least 30% of the EST sequences). Within the <it>A. mexicanum </it>contigs, 0.49% and 0.06% of positions were polymorphic at moderate and high frequency, while higher levels of polymorphism were observed for <it>A. t. tigrinum </it>(1.41% and 0.20%). Higher levels of polymorphism are expected for <it>A. t. tigrinum </it>because they exist in larger, out-bred populations in nature.</p>
				<p>To identify SNPs between species, we had to first identify presumptive, interspecific orthologues. We did this by performing BLASTN searches between the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies, and the resulting alignments were filtered to retain only those alignments between sequences that were one another's reciprocal best BLAST hit. As expected, the number of reciprocal 'best hits' varied depending upon the <it>E </it>value threshold, although increasing the <it>E </it>threshold by several orders of magnitude had a disproportionately small effect on the overall total length of BLAST alignments. A threshold of <it>E&lt;</it>10<sup>-80</sup>yielded 2414 alignments encompassing a total of 1.25 Mbp from each species, whereas a threshold of <it>E&lt;</it>10<sup>-20 </sup>yielded 2820 alignments encompassing a total of 1.32 Mbp. The percent sequence identity of alignments was very high among presumptive orthologues, ranging from 84&#8211;100% at the more stringent <it>E </it>threshold of <it>E&lt;</it>10<sup>-80</sup>. On average, <it>A. mexicanum </it>and <it>A. t. tigrinum </it>transcripts are estimated to be 97% identical at the nucleotide level, including both protein coding and UTR sequence. This estimate for nuclear sequence identity is surprisingly similar to estimates obtained from complete mtDNA reference sequences for these species (96%, unpublished data), and to estimates for partial mtDNA sequence data obtained from multiple natural populations <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. These results are consistent with the idea that mitochondrial mutation rates are lower in cold versus warm-blooded vertebrates <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. From a resource perspective, the high level of sequence identity observed between these species suggests that informatics will enable rapidly the development of probes between these and other species of the <it>A. tigrinum </it>complex.</p>
			</sec>
			<sec>
				<st>
					<p>Extending EST resources to other ambystomatid species</p>
				</st>
				<p>Relatively little DNA sequence has been obtained from species that are closely related to commonly used model organisms, and yet, such extensions would greatly facilitate genetic studies of natural phenotypes, population structures, species boundaries, and conservatism and divergence of developmental mechanisms. Like many amphibian species that are threatened by extinction, many of these ambystomatid salamanders are currently in need of population genetic studies to inform conservation and management strategies [e.g. <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>]. We characterized SNPs from orthologous <it>A. mexicanum </it>and <it>A. t. tigrinum </it>ESTs and extended this information to develop informative molecular markers for a related species, <it>A. ordinarium</it>. <it>Ambystoma ordinarium </it>is a stream dwelling paedomorph endemic to high elevation habitats in central Mexico <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. This species is particularly interesting from an ecological and evolutionary standpoint because it harbors a high level of intraspecific mitochondrial variation, and as an independently derived stream paedomorph, is unique among the typically pond-breeding tiger salamanders. As a reference of molecular divergence, <it>Ambystoma ordinarium </it>shares approximately 98 and 97% mtDNA sequence identity with <it>A. mexicanum </it>and <it>A. t. tigrinum </it>respectively <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>.</p>
				<p>To identify informative markers for <it>A. ordinarium</it>, <it>A. mexicanum and A. t. tigrinum </it>EST contigs were aligned to identify orthologous genes with species-specific sequence variations (SNPs or Insertion/Deletions = INDELs). Primer pairs corresponding to 123 ESTs (Table <tblr tid="T8">8</tblr>) were screened by PCR using a pool of DNA template made from individuals of 10 <it>A. ordinarium </it>populations. Seventy-nine percent (N = 97) of the primer pairs yielded amplification products that were approximately the same size as corresponding <it>A. mexicanum </it>and <it>A. t. tigrinum </it>fragments, using only a single set of PCR conditions. To estimate the frequency of intraspecific DNA sequence polymorphism among this set of DNA marker loci, 43 loci were sequenced using a single individual sampled randomly from each of the 10 populations, which span the geographic range of <it>A. ordinarium</it>. At least one polymorphic site was observed for 20 of the sequenced loci, with the frequency of polymorphisms dependent upon the size of the DNA fragment amplified. Our results suggest that the vast majority of primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>EST orthologues can be used to amplify the corresponding sequence in a related <it>A. tigrinum </it>complex species, and for small DNA fragments in the range of 150&#8211;500 bp, approximately half are expected to have informative polymorphisms.</p>
				<tbl id="T8">
					<title>
						<p>Table 8</p>
					</title>
					<caption>
						<p>EST loci used in a population-level PCR amplification screen in <it>A. ordinarium</it></p>
					</caption>
					<tblbdy cols="3">
						<r>
							<c ca="left">
								<p>
									<b>Locus ID</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Forward Primer 5' to 3'</b>
								</p>
							</c>
							<c ca="left">
								<p>
									<b>Reverse Primer 5' to 3'</b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="3">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>1F8</p>
							</c>
							<c ca="left">
								<p>AAGAAGGTCGGGATTGTGGGTAA</p>
							</c>
							<c ca="left">
								<p>CAGCCTTCCTCTTCATCTTTGTCTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>1H3</p>
							</c>
							<c ca="left">
								<p>GGCAAATGCTGGTCCCAACACAAA</p>
							</c>
							<c ca="left">
								<p>GGACAACACTGCCAAATACCACAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>2C8</p>
							</c>
							<c ca="left">
								<p>GCAAGCACCAGCCACATAAAG</p>
							</c>
							<c ca="left">
								<p>GGCCACCATAACCACTCTGCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>3B10</p>
							</c>
							<c ca="left">
								<p>TCAAAACGAATAAGGGAAGAGCGACTG</p>
							</c>
							<c ca="left">
								<p>TTGCCCCCATAATAAGCCATCCATC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5E7</p>
							</c>
							<c ca="left">
								<p>ACGCTTCGCTGGGGTTGACAT</p>
							</c>
							<c ca="left">
								<p>CGGTAGGATTTCTGGTAGCGAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>5F4</p>
							</c>
							<c ca="left">
								<p>CCGAGATGAGATTTATAGAAGGAC</p>
							</c>
							<c ca="left">
								<p>TAGGGGAAGTTAAACATAGATAGAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6A3</p>
							</c>
							<c ca="left">
								<p>GTTTATGAAGGCGAGAGGGCTATGACCA</p>
							</c>
							<c ca="left">
								<p>ATCTTGTTCTCCTCGCCAGTGCTCTTGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B1</p>
							</c>
							<c ca="left">
								<p>TGATGCTGGCGAGTACAAACCCCCTTCT</p>
							</c>
							<c ca="left">
								<p>TTTACCATTCCTTCCCTTCGGCAGCACA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B3</p>
							</c>
							<c ca="left">
								<p>ACCACGTGCTGTCTTCCCATCCAT</p>
							</c>
							<c ca="left">
								<p>ACGAAGCTCATTGTAGAAGGTGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6B4</p>
							</c>
							<c ca="left">
								<p>CCCACGATGAATTGGAATTGGACAT</p>
							</c>
							<c ca="left">
								<p>CTGCCTGCCAGACCTACAGACTATCGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6C4</p>
							</c>
							<c ca="left">
								<p>ATGGCGCCAAAGTGATGAGTA</p>
							</c>
							<c ca="left">
								<p>GGGCCAGGCACACGACCACAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6D2</p>
							</c>
							<c ca="left">
								<p>ATCAAGGCTGGCATGGTGGTCA</p>
							</c>
							<c ca="left">
								<p>GGGGGTCGTTCTTGCTGTCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>6H8</p>
							</c>
							<c ca="left">
								<p>GAAGAAGACAGAAACGCAGGAGAAAAAC</p>
							</c>
							<c ca="left">
								<p>CGGGCGGGGGCGGGTCACAGTAAAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL005B_A01.5.1</p>
							</c>
							<c ca="left">
								<p>GACAGGTCATGAACTTTTGAAAATAA</p>
							</c>
							<c ca="left">
								<p>AAAGTATATGTACCAAATGGGAGAGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL006A_G07.5.1</p>
							</c>
							<c ca="left">
								<p>GATGTCCTCTCCACTATACAAGTGTG</p>
							</c>
							<c ca="left">
								<p>GTTTGACTTGTCACCACTTTATCAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL012D_F02.5.1</p>
							</c>
							<c ca="left">
								<p>ACAGCCAGAAATAGAAACTTTGAACT</p>
							</c>
							<c ca="left">
								<p>TGAAAGTATGTATTGTTTTCACAGGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL013C_E01.5.1</p>
							</c>
							<c ca="left">
								<p>AGGATGAAATAATATGCTGTGCTTC</p>
							</c>
							<c ca="left">
								<p>ACCGTGATAAACTCCATCCCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL014D_B11.5.1</p>
							</c>
							<c ca="left">
								<p>AGCAAAACTCCTCTATGAATCTCG</p>
							</c>
							<c ca="left">
								<p>ATTGCACACTAAATAGGTGAATACGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>BL279A_G10.5.1</p>
							</c>
							<c ca="left">
								<p>ATGGCAGGATGAAGAAAGACAT</p>
							</c>
							<c ca="left">
								<p>ATGCACTTTGGACCCACTGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1023.5.1</p>
							</c>
							<c ca="left">
								<p>TGTGGTTATTGGACTACTTCACTCTC</p>
							</c>
							<c ca="left">
								<p>AAACGTCCATTTGACACTGTATTTTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1166.5.1</p>
							</c>
							<c ca="left">
								<p>GAATGAAGAGAAAATGTTTTGAAGGT</p>
							</c>
							<c ca="left">
								<p>GCACAGTATTGGCTATGAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1311.5.1</p>
							</c>
							<c ca="left">
								<p>AGAAAACTGTGTCAAGCTTATTTTCC</p>
							</c>
							<c ca="left">
								<p>CAACTTAGTGTTCACATTTCTGAGGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1335.5.1</p>
							</c>
							<c ca="left">
								<p>CCACTTATGGTAGTTCCCACTTTTAT</p>
							</c>
							<c ca="left">
								<p>GCTAAAGAATACCAAGAACCTTTGAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1381.5.1</p>
							</c>
							<c ca="left">
								<p>GTCACAGGTATAACATTGAAAGGATG</p>
							</c>
							<c ca="left">
								<p>TAAATGAATCAAACATTGAAGAGAGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1459.5.1</p>
							</c>
							<c ca="left">
								<p>ATAACAAGGACATGTTCTGCTGG</p>
							</c>
							<c ca="left">
								<p>CTAGCAGAACCCTGTATAGCCTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1506.5.1</p>
							</c>
							<c ca="left">
								<p>AGGATATCCGCTCAGAAATATGAAG</p>
							</c>
							<c ca="left">
								<p>CTGACCACTTGCAAAACTTACTACCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1578.5.1</p>
							</c>
							<c ca="left">
								<p>CCTAGAACATTACCAAAACAGACTCA</p>
							</c>
							<c ca="left">
								<p>AATGAAGAAGTATTGCATGTGAGAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1647.5.1</p>
							</c>
							<c ca="left">
								<p>GTACAACGTCAGGCAAAGCTATTCT</p>
							</c>
							<c ca="left">
								<p>ATCTCCAACACCGTGGCTAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1717.5.1</p>
							</c>
							<c ca="left">
								<p>GAACTTGTTGGCAGGTTTCTCTT</p>
							</c>
							<c ca="left">
								<p>CTAGTGATAGGTTGGACATACCAGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1796.5.1</p>
							</c>
							<c ca="left">
								<p>TGTGGGTATGTATATGGCTAACTTGT</p>
							</c>
							<c ca="left">
								<p>AGATTTTATGTGCTACTGCATTTACG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1908.5.1</p>
							</c>
							<c ca="left">
								<p>CTCATGACTTAATTGCTGTTCTTCG</p>
							</c>
							<c ca="left">
								<p>ATAACCATTCTGAGGTTTTGAGTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1941.5.1</p>
							</c>
							<c ca="left">
								<p>ATCTCCTGCTTCATCTCTTGATTTAT</p>
							</c>
							<c ca="left">
								<p>TAACAGATTTAATAAACGTCCCCTTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig1943.5.1</p>
							</c>
							<c ca="left">
								<p>AGTACGATGAATCTGGTCCTTCAAT</p>
							</c>
							<c ca="left">
								<p>CCACAATACTGACATACTCTGGTCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig325.5.1</p>
							</c>
							<c ca="left">
								<p>GTGAAGTCAGTGAGTAAAGTCCATGT</p>
							</c>
							<c ca="left">
								<p>CTAGGATACCAGTGGGAGAGTGTAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig330.5.1</p>
							</c>
							<c ca="left">
								<p>GTCATCACCTCCACTACTTCACAAG</p>
							</c>
							<c ca="left">
								<p>TTTTGGCACTGTAAGATTCTATGAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig536.5.1</p>
							</c>
							<c ca="left">
								<p>CCTTAGGTAGAACAGACTGAAGCAG</p>
							</c>
							<c ca="left">
								<p>GAAACATGAAACTGGACTTGTTTTAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig917.5.1</p>
							</c>
							<c ca="left">
								<p>GGATGCAGATTCTTCCTATTTTACTC</p>
							</c>
							<c ca="left">
								<p>CTGGTCACTTTACTTGTTTTCAGTGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig926.5.1</p>
							</c>
							<c ca="left">
								<p>TTCATCACATTCTACTTCACAAATCA</p>
							</c>
							<c ca="left">
								<p>CTAGGCAAGCAAGCTTTCTAATAGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig93.5.1</p>
							</c>
							<c ca="left">
								<p>GAATAAAAGCAACAATTGCAGAGTTA</p>
							</c>
							<c ca="left">
								<p>CTCGACTCCTTCTACGATCTCTACTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Et.fasta.Contig990.5.1</p>
							</c>
							<c ca="left">
								<p>GTTTAGGTTAGTATGAAGGATCCCAA</p>
							</c>
							<c ca="left">
								<p>TGCCAGTACTCACCAATTAGTAAAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C12</p>
							</c>
							<c ca="left">
								<p>CCCAAATCCAGGAGTTCAAA</p>
							</c>
							<c ca="left">
								<p>TGGGACCTGGGGCTTCATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C13</p>
							</c>
							<c ca="left">
								<p>TTGCCCGAGAAAAGGAAGGACATA</p>
							</c>
							<c ca="left">
								<p>CAAGGGTGGGTGAGGGACATC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C5</p>
							</c>
							<c ca="left">
								<p>F-CACTGTTGACTTGGGTTATGTTATT</p>
							</c>
							<c ca="left">
								<p>CTGCTCCTAGGGTTTGTGAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C7</p>
							</c>
							<c ca="left">
								<p>CCCGTGTGGCTGGCTTGTGC</p>
							</c>
							<c ca="left">
								<p>TCGGCTACTTTGGTGTTTTTCTCCCTCAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C9</p>
							</c>
							<c ca="left">
								<p>TGGTCCGGCAACAGCATCAGA</p>
							</c>
							<c ca="left">
								<p>GCTTTTCGGTATTCAACGGCAGAGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-C9</p>
							</c>
							<c ca="left">
								<p>TGGTCCGGCAACAGCATCAGA</p>
							</c>
							<c ca="left">
								<p>GCTTTTCGGTATTCAACGGCAGAGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D5</p>
							</c>
							<c ca="left">
								<p>AGACCCTTGCTGTGTAACTGCT</p>
							</c>
							<c ca="left">
								<p>GACTGGGACTGACTTCTATGACG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D6</p>
							</c>
							<c ca="left">
								<p>CAGCGTGCCCACCCGATAGAA</p>
							</c>
							<c ca="left">
								<p>TCCCAAAAAGTAAAATGTGCAAAGAAAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-D7</p>
							</c>
							<c ca="left">
								<p>CAGCGGTGGAAATGACAAACAGG</p>
							</c>
							<c ca="left">
								<p>CCAAGACGACGAGGAACGGTATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-E12</p>
							</c>
							<c ca="left">
								<p>CAACCATGAGAGGAGGCCAGAGAAC</p>
							</c>
							<c ca="left">
								<p>AAAACAGCACTACCTACAAAACCCTATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-F1</p>
							</c>
							<c ca="left">
								<p>TTAGTTTGGGTGCAGACAGGA</p>
							</c>
							<c ca="left">
								<p>GGTGCTCAACAACAAATCAACT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-F20</p>
							</c>
							<c ca="left">
								<p>TCCCCAACAACTCCAGCAGAT</p>
							</c>
							<c ca="left">
								<p>GGAAACCACCTAGACGAAAAATG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I18</p>
							</c>
							<c ca="left">
								<p>CATGTTTGTGGGTGTGGTGAA</p>
							</c>
							<c ca="left">
								<p>AAAAGCGGCATCTGGTAAGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I19</p>
							</c>
							<c ca="left">
								<p>ACCCAGACCTGTCCACCTCA</p>
							</c>
							<c ca="left">
								<p>GAACAGCTCTCCAATCCACAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I21</p>
							</c>
							<c ca="left">
								<p>CCAAGCGAAGGAGGCGTGTG</p>
							</c>
							<c ca="left">
								<p>CATGTGGCTCTTTGTTTCTGGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I5</p>
							</c>
							<c ca="left">
								<p>TAATCGTGTTTGGTGGCATCCTTGAGTC</p>
							</c>
							<c ca="left">
								<p>AGCAGCAGTTCCATTTTCCCACACCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-I8</p>
							</c>
							<c ca="left">
								<p>ACCTGCAGTGGGCTAAGACC</p>
							</c>
							<c ca="left">
								<p>ATGGAAATAATAAAATAAAATGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J10</p>
							</c>
							<c ca="left">
								<p>CGTTCGCTTTGCCTGCCACA</p>
							</c>
							<c ca="left">
								<p>GGCTCTTCCCCGGTCGTCCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J17</p>
							</c>
							<c ca="left">
								<p>AGCGCCTTCTACACGGACAC</p>
							</c>
							<c ca="left">
								<p>TATGCCCCAATTACTCTTCTGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J2</p>
							</c>
							<c ca="left">
								<p>TACAGTAACTATGCCAAGATGAAATG</p>
							</c>
							<c ca="left">
								<p>CAATATGGATAATGGCTGTAGACC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J20</p>
							</c>
							<c ca="left">
								<p>ATCCTCCAAGCTCACTACAACA</p>
							</c>
							<c ca="left">
								<p>CCAGCCCCTTCCCAAACAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-J9</p>
							</c>
							<c ca="left">
								<p>CTGTCATTGCCTGCATCGGGGAGAAG</p>
							</c>
							<c ca="left">
								<p>TGTTGAGGGGAAGCAGTTTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-K2</p>
							</c>
							<c ca="left">
								<p>GCTTTCGCCTTTGACACCTC</p>
							</c>
							<c ca="left">
								<p>GGCCGGACCATTGCTGAAGAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L11</p>
							</c>
							<c ca="left">
								<p>AAAGTGACCATCCAGTGCCCAAACCT</p>
							</c>
							<c ca="left">
								<p>CCGGCCGAAACTGACGAGATACATTAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L13</p>
							</c>
							<c ca="left">
								<p>TCAGCTGCACTAGGTTTGTC</p>
							</c>
							<c ca="left">
								<p>CATTTTGATTTGCTCCATAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L19</p>
							</c>
							<c ca="left">
								<p>GACAACCTTGAATCCTTTATG</p>
							</c>
							<c ca="left">
								<p>AGATGTTGGTTGGTGACTTAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L20</p>
							</c>
							<c ca="left">
								<p>TGGGCATAGATGGCAAGGAAAAA</p>
							</c>
							<c ca="left">
								<p>CCCCCAGCATCTCGCATACAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-L7</p>
							</c>
							<c ca="left">
								<p>GTGCTACAGGAAGGAATGGATG</p>
							</c>
							<c ca="left">
								<p>TAGCACAGGAACAGCCGACAATAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-M14</p>
							</c>
							<c ca="left">
								<p>CCGCTTGGACATGAGGAGAT</p>
							</c>
							<c ca="left">
								<p>TGGCAAAGAAACAGAACACAACTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-M19</p>
							</c>
							<c ca="left">
								<p>GAGAAGTAGTGTCCCGGCAGAAAC</p>
							</c>
							<c ca="left">
								<p>ATGGGTGAAAACTTAGGTGAAATG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-N9</p>
							</c>
							<c ca="left">
								<p>GCGGGGCAATACATGACGTTCCACAG</p>
							</c>
							<c ca="left">
								<p>GACCCCCATCTCCGTTTCCCATTCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O1</p>
							</c>
							<c ca="left">
								<p>GGGGTAGAGCACAGTCCAGTT</p>
							</c>
							<c ca="left">
								<p>TTGCAAGGCCGAAAAGGTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O12</p>
							</c>
							<c ca="left">
								<p>GGAATTCCGGGGCACTACT</p>
							</c>
							<c ca="left">
								<p>TCGCGAGGACGGGGAAGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G1-O24</p>
							</c>
							<c ca="left">
								<p>CGGCCTTCCTGCAGTACAACCATC</p>
							</c>
							<c ca="left">
								<p>TCGGCAACGTGAAGACCATA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-A11</p>
							</c>
							<c ca="left">
								<p>GCCCCTGGAAGCTGTTGTGA</p>
							</c>
							<c ca="left">
								<p>GGGGTCCATCCGAGTCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-A7</p>
							</c>
							<c ca="left">
								<p>TTACCCCACAGACAAAATCAACACC</p>
							</c>
							<c ca="left">
								<p>GGCGGCCCCTCATAGCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-B1</p>
							</c>
							<c ca="left">
								<p>GGGCCTAGTCCTGCTGGTC</p>
							</c>
							<c ca="left">
								<p>CAAAGAGTGCGGAGAAATGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-B8</p>
							</c>
							<c ca="left">
								<p>CAACATGCGACCACTATAGCCACTTCCT</p>
							</c>
							<c ca="left">
								<p>CGCCACCGCCACCACCACA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-C2</p>
							</c>
							<c ca="left">
								<p>TTTGCAGGAAGAGTCATAACACAG</p>
							</c>
							<c ca="left">
								<p>GTCAACAACACCCTTTTCCCTTCCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-D1</p>
							</c>
							<c ca="left">
								<p>GCAGGTCGGCAAGAAGCTAAAGAAGGAA</p>
							</c>
							<c ca="left">
								<p>AGGGTTGGTTTGAAAGGATGTGCTGGTAA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-E17</p>
							</c>
							<c ca="left">
								<p>GGAGCACCAAATTCAAGTCAG</p>
							</c>
							<c ca="left">
								<p>CGTCCCCGGTCAATCTCCAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-E19</p>
							</c>
							<c ca="left">
								<p>CCAGTTTGAGCCCCAGGAG</p>
							</c>
							<c ca="left">
								<p>TCGCGGCAGTCAAGAGGTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-F17</p>
							</c>
							<c ca="left">
								<p>TATCCTCTTATTGCTGCATTCTCCTCAC</p>
							</c>
							<c ca="left">
								<p>AGTACGGCCGTTCACCATCTCTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-F2</p>
							</c>
							<c ca="left">
								<p>CACACCACAGACGCATTGAC</p>
							</c>
							<c ca="left">
								<p>TCCCCAGCCTGTGTAGAAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G13</p>
							</c>
							<c ca="left">
								<p>GGGAGGGGAGAAGGCTACCA</p>
							</c>
							<c ca="left">
								<p>ATACACGGCTTCCATGCTTCTTCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G15</p>
							</c>
							<c ca="left">
								<p>CCACGGCCCCACATCCAGC</p>
							</c>
							<c ca="left">
								<p>TCCCGCAGAATTTCCGTATCCAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G21</p>
							</c>
							<c ca="left">
								<p>TCCAAGAGGGTGTGAGGTGAAC</p>
							</c>
							<c ca="left">
								<p>AAAGCCATGCGAAGCGGAAGAC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G23</p>
							</c>
							<c ca="left">
								<p>GGTTTGGTACTTCAGCGGATGT</p>
							</c>
							<c ca="left">
								<p>CCAAAGCCTGTACTATGCGAAAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G5</p>
							</c>
							<c ca="left">
								<p>CGGTCCCTACTGTGGTCTATGGTTTTCA</p>
							</c>
							<c ca="left">
								<p>GGCTCTGCATATCCTCGGTCACACTTCC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-G6</p>
							</c>
							<c ca="left">
								<p>CCCATGGCTGCAAGGATTACG</p>
							</c>
							<c ca="left">
								<p>CAGGGGTTGTTGGGAGGCAGTGT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-H18</p>
							</c>
							<c ca="left">
								<p>TTGTCAAATGGGCGAGTTCA</p>
							</c>
							<c ca="left">
								<p>TGTTTTGCACCCAGTTTTTG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-I18</p>
							</c>
							<c ca="left">
								<p>GATCTCCTCAGGTCTCTTTCA</p>
							</c>
							<c ca="left">
								<p>GATTATGGGCCGGTGTCTCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-I23</p>
							</c>
							<c ca="left">
								<p>TGACTTTCCCAATGTGAGCAGAC</p>
							</c>
							<c ca="left">
								<p>CAGAGGTGGTGTTACAGCAGCAGTTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-J12</p>
							</c>
							<c ca="left">
								<p>CCTCTTGTCCCAGTGCCAGTG</p>
							</c>
							<c ca="left">
								<p>TCCAGGGATCCGAAACAAAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-J21</p>
							</c>
							<c ca="left">
								<p>CCGCCTCAGCCTGTTTCTCTACTTTT</p>
							</c>
							<c ca="left">
								<p>CTTTGAATTTCTGCTTTTGGTGCTCTGC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-K12</p>
							</c>
							<c ca="left">
								<p>ACATTAGTCCTGGTTACGAGAGC</p>
							</c>
							<c ca="left">
								<p>AAAGGGCAGTCCAGCATTGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-K2</p>
							</c>
							<c ca="left">
								<p>CTGCCCAAGAAGACCGAGAGCCACAAG</p>
							</c>
							<c ca="left">
								<p>AGCGCCCCCTGCACCAAAATCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-L16</p>
							</c>
							<c ca="left">
								<p>CCAAGGGTAGGAGAACAAGACA</p>
							</c>
							<c ca="left">
								<p>ATGGCATGCTGGGAAATCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-L21</p>
							</c>
							<c ca="left">
								<p>GAATCTAGGTCCAAGCAGTCCCATCT</p>
							</c>
							<c ca="left">
								<p>GACCATCACACCACTACCCACACTCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-L3</p>
							</c>
							<c ca="left">
								<p>TGAAAGAGGCCAGAAACAAGTAG</p>
							</c>
							<c ca="left">
								<p>TTCCCAAGGTCTCCATAACAAT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-L4</p>
							</c>
							<c ca="left">
								<p>TGGCCAAGAAGATGAAACAGGAAGAGGAG</p>
							</c>
							<c ca="left">
								<p>TGGCAAAGGACACGACGCAGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-M14</p>
							</c>
							<c ca="left">
								<p>CGGCCTCCTCGACGCATACG</p>
							</c>
							<c ca="left">
								<p>CCAGGCCGGCCCATTGTTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-M24</p>
							</c>
							<c ca="left">
								<p>ACGGAGCACGGTCAGATTTCACG</p>
							</c>
							<c ca="left">
								<p>CCCGGCTGGCTCTTCTTGCTCTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-M3</p>
							</c>
							<c ca="left">
								<p>CGATCCGCATTGAACGAGT</p>
							</c>
							<c ca="left">
								<p>TGTGGCAGGAAGGAGAAGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G2-N2</p>
							</c>
							<c ca="left">
								<p>CGTGTTTTCCTCCTATGTCGACTTCTTTG</p>
							</c>
							<c ca="left">
								<p>ACGTGCTCTGCCTTTCTTGATCTTGTGTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>G3-D7</p>
							</c>
							<c ca="left">
								<p>AGGATTTCTTGGCCGGTGGAGTGG</p>
							</c>
							<c ca="left">
								<p>GAAGTTGAGGGCCTGGGTGGGGAAGTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>NT001D_E08.5.1</p>
							</c>
							<c ca="left">
								<p>AGAAGTTCCTAGATGAGTTGGAGGAG</p>
							</c>
							<c ca="left">
								<p>AATTAATTTCCTAAACCAGGTGACAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>NT010B_E09.5.1</p>
							</c>
							<c ca="left">
								<p>GAAGAGGTCCTAAAATATCAAGATGC</p>
							</c>
							<c ca="left">
								<p>ATGATAGACTTCGTCCTTGTCATAGA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>NT014D_E01.5.1</p>
							</c>
							<c ca="left">
								<p>AAAGAAGTCCCGCATCTAACCT</p>
							</c>
							<c ca="left">
								<p>ATTAAATATGAGAAGATGTGTGCAGG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p1_b8</p>
							</c>
							<c ca="left">
								<p>AGTCACTGTGTTACATTATCACCCAC</p>
							</c>
							<c ca="left">
								<p>ATAATTATACACTGCGGTCTGCATCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p1_c5</p>
							</c>
							<c ca="left">
								<p>AGTACCTGTTCGACAAGCACAC</p>
							</c>
							<c ca="left">
								<p>TGAGAACATAGACAAGTTAACATACACC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p1_d10</p>
							</c>
							<c ca="left">
								<p>GAGATAGAAAGGCTGCATAAAGAAAT</p>
							</c>
							<c ca="left">
								<p>TATGTTTCAACAATGTACAGGAAACC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p1_d4</p>
							</c>
							<c ca="left">
								<p>CACCAGAACAAGCTGTATTTTTATGT</p>
							</c>
							<c ca="left">
								<p>TGGTTTGCATCATATATTAAAGGGTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p1_g7</p>
							</c>
							<c ca="left">
								<p>GACTTCAAGCACATTGGGAAAC</p>
							</c>
							<c ca="left">
								<p>ATTGTAAACTTGATAGGCTGGTGAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p2_g6</p>
							</c>
							<c ca="left">
								<p>AGAATTCCCAATAGCACCTGAAAT</p>
							</c>
							<c ca="left">
								<p>CACTTGGTAAATACATACACACAGCA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p2_h2</p>
							</c>
							<c ca="left">
								<p>CTTTTTGGCCTGGTCTTTTTG</p>
							</c>
							<c ca="left">
								<p>AGATTCTTCAGACTCGTCCTTCTTT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p3_a5</p>
							</c>
							<c ca="left">
								<p>TTTACACAGAAACCTTGTTTATTTGGC</p>
							</c>
							<c ca="left">
								<p>TTTAAGGATGCTTAGAGGCAAAGTATT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p3_b1</p>
							</c>
							<c ca="left">
								<p>AGTCACTGTGTTACATTATCACCCAC</p>
							</c>
							<c ca="left">
								<p>TATACACTGCGGTCTGCATCTACT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p5_b3</p>
							</c>
							<c ca="left">
								<p>AATGGGATGAAGAGCGAGAAT</p>
							</c>
							<c ca="left">
								<p>CTGCCCCATTGACATTTACCTA</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p5_h3</p>
							</c>
							<c ca="left">
								<p>CCTTCAGACGAAAACAGCACTAAG</p>
							</c>
							<c ca="left">
								<p>TACAGTGTATGAGAGCCCAATATTTC</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V2_p6_a4</p>
							</c>
							<c ca="left">
								<p>AGAAATACATCAAATATCGGGTGG</p>
							</c>
							<c ca="left">
								<p>AAAAAGGACAATGTTCAGCTCTCT</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V3_p1_a21</p>
							</c>
							<c ca="left">
								<p>ACCAAGTTCTTGGAAAGTGGTG</p>
							</c>
							<c ca="left">
								<p>CTTAGTGTCTCCTGGGTTTGAATAG</p>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>V3_p1_b13</p>
							</c>
							<c ca="left">
								<p>GTCTTGGTACTCAATGAAGGAGATG</p>
							</c>
							<c ca="left">
								<p>TCAATCTGATGAAGAGTTTACATGTCT</p>
							</c>
						</r>
					</tblbdy>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Comparative gene mapping</p>
				</st>
				<p>Salamanders occupy a pivotal phylogenetic position for reconstructing the ancestral tetrapod genome structure and for providing perspective on the extremely derived anuran <it>Xenopus </it>(37) that is currently providing the bulk of amphibian genome information. Here we show the utility of ambystomatid ESTs for identifying chromosomal regions that are conserved between salamanders and other vertebrates. A region of conserved synteny that corresponds to human chromosome (<it>Hsa</it>) 17q has been identified in several non-mammalian taxa including reptiles (38) and fishes (39). In a previous study Voss et al. (40) identified a region of conserved synteny between <it>Ambystoma </it>and <it>Hsa </it>17q that included collagen type 1 alpha 1 (<it>Col1a1</it>), thyroid hormone receptor alpha (<it>Thra</it>), homeo box b13 (<it>Hoxb13)</it>, and distal-less 3 (<it>Dlx3) </it>(Figure <figr fid="F4">4</figr>). To evaluate both the technical feasibility of mapping ESTs and the likelihood that presumptive orthologues map to the same synteny group, we searched our assemblies for presumptive <it>Hsa </it>17 orthologues and then developed a subset of these loci for genetic linkage mapping. Using a joint assembly of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs, 97 Hsa 17 presumptive orthologues were identified. We chose 15 genes from this list and designed PCR primers to amplify a short DNA fragment containing 1 or more presumptive SNPs that were identified in the joint assembly (Table <tblr tid="T9">9</tblr>). All but two of these genes were mapped, indicating a high probability of mapping success using markers developed from the joint assembly of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs. All 6 ESTs that exhibited 'best hits' to loci within the previously defined human-<it>Ambystoma </it>synteny group did map to this region (<it>Hspc009</it>, <it>Sui1</it>, <it>Krt17</it>, <it>Krt24</it>, <it>Flj13855, </it>and <it>Rpl19</it>). Our results show that BLAST-based definitions of orthology are informative between salamanders and human. All other presumptive <it>Hsa </it>17 loci mapped to <it>Ambystoma </it>chromosomal regions outside of the previously defined synteny group. It is interesting to note that two of these loci mapped to the same ambystomatid linkage group (<it>Cgi-125</it>, <it>Flj20345</it>), but in human the presumptive orthologues are 50 Mb apart and distantly flank the syntenic loci in Figure <figr fid="F4">4</figr>. Assuming orthology has been assigned correctly for these loci, this suggests a dynamic history for some <it>Hsa </it>17 orthologues during vertebrate evolution.</p>
				<fig id="F4">
					<title>
						<p>Figure 4</p>
					</title>
					<caption>
						<p>Comparison of gene order between <it>Ambystoma </it>linkage group 1 and an 11 Mb region of Hsa17 (37.7 Mb to 48.7 Mb)</p>
					</caption>
					<text>
						<p><b>Comparison of gene order between <it>Ambystoma </it>linkage group 1 and an 11 Mb region of Hsa17 (37.7 Mb to 48.7 Mb)</b>. Lines connect the positions of putatively orthologous genes.</p>
					</text>
					<graphic file="1471-2164-5-54-4"/>
				</fig>
				<tbl id="T9">
					<title>
						<p>Table 9</p>
					</title>
					<caption>
						<p>Presumptive human chromosome 17 loci that were mapped in <it>Ambystoma</it></p>
					</caption>
					<tblbdy cols="7">
						<r>
							<c ca="left">
								<p>
									<b>Marker ID</b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Primers<sup>a</sup></b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Diagnosis<sup>b</sup></b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>LG<sup>c</sup></b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>Symbol<sup>d</sup></b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>RefSeq ID<sup>e</sup></b>
								</p>
							</c>
							<c ca="center">
								<p>
									<b>E-value<sup>f</sup></b>
								</p>
							</c>
						</r>
						<r>
							<c cspan="7">
								<hr/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_6_E/F_6</p>
							</c>
							<c ca="left">
								<p>F-GAAAACCTGCTCAGCATTAGTGT</p>
							</c>
							<c ca="center">
								<p>ASA</p>
							</c>
							<c ca="center">
								<p>ul</p>
							</c>
							<c ca="center">
								<p>PFN1</p>
							</c>
							<c ca="center">
								<p>NP_005013</p>
							</c>
							<c ca="center">
								<p>E<sup>-34</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-TCTATTACCATAGCATTAATTGGCAG</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_5_G/H_5</p>
							</c>
							<c ca="left">
								<p>F-CTATTTCATCTGAGTACCGTTGAATG</p>
							</c>
							<c ca="center">
								<p>PE (A)</p>
							</c>
							<c ca="center">
								<p>23</p>
							</c>
							<c ca="center">
								<p>CGI-125</p>
							</c>
							<c ca="center">
								<p>NP_057144</p>
							</c>
							<c ca="center">
								<p>E<sup>-56</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-TAATGTAGAACTAAATGGCATCCTTC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-CCATGGTGCAGGAAGAGAGCCTATAT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_0.4_A/B_1</p>
							</c>
							<c ca="left">
								<p>F-GTCTCATTATCCGCAAACCTGT</p>
							</c>
							<c ca="center">
								<p>SP</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>RPL19</p>
							</c>
							<c ca="center">
								<p>NP_000972</p>
							</c>
							<c ca="center">
								<p>E<sup>-67</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-ATTCTCATCCTCCTCATCCACGAC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_4_B_7/8</p>
							</c>
							<c ca="left">
								<p>F-CCTAGAACATTACCAAAACAGACTCA</p>
							</c>
							<c ca="center">
								<p>RD (Dpn II)</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>KRT10</p>
							</c>
							<c ca="center">
								<p>NP_061889</p>
							</c>
							<c ca="center">
								<p>E<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-AATGAAGAAGTATTGCATGTGAGAAC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_4_B_9/10</p>
							</c>
							<c ca="left">
								<p>F-GAACTTGTTGGCAGGTTTCTCTT</p>
							</c>
							<c ca="center">
								<p>RD (AciI)</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>KRT17</p>
							</c>
							<c ca="center">
								<p>NP_000413</p>
							</c>
							<c ca="center">
								<p>E<sup>-146</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-CTAGTGATAGGTTGGACATACCAGAG</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_10_C/D_4</p>
							</c>
							<c ca="left">
								<p>F-CTCCACTATTTAAAGGACATGCTACA</p>
							</c>
							<c ca="center">
								<p>PE (A)</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>SUI1</p>
							</c>
							<c ca="center">
								<p>NP_005792</p>
							</c>
							<c ca="center">
								<p>E<sup>-48</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-TTAATATAGCACAACATTGCCTCATT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-TGCTACATTAATGTAATAAACGGCATCATC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_6_E/F_11</p>
							</c>
							<c ca="left">
								<p>F-AAGAGAAGTTCCTAGATGAGTTGGAG</p>
							</c>
							<c ca="center">
								<p>PE (A)</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>HSPC009</p>
							</c>
							<c ca="center">
								<p>NP_054738</p>
							</c>
							<c ca="center">
								<p>E<sup>-26</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-TGAAGAGAGAACTCAAAGTGTCTGAT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-TCATGTTTTGCTCTGCTGTGCAGT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_9_A/B_10</p>
							</c>
							<c ca="left">
								<p>F-TGATAGTTTCTGGATTAAGACGAGTG</p>
							</c>
							<c ca="center">
								<p>PE (T)</p>
							</c>
							<c ca="center">
								<p>1</p>
							</c>
							<c ca="center">
								<p>FLJ13855</p>
							</c>
							<c ca="center">
								<p>NP_075567</p>
							</c>
							<c ca="center">
								<p>E<sup>-15</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-CTTAGAGCCATTGTTACAAGATGTTC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-GTGATCTAGTGGGATCAAACCCTAAAGACC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_10_C/D_9</p>
							</c>
							<c ca="left">
								<p>F-AAAGTGCCAAGAAGGAGATTAACTT</p>
							</c>
							<c ca="center">
								<p>PE (T)</p>
							</c>
							<c ca="center">
								<p>9</p>
							</c>
							<c ca="center">
								<p>NME1</p>
							</c>
							<c ca="center">
								<p>NP_000260</p>
							</c>
							<c ca="center">
								<p>E<sup>-71</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-GAGCTCAGAAAACAAGGCAGTAAC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-AAATGGATCTACGAGTAGACCTTGACCC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_9_C/D_9</p>
							</c>
							<c ca="left">
								<p>F-GAGTCTCCTTTAGGATTGACGTATCT</p>
							</c>
							<c ca="center">
								<p>PE (T)</p>
							</c>
							<c ca="center">
								<p>23</p>
							</c>
							<c ca="center">
								<p>FLJ20345</p>
							</c>
							<c ca="center">
								<p>NP_060247</p>
							</c>
							<c ca="center">
								<p>E<sup>-17</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-GCTATGTGAGCAGAGATAAAAGTCAG</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-GTTACAGCATCAGTGGGATGTGGTATGT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_8_C/D_9</p>
							</c>
							<c ca="left">
								<p>F-AGGATACCAACCTCTGTGCTATACAT</p>
							</c>
							<c ca="center">
								<p>PE (C)</p>
							</c>
							<c ca="center">
								<p>15</p>
							</c>
							<c ca="center">
								<p>H3F3B</p>
							</c>
							<c ca="center">
								<p>NP_005315</p>
							</c>
							<c ca="center">
								<p>E<sup>-66</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-TAAATGTATTTACAAACCGAAAGCAA</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-CGTGGCGAGCGTGCCTAGT</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_9_C/D_4</p>
							</c>
							<c ca="left">
								<p>F-GTGGTTATTTGTAACATTTCGTTGAC</p>
							</c>
							<c ca="center">
								<p>PE (A)</p>
							</c>
							<c ca="center">
								<p>8</p>
							</c>
							<c ca="center">
								<p>SFRS2</p>
							</c>
							<c ca="center">
								<p>NP_003007</p>
							</c>
							<c ca="center">
								<p>E<sup>-40</sup></p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-AATTACATTTGGGCTTCTCAATTTAC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-TTTTTAAACGCGTAAAAATGTTAACAGA</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c ca="left">
								<p>Pl_6_C/D_5</p>
							</c>
							<c ca="left">
								<p>F-CCGTAAATGTTTCTAAATGACAGTTG</p>
							</c>
							<c ca="center">
								<p>PE (G)</p>
							</c>
							<c ca="center">
								<p>2</p>
							</c>
							<c ca="center">
								<p>ACTG1</p>
							</c>
							<c ca="center">
								<p>NP_001605</p>
							</c>
							<c ca="center">
								<p>0</p>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>R-GGAAAGAAAGTACAATCAAGTCCTTC</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
						<r>
							<c>
								<p/>
							</c>
							<c ca="left">
								<p>E-GATTGAAAACTGGAACCGAAAGAAGATAAA</p>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
							<c>
								<p/>
							</c>
						</r>
					</tblbdy>
					<tblfn>
						<p><sup>a</sup>Sequences are 5' amplification primers, 3' amplification primers, or primer extension probes, and are preceded by F-, R-, and E- respectively. <sup>b</sup>Genotyping methods are abbreviated: allele specific amplification (ASA), size polymorphism (SP), restriction digestion (RD), primer extension (PE). Diagnostic restriction enzymes and diagnostic extension bases are provided in parentheses. <sup>c</sup>Ambystoma linkage group ID. "ul" designates markers that are unlinked. <sup>d</sup>Official gene symbols as defined by the Human Genome Organization Gene Nomenclature Committee <url>http://www.gene.ucl.ac.uk/nomenclature/</url>. <sup>e</sup>Best BLASTX hit (highest e-value) from the human RefSeq database using the contig from which each marker was designed as a query sequence. <sup>f</sup>Highest E-value statistic obtained by searching contigs, from which EST markers were designed, against the human RefSeq database.</p>
					</tblfn>
				</tbl>
			</sec>
			<sec>
				<st>
					<p>Future directions</p>
				</st>
				<p>Ambystomatid salamanders are classic model organisms that continue to inform biological research in a variety of areas. Their future importance in regenerative biology and metamorphosis will almost certainly escalate as genome resources and other molecular and cellular approaches become widely available. Among the genomic resources currently under development (see <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>) are a comparative genome map, which will allow mapping of candidate genes, QTL, and comparative anchors for cross-referencing the salamander genome to fully sequenced vertebrate models. In closing, we reiterate a second benefit to resource development in <it>Ambystoma</it>. Genome resources in <it>Ambystoma </it>can be extended to multiple, closely related species to explore the molecular basis of natural, phenotypic variation. Such extensions can better inform our understanding of ambystomatid biodiversity in nature and draw attention to the need for conserving such naturalistic systems. Several paedomorphic species, including <it>A. mexicanum</it>, are on the brink of extinction. We can think of no better investment than one that simultaneously enhances research in all areas of biology and draws attention to the conservation needs of model organisms in their natural habitats.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Conclusions</p>
			</st>
			<p>Approximately 40,000 cDNA sequences were isolated from a variety of tissues to develop expressed sequence tags for two model salamander species (<it>A. mexicanum </it>and <it>A. t. tigrinum</it>). An approximately equivalent number of contigs were identified for each species, with 21,091 unique contigs identified overall. The strategy to sequence cDNAs from a diverse collection of tissues from normalized and non-normalized libraries yielded different sets of highly redundant contigs. Only 25% and 28% of the <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs, respectively, were identified in common. To demonstrate the utility of these EST resources, we searched databases to identify new probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human/<it>Ambystoma </it>synteny group with marker loci, and extended PCR primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>orthologues to a related tiger salamander species. Over 100 new probes were identified for regeneration research using informatic approaches. With respect to comparative mapping, 13 of 15 EST markers were mapped successfully, and 6 EST markers were mapped to a previously defined synteny group in <it>Ambystoma</it>. These results indicate a high probability of mapping success using EST markers developed from the joint assembly of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>contigs. Finally, we found that primer sets designed for <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>EST orthologues can be used to amplify the corresponding sequence in a related <it>A. tigrinum </it>complex species. Overall, the EST resources reported here will enable a diversity of new research areas using ambystomatid salamanders.</p>
		</sec>
		<sec>
			<st>
				<p>Methods</p>
			</st>
			<sec>
				<st>
					<p>cDNA library construction</p>
				</st>
				<p>Ten cDNA libraries were constructed for the project using various larval tissues of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>(Table <tblr tid="T1">1</tblr>). Larval <it>A. mexicanum </it>were obtained from adult animals whose ancestry traces back to the Axolotl Colony <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. Larval <it>A. t. tigrinum </it>were obtained from Charles Sullivan Corp. The GARD and MATH A. mexicanum limb regeneration libraries were constructed using regenerating forelimb mesenchyme. Total RNAs were collected from anterior and posterior limbs amputated at the mid-stylopod level on 15 cm animals, and from the resulting regenerates at 12 h, 2 days, 5 days and early bud stages. One hundred &#956;g fractions of each were pooled together and polyA-selected to yield 5 &#956;g that was utilized for directional library construction (Lambda Zap, Stratagene). The V1 (<it>A. mex</it>), V2 (<it>A. tig</it>), V4-5 (<it>A. tig</it>), and V6-7 (<it>A. mex</it>) libraries were made from an assortment of larval tissues (see Table <tblr tid="T1">1</tblr>) using the SMART cDNA cloning kits (Clontech). Total RNAs were isolated and reverse transcribed to yield cDNAs that were amplified by long distance PCR and subsequently cloned into pTriplEX. The V3 and AG libraries were constructed by commercial companies (BioS&amp;T and Agencourt, respectively).</p>
			</sec>
			<sec>
				<st>
					<p>cDNA template preparation and sequencing</p>
				</st>
				<p>cDNA inserts were mass excised as phagemids, picked into microtitre plates, grown overnight in LB broth, and then diluted (1/20) to spike PCR reactions: (94&#176;C for 2 min; then 30 cycles at 94&#176;C for 45 sec, 58&#176;C for 45&#176;sec, and 72&#176;C for 7 min). All successful amplifications with inserts larger than ~500 bp were sequenced (ABI Big Dye or Amersham Dye terminator chemistry and 5' universal primer). Sequencing and clean-up reactions was carried out according to manufacturers' protocols. ESTs were deposited into NCBI database under accession numbers BI817205-BI818091 and CN033008-CN045937 and CN045944-CN069430.</p>
			</sec>
			<sec>
				<st>
					<p>EST sequence processing and assembly</p>
				</st>
				<p>The PHRED base-calling program <abbrgrp><abbr bid="B42">42</abbr></abbrgrp> was used to generate sequence and quality scores from trace files. PHRED files were then quality clipped and vector/contaminant screened. An in-house program called QUALSCREEN was used to quality clip the ends of sequence traces. Starting at the ends of sequence traces, this program uses a 20 bp sliding window to identify a continuous run of bases that has an average PHRED quality score of 15. Mitochondrial DNA sequences were identified by searching all ESTs against the complete mtDNA genome sequence of <it>A. mexicanum </it>(AJ584639). Finally, all sequences less than 100 bp were removed. The average length of the resulting ESTs was 629 bp. The resulting high quality ESTs were clustered initially using PaCE <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> on the U.K. HP Superdome computer. Multi-sequence clusters were used as input sequence sets for assembly using CAP3 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> with an 85% sequence similarity threshold. Clusters comprising single ESTs were assembled again using CAP3 with an 80% sequence similarity threshold to identify multi-EST contigs that were missed during the initial analysis. This procedure identified 550 additional contigs comprising 1150 ESTs.</p>
			</sec>
			<sec>
				<st>
					<p>Functional annotation</p>
				</st>
				<p>All contigs and singletons were searched against the human RefSeq database (Oct. 2003 release) using BLASTX. The subset of sequences that yielded no BLAST hit was searched against the non-redundant protein sequence database (Feb. 2004) using BLASTX. The remaining subset of sequences that yielded no BLAST hit was searched against <it>Xenopus laevis </it>and <it>X. tropicalis </it>UNIGENE ESTs (Mar. 2004) using TBLASTX. Zebrafish ESTs were downloaded from UNIGENE ESTs (May 2004). BLAST searches were done with an E-value threshold of E &lt;10-7 unless specified.</p>
			</sec>
			<sec>
				<st>
					<p>Sequence comparison of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies</p>
				</st>
				<p>All low quality base calls within contigs were masked using a PHRED base quality threshold of 16. To identify polymorphisms for linkage mapping, contigs from <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies were joined into a single assembly using CAP3 and the following criteria: an assembly threshold of 12 bp to identify initial matches, a minimum 100 bp match length, and 85% sequence identity. To identify putatively orthologous genes from <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assemblies, and generate an estimate of gene sequence divergence, assemblies were compared using BLASTN with a threshold of <it>E </it>&lt;10<sup>-20</sup>. Following BLAST, alignments were filtered to obtain reciprocal best BLAST hits.</p>
			</sec>
			<sec>
				<st>
					<p>Extending <it>A. mexicanum </it>/ <it>A. t. tigrinum </it>sequence information to <it>A. ordinarium</it></p>
				</st>
				<p>Polymorphic DNA marker loci were identified by locating single nucleotide polymorphisms (SNPs) in the joint <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assembly. Polymerase chain reaction (PCR) primers were designed using <it>Primer 3 </it><abbrgrp><abbr bid="B45">45</abbr></abbrgrp> to amplify 100 &#8211; 500 bp SNP-containing fragments from 123 different protein-coding loci (Table <tblr tid="T8">8</tblr>). DNA was isolated from salamander tail clips using SDS, RNAse and proteinase K treatment, followed by phenol-chloroform extraction. Fragments were amplified using 150 ng DNA, 75 ng each primer, 1.5 mM MgCl<sub>2</sub>, 0.25 U Taq, and a 3-step profile (94&#176;C for 4 min; 33 cycles of 94&#176;C for 45 s, 60&#176;C for 45 s, 72&#176;C for 30 s; and 72&#176;C for 7 min). DNA fragments were purified and sequenced using ABI Big Dye or Amersham Dye terminator chemistry. Single nucleotide polymorphisms were identified by eye from sequence alignments.</p>
			</sec>
			<sec>
				<st>
					<p>Linkage mapping of human chromosome 17 orthologous genes</p>
				</st>
				<p>Putative salamander orthologues of genes on human chromosome 17 (<it>Hsa </it>17) were identified by comparing the joint <it>A. mexicanum </it>and <it>A. t. tigrinum </it>assembly to sequences from the human RefSeq (NCBI) protein database, using BLASTX at threshold <it>E&lt;</it>10<sup>-7</sup>. Linkage distance and arrangement among markers was estimated using MapManager QTXb19 software <abbrgrp><abbr bid="B46">46</abbr></abbrgrp> and the Kosambi mapping function at a threshold of p = 0.001. All markers were mapped using DNA from a previously described meiotic mapping panel <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>. All PCR primers and primer extension probes were designed using <it>Primer 3 </it><abbrgrp><abbr bid="B45">45</abbr></abbrgrp> and <it>Array Designer2 </it>(Premier Biosoft) software. Species-specific polymorphisms were assayed by allele specific amplification, restriction digestion, or primer extension, using the reagent and PCR conditions described above. Primer extension markers were genotyped using the AcycloPrime-FP SNP detection assay (Perkin Elmer). See Table <tblr tid="T9">9</tblr> for amplification and extension primer sequences, and information about genotyping methodology.</p>
			</sec>
		</sec>
		<sec>
			<st>
				<p>Author's contributions</p>
			</st>
			<p>SP and DK: bioinformatics; JW: clone management and sequencing in support of <it>A. mexicanum </it>and <it>A. t. tigrinum </it>ESTs; JS: comparative mapping and polymorphism estimation; DW: extending ESTs to <it>A. ordinarium</it>; JM, KK, AS, NM: PCR and gel electrophoresis; BH and ET: cDNA library construction and sequencing for spinal cord regeneration ESTs; MR, SB, DG: cDNA library construction and clone management for limb regeneration ESTs; DP and SV conceived of the project and participated in its design and coordination. All authors read and approved the final manuscript.</p>
		</sec>
	</bdy>
	<bm>
		<ack>
			<sec>
				<st>
					<p>Acknowledgements</p>
				</st>
				<p>We thank the Axolotl Colony. We thank Greg Chinchar and Betty Davidson for providing RNA to make cDNA libraries V3 and V4. We acknowledge the support of the National Science Foundation, the National Center for Research Resources at the National Institutes of Health, the Kentucky Spinal Cord and Head Injury Research Trust, and the NSF EPSCOR initiative in Functional Genomics at University of Kentucky.</p>
			</sec>
		</ack>
		<refgrp>
			<bibl id="B1">
				<title>
					<p>How did urodele embryos come into prominence as a model system</p>
				</title>
				<aug>
					<au>
						<snm>Beetschen</snm>
						<fnm>J-C</fnm>
					</au>
				</aug>
				<source>Int J Dev Biol</source>
				<pubdate>1996</pubdate>
				<volume>40</volume>
				<fpage>629</fpage>
				<lpage>636</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">8877434</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B2">
				<title>
					<p>The molecular basis of amphibian limb regeneration: integrating the old with the new</p>
				</title>
				<aug>
					<au>
						<snm>Gardiner</snm>
						<fnm>DM</fnm>
					</au>
					<au>
						<snm>Endo</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Bryant</snm>
						<fnm>SV</fnm>
					</au>
				</aug>
				<source>Semin Cell Dev Biol</source>
				<pubdate>2002</pubdate>
				<volume>13</volume>
				<fpage>345</fpage>
				<lpage>352</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/S1084952102000903</pubid>
						<pubid idtype="pmpid" link="fulltext">12324216</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B3">
				<title>
					<p>Ectoderm to mesoderm lineage switching during axolotl tail regeneration</p>
				</title>
				<aug>
					<au>
						<snm>Echeverri</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Tanaka</snm>
						<fnm>EM</fnm>
					</au>
				</aug>
				<source>Science</source>
				<pubdate>2002</pubdate>
				<volume>298</volume>
				<fpage>1933</fpage>
				<lpage>1936</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1126/science.1077804</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B4">
				<title>
					<p>Conservation of fibroblast growth factor function in lens regeneration</p>
				</title>
				<aug>
					<au>
						<snm>Del Rio-Tsonis</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Jung</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Chiu</snm>
						<fnm>IM</fnm>
					</au>
					<au>
						<snm>Tsonis</snm>
						<fnm>PA</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1997</pubdate>
				<volume>94</volume>
				<fpage>13701</fpage>
				<lpage>13706</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1073/pnas.94.25.13701</pubid>
						<pubid idtype="pmpid" link="fulltext">9391089</pubid>
						<pubid idtype="pmcid">28369</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B5">
				<title>
					<p>Neural cell differentiation from retinal pigment epithelial cells of the newt: an organ culture model for the urodele retinal regeneration</p>
				</title>
				<aug>
					<au>
						<snm>Ikegami</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Mitsuda</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Araki</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>J Neurobiol</source>
				<pubdate>2002</pubdate>
				<volume>50</volume>
				<fpage>209</fpage>
				<lpage>20</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/neu.10031</pubid>
						<pubid idtype="pmpid" link="fulltext">11810636</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B6">
				<title>
					<p>Urodele spinal cord regeneration and related processes</p>
				</title>
				<aug>
					<au>
						<snm>Chernoff</snm>
						<fnm>EAG</fnm>
					</au>
					<au>
						<snm>Stocum</snm>
						<fnm>DL</fnm>
					</au>
					<au>
						<snm>Nye</snm>
						<fnm>HLD</fnm>
					</au>
					<au>
						<snm>Cameron</snm>
						<fnm>JA</fnm>
					</au>
				</aug>
				<source>Dev Dyn</source>
				<pubdate>2003</pubdate>
				<volume>226</volume>
				<fpage>295</fpage>
				<lpage>307</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/dvdy.10240</pubid>
						<pubid idtype="pmpid" link="fulltext">12557207</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B7">
				<title>
					<p>Re-examining jaw regeneration in urodeles: what have we learnt?</p>
				</title>
				<aug>
					<au>
						<snm>Ferretti</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Int J Dev Biol</source>
				<pubdate>1996</pubdate>
				<volume>40</volume>
				<fpage>807</fpage>
				<lpage>811</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">8877454</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B8">
				<title>
					<p>Goalpha labels ON bipolar cells in the tiger salamander retina</p>
				</title>
				<aug>
					<au>
						<snm>Zhang</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Wu</snm>
						<fnm>SM</fnm>
					</au>
				</aug>
				<source>J Comp Neurol</source>
				<pubdate>2003</pubdate>
				<volume>461</volume>
				<fpage>276</fpage>
				<lpage>289</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1002/cne.10704</pubid>
						<pubid idtype="pmpid" link="fulltext">12724843</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B9">
				<title>
					<p>Cranial neural crest emergence and migration in the Mexican axolotl (<it>Ambystoma mexicanum</it>)</p>
				</title>
				<aug>
					<au>
						<snm>Falck</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Hanken</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Olsson</snm>
						<fnm>L</fnm>
					</au>
				</aug>
				<source>Zoology-Jena</source>
				<pubdate>2002</pubdate>
				<volume>105</volume>
				<fpage>195</fpage>
				<lpage>202</lpage>
			</bibl>
			<bibl id="B10">
				<title>
					<p>A point mutation in bioactive RNA results in the failure of mutant heart correction in mexican axolotls</p>
				</title>
				<aug>
					<au>
						<snm>Zhang</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Dube</snm>
						<fnm>DK</fnm>
					</au>
					<au>
						<snm>Huang</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Zajdel</snm>
						<fnm>RW</fnm>
					</au>
					<au>
						<snm>Bhatia</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Foster</snm>
						<fnm>D</fnm>
					</au>
					<au>
						<snm>Lemanski</snm>
						<fnm>SL</fnm>
					</au>
					<au>
						<snm>Lemanski</snm>
						<fnm>LF</fnm>
					</au>
				</aug>
				<source>Anat Embryol</source>
				<pubdate>2003</pubdate>
				<volume>206</volume>
				<fpage>495</fpage>
				<lpage>506</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">12721841</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B11">
				<title>
					<p>On the scents of smell in the salamander</p>
				</title>
				<aug>
					<au>
						<snm>Kauer</snm>
						<fnm>JS</fnm>
					</au>
				</aug>
				<source>Nature</source>
				<pubdate>2002</pubdate>
				<volume>417</volume>
				<fpage>336</fpage>
				<lpage>342</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/417336a</pubid>
						<pubid idtype="pmpid" link="fulltext">12015614</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B12">
				<title>
					<p>Candidate gene analysis of metamorphic timing in ambystomatid salamanders</p>
				</title>
				<aug>
					<au>
						<snm>Voss</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Prudic</snm>
						<fnm>KL</fnm>
					</au>
					<au>
						<snm>Oliver</snm>
						<fnm>JC</fnm>
					</au>
					<au>
						<snm>Shaffer</snm>
						<fnm>HB</fnm>
					</au>
				</aug>
				<source>Mol Ecol</source>
				<pubdate>2003</pubdate>
				<volume>12</volume>
				<fpage>1217</fpage>
				<lpage>1223</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">12694285</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B13">
				<title>
					<p>Hybridization between a rare, native tiger salamander (<it>Ambystoma californiense</it></p>
				</title>
				<aug>
					<au>
						<snm>Riley</snm>
						<fnm>SPD</fnm>
					</au>
					<au>
						<snm>Shaffer</snm>
						<fnm>HB</fnm>
					</au>
					<au>
						<snm>Voss</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Fitzpatrick</snm>
						<fnm>BM</fnm>
					</au>
				</aug>
				<source>Ecol Appl</source>
				<pubdate>2003</pubdate>
				<volume>13</volume>
				<fpage>1263</fpage>
				<lpage>1275</lpage>
			</bibl>
			<bibl id="B14">
				<title>
					<p>Setting the stage: Developmental biology in pre-college classrooms</p>
				</title>
				<aug>
					<au>
						<snm>Borland</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Crawford</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Brand</snm>
						<fnm>V</fnm>
					</au>
				</aug>
				<source>Int J Dev Biol</source>
				<pubdate>2003</pubdate>
				<volume>47</volume>
				<fpage>85</fpage>
				<lpage>91</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">12705654</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B15">
				<title>
					<p>Genomic sequence of a ranavirus (family Iridoviridae) associated with salamander mortalities in North America</p>
				</title>
				<aug>
					<au>
						<snm>Jancovich</snm>
						<fnm>JK</fnm>
					</au>
					<au>
						<snm>Mao</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Chinchar</snm>
						<fnm>VG</fnm>
					</au>
					<au>
						<snm>Wyatt</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Case</snm>
						<fnm>ST</fnm>
					</au>
					<au>
						<snm>Kumar</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Valente</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Subrmanian</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Davidson</snm>
						<fnm>EW</fnm>
					</au>
					<au>
						<snm>Collins</snm>
						<fnm>JP</fnm>
					</au>
					<au>
						<snm>Jacobs</snm>
						<fnm>JB</fnm>
					</au>
				</aug>
				<source>Virology</source>
				<pubdate>2003</pubdate>
				<volume>316</volume>
				<fpage>90</fpage>
				<lpage>103</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1016/j.virol.2003.08.001</pubid>
						<pubid idtype="pmpid" link="fulltext">14599794</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B16">
				<title>
					<p>The polytypic species revisited: genetic differentiation and molecular phylogenetics of the tiger salamander <it>Ambystoma tigrinum </it>(Amphibia: Caudata) complex</p>
				</title>
				<aug>
					<au>
						<snm>Shaffer</snm>
						<fnm>HB</fnm>
					</au>
					<au>
						<snm>McKnight</snm>
						<fnm>ML</fnm>
					</au>
				</aug>
				<source>Evolution</source>
				<pubdate>1996</pubdate>
				<volume>50</volume>
				<fpage>417</fpage>
				<lpage>433</lpage>
			</bibl>
			<bibl id="B17">
				<title>
					<p>Axolotl Colony Website</p>
				</title>
				<url>http://www.indiana.edu/~axolotl/</url>
			</bibl>
			<bibl id="B18">
				<title>
					<p>Comparative DNA renaturation kinetics in amphibians</p>
				</title>
				<aug>
					<au>
						<snm>Straus</snm>
						<fnm>NA</fnm>
					</au>
				</aug>
				<source>Proc Nat Acad Sci USA</source>
				<pubdate>1971</pubdate>
				<volume>68</volume>
				<fpage>799</fpage>
				<lpage>802</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmcid">389046</pubid>
						<pubid idtype="pmpid">5279521</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B19">
				<title>
					<p>The age of model organisms</p>
				</title>
				<aug>
					<au>
						<snm>Davis</snm>
						<fnm>RH</fnm>
					</au>
				</aug>
				<source>Nat Rev</source>
				<pubdate>2004</pubdate>
				<volume>5</volume>
				<fpage>69</fpage>
				<lpage>77</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/nrg1250</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B20">
				<title>
					<p>An <it>Ambystomatid mexicanum </it>EST sequencing project: Analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries</p>
				</title>
				<aug>
					<au>
						<snm>Habermann</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Bebin</snm>
						<fnm>A-G</fnm>
					</au>
					<au>
						<snm>Herklotz</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Volkmer</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Eckelt</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Pehlke</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Epperlein</snm>
						<fnm>HH</fnm>
					</au>
					<au>
						<snm>Schackert</snm>
						<fnm>HK</fnm>
					</au>
					<au>
						<snm>Wiebe</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Tanaka</snm>
						<fnm>EM</fnm>
					</au>
				</aug>
				<source>Genome Biology</source>
				<inpress/>
			</bibl>
			<bibl id="B21">
				<title>
					<p>Functional annotation of a full-length mouse cDNA collection</p>
				</title>
				<aug>
					<au>
						<snm>Kawai</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Shinagawa</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Shibata</snm>
						<fnm>K</fnm>
					</au>
					<etal/>
				</aug>
				<source>Nature</source>
				<pubdate>2001</pubdate>
				<volume>409</volume>
				<fpage>685</fpage>
				<lpage>690</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/35055500</pubid>
						<pubid idtype="pmpid" link="fulltext">11217851</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B22">
				<title>
					<p>Analysis of expressed sequence tags indicates 35,000 human genes</p>
				</title>
				<aug>
					<au>
						<snm>Ewing</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Green</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Nat Gen</source>
				<pubdate>2000</pubdate>
				<volume>25</volume>
				<fpage>232</fpage>
				<lpage>234</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1038/76115</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B23">
				<title>
					<p>Gene Ontology Consortium</p>
				</title>
				<url>http://www.godatabase.org/dev/database/</url>
			</bibl>
			<bibl id="B24">
				<title>
					<p>Incorporation of thymidine-H3 by cells in normal and injured mouse spinal cord</p>
				</title>
				<aug>
					<au>
						<snm>Adrian</snm>
						<fnm>EK</fnm>
						<suf>Jr</suf>
					</au>
					<au>
						<snm>Walker</snm>
						<fnm>BE</fnm>
					</au>
				</aug>
				<source>J Neuropathol Exp Neurol</source>
				<pubdate>1962</pubdate>
				<volume>21</volume>
				<fpage>597</fpage>
				<lpage>609</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">14011122</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B25">
				<title>
					<p>Cell proliferation and nestin expression in the ependyma of the adult rat spinal cord after injury</p>
				</title>
				<aug>
					<au>
						<snm>Namiki</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Tator</snm>
						<fnm>CH</fnm>
					</au>
				</aug>
				<source>J Neuropathol Exp Neurol</source>
				<pubdate>1999</pubdate>
				<volume>58</volume>
				<fpage>489</fpage>
				<lpage>98</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">10331437</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B26">
				<title>
					<p>Ependyma of the rat fourth ventricle and central canal: Response to injury</p>
				</title>
				<aug>
					<au>
						<snm>Bruni</snm>
						<fnm>JE</fnm>
					</au>
					<au>
						<snm>Anderson</snm>
						<fnm>WA</fnm>
					</au>
				</aug>
				<source>Acta Anat</source>
				<pubdate>1985</pubdate>
				<volume>128</volume>
				<fpage>265</fpage>
				<lpage>273</lpage>
			</bibl>
			<bibl id="B27">
				<title>
					<p>Ependymal cell reactions in spinal cord segments after compression injury in adult rat</p>
				</title>
				<aug>
					<au>
						<snm>Takahashi</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Yasuhisa</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Kurosawa</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Sueyoshi</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Shirai</snm>
						<fnm>S</fnm>
					</au>
				</aug>
				<source>J Neuropath Exp Neurol</source>
				<pubdate>2003</pubdate>
				<volume>62</volume>
				<fpage>185</fpage>
				<lpage>194</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid">12578228</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B28">
				<title>
					<p>Trancription factor expression and notch-dependent regulation of neural progenitors in the adult rat spinal cord</p>
				</title>
				<aug>
					<au>
						<snm>Yamamoto</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Nagao</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Sugimori</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Kosako</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Nakatomi</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Yamamoto</snm>
						<fnm>N</fnm>
					</au>
					<au>
						<snm>Takebayashi</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Nabeshima</snm>
						<fnm>Y</fnm>
					</au>
					<au>
						<snm>Kitamura</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Weinmaster</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Nakamura</snm>
						<fnm>K</fnm>
					</au>
					<au>
						<snm>Nakafuku</snm>
						<fnm>M</fnm>
					</au>
				</aug>
				<source>J Neurosci</source>
				<pubdate>2001</pubdate>
				<volume>21</volume>
				<fpage>9814</fpage>
				<lpage>9823</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">11739589</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B29">
				<title>
					<p>Proliferation and differentiation of progenitor cells throughout the intact adult spinal cord</p>
				</title>
				<aug>
					<au>
						<snm>Horner</snm>
						<fnm>PJ</fnm>
					</au>
					<au>
						<snm>Power</snm>
						<fnm>AE</fnm>
					</au>
					<au>
						<snm>Kempermann</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Kuhn</snm>
						<fnm>HG</fnm>
					</au>
					<au>
						<snm>Plamer</snm>
						<fnm>TD</fnm>
					</au>
					<au>
						<snm>Winkler</snm>
						<fnm>J</fnm>
					</au>
					<au>
						<snm>Thal</snm>
						<fnm>LJ</fnm>
					</au>
					<au>
						<snm>Gage</snm>
						<fnm>FH</fnm>
					</au>
				</aug>
				<source>J Neurosci</source>
				<pubdate>2000</pubdate>
				<volume>20</volume>
				<fpage>2218</fpage>
				<lpage>2228</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">10704497</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B30">
				<title>
					<p>Gene expression profiling of acute spinal cord injury reveals spreading inflammatory signals and neuron loss</p>
				</title>
				<aug>
					<au>
						<snm>Carmel</snm>
						<fnm>JB</fnm>
					</au>
					<au>
						<snm>Galante</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Soteropoulos</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Tolias</snm>
						<fnm>P</fnm>
					</au>
					<au>
						<snm>Recce</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Young</snm>
						<fnm>W</fnm>
					</au>
					<au>
						<snm>Hart</snm>
						<fnm>RP</fnm>
					</au>
				</aug>
				<source>Physio Genomics</source>
				<pubdate>2001</pubdate>
				<volume>7</volume>
				<fpage>201</fpage>
				<lpage>213</lpage>
			</bibl>
			<bibl id="B31">
				<title>
					<p>GeneChip analysis after acute spinal cord injury in rat</p>
				</title>
				<aug>
					<au>
						<snm>Song</snm>
						<fnm>G</fnm>
					</au>
					<au>
						<snm>Cechvala</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Resnick</snm>
						<fnm>DK</fnm>
					</au>
					<au>
						<snm>Dempsey</snm>
						<fnm>RJ</fnm>
					</au>
					<au>
						<snm>Rao</snm>
						<fnm>VLR</fnm>
					</au>
				</aug>
				<source>J Neurochem</source>
				<pubdate>2001</pubdate>
				<volume>79</volume>
				<fpage>804</fpage>
				<lpage>815</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1046/j.1471-4159.2001.00626.x</pubid>
						<pubid idtype="pmpid" link="fulltext">11723173</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B32">
				<title>
					<p>Genetic analysis of Steel and the PG-M/versican-encoding gene AxPG as candidate genes for the white (d) pigmentation mutant in the salamander <it>Ambystoma mexicanum</it></p>
				</title>
				<aug>
					<au>
						<snm>Parichy</snm>
						<fnm>DM</fnm>
					</au>
					<au>
						<snm>Stigson</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Voss</snm>
						<fnm>SR</fnm>
					</au>
				</aug>
				<source>Dev Genes Evol</source>
				<pubdate>1999</pubdate>
				<volume>209</volume>
				<fpage>349</fpage>
				<lpage>356</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1007/s004270050263</pubid>
						<pubid idtype="pmpid" link="fulltext">10370116</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B33">
				<title>
					<p>Adaptive evolution via a major gene effect: paedomorphosis in the Mexican axolotl</p>
				</title>
				<aug>
					<au>
						<snm>Voss</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Shaffer</snm>
						<fnm>HB</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1997</pubdate>
				<volume>94</volume>
				<fpage>14185</fpage>
				<lpage>14189</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1073/pnas.94.25.14185</pubid>
						<pubid idtype="pmpid" link="fulltext">9391174</pubid>
						<pubid idtype="pmcid">28454</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B34">
				<title>
					<p>Environment dependent admixture dynamics in a tiger salamander hybrid zone</p>
				</title>
				<aug>
					<au>
						<snm>Fitzpatrick</snm>
						<fnm>BM</fnm>
					</au>
					<au>
						<snm>Shaffer</snm>
						<fnm>HB</fnm>
					</au>
				</aug>
				<source>Int J Org Evolution</source>
				<pubdate>2004</pubdate>
				<volume>58</volume>
				<fpage>1282</fpage>
				<lpage>1293</lpage>
			</bibl>
			<bibl id="B35">
				<title>
					<p>Rate of mitochondrial DNA evolution is slow in sharks compared to mammals</p>
				</title>
				<aug>
					<au>
						<snm>Martin</snm>
						<fnm>AP</fnm>
					</au>
					<au>
						<snm>Palumbi</snm>
						<fnm>SR</fnm>
					</au>
				</aug>
				<source>Proc Natl Acad Sci USA</source>
				<pubdate>1993</pubdate>
				<volume>90</volume>
				<fpage>4087</fpage>
				<lpage>4091</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">8483925</pubid>
						<pubid idtype="pmcid">46451</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B36">
				<title>
					<p>The life history of the Mexican salamander <it>Ambystoma ordinarium </it>Taylor</p>
				</title>
				<aug>
					<au>
						<snm>Anderson</snm>
						<fnm>JD</fnm>
					</au>
					<au>
						<snm>Worthington</snm>
						<fnm>RD</fnm>
					</au>
				</aug>
				<source>Herpetologica</source>
				<pubdate>1971</pubdate>
				<volume>27</volume>
				<fpage>165</fpage>
				<lpage>176</lpage>
			</bibl>
			<bibl id="B37">
				<title>
					<p><it>Xenopus laevis </it>as a model organism</p>
				</title>
				<aug>
					<au>
						<snm>Cannatella</snm>
						<fnm>DC</fnm>
					</au>
					<au>
						<snm>De Sa</snm>
						<fnm>RO</fnm>
					</au>
				</aug>
				<source>Syst Biol</source>
				<pubdate>1993</pubdate>
				<volume>42</volume>
				<fpage>476</fpage>
				<lpage>507</lpage>
			</bibl>
			<bibl id="B38">
				<title>
					<p>First report on chicken genes and chromosomes</p>
				</title>
				<aug>
					<au>
						<snm>Schmid</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Nanda</snm>
						<fnm>I</fnm>
					</au>
					<au>
						<snm>Guttenbach</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Steinlein</snm>
						<fnm>C</fnm>
					</au>
					<au>
						<snm>Hoehn</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Schartl</snm>
						<fnm>M</fnm>
					</au>
					<au>
						<snm>Haaf</snm>
						<fnm>T</fnm>
					</au>
					<au>
						<snm>Weigend</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Fries</snm>
						<fnm>R</fnm>
					</au>
					<au>
						<snm>Buderstedde</snm>
						<fnm>J-M</fnm>
					</au>
					<etal/>
				</aug>
				<source>Cytogenet Cell Genet</source>
				<pubdate>2000</pubdate>
				<volume>90</volume>
				<fpage>169</fpage>
				<lpage>218</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1159/000056772</pubid>
						<pubid idtype="pmpid" link="fulltext">11124517</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B39">
				<title>
					<p>Zebrafish comparative genomics and the origins of vertebrate chromosomes</p>
				</title>
				<aug>
					<au>
						<snm>Postlethwait</snm>
						<fnm>JH</fnm>
					</au>
					<au>
						<snm>Woods</snm>
						<fnm>IG</fnm>
					</au>
					<au>
						<snm>Ngo-Hazelett</snm>
						<fnm>YP</fnm>
					</au>
					<au>
						<snm>Yan</snm>
						<fnm>Y-L</fnm>
					</au>
					<au>
						<snm>Kelly</snm>
						<fnm>PD</fnm>
					</au>
					<au>
						<snm>Chu</snm>
						<fnm>F</fnm>
					</au>
					<au>
						<snm>Huang</snm>
						<fnm>H</fnm>
					</au>
					<au>
						<snm>Hill-Force</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Talbot</snm>
						<fnm>WS</fnm>
					</au>
				</aug>
				<source>Genome Res</source>
				<pubdate>2000</pubdate>
				<volume>10</volume>
				<fpage>1890</fpage>
				<lpage>1902</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1101/gr.164800</pubid>
						<pubid idtype="pmpid" link="fulltext">11116085</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B40">
				<title>
					<p>Conserved vertebrate chromosome segments in the large salamander genome</p>
				</title>
				<aug>
					<au>
						<snm>Voss</snm>
						<fnm>SR</fnm>
					</au>
					<au>
						<snm>Smith</snm>
						<fnm>JJ</fnm>
					</au>
					<au>
						<snm>Gardiner</snm>
						<fnm>DM</fnm>
					</au>
					<au>
						<snm>Parichy</snm>
						<fnm>DM</fnm>
					</au>
				</aug>
				<source>Genetics</source>
				<pubdate>2001</pubdate>
				<volume>158</volume>
				<fpage>735</fpage>
				<lpage>746</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">11404337</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B41">
				<title>
					<p>Salamander Genome Project Website</p>
				</title>
				<url>http://salamander.uky.edu</url>
			</bibl>
			<bibl id="B42">
				<title>
					<p>Base-calling of automated sequencer traces using phred. II. Error probabilities</p>
				</title>
				<aug>
					<au>
						<snm>Ewing</snm>
						<fnm>B</fnm>
					</au>
					<au>
						<snm>Green</snm>
						<fnm>P</fnm>
					</au>
				</aug>
				<source>Genome Res</source>
				<pubdate>1998</pubdate>
				<volume>8</volume>
				<fpage>186</fpage>
				<lpage>194</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="pmpid" link="fulltext">9521922</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B43">
				<title>
					<p>Efficient clustering of large EST data sets on parallel computers</p>
				</title>
				<aug>
					<au>
						<snm>Kalyanaraman</snm>
						<fnm>A</fnm>
					</au>
					<au>
						<snm>Aluru</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Kothari</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Brendel</snm>
						<fnm>V</fnm>
					</au>
				</aug>
				<source>Nucleic Acids Res</source>
				<pubdate>2003</pubdate>
				<volume>31</volume>
				<fpage>2963</fpage>
				<lpage>2974</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1093/nar/gkg379</pubid>
						<pubid idtype="pmpid" link="fulltext">12771222</pubid>
						<pubid idtype="pmcid">156714</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B44">
				<title>
					<p>CAP3: A dna sequence assembly program</p>
				</title>
				<aug>
					<au>
						<snm>Huang</snm>
						<fnm>X</fnm>
					</au>
					<au>
						<snm>Madan</snm>
						<fnm>A</fnm>
					</au>
				</aug>
				<source>Genome Res</source>
				<pubdate>1999</pubdate>
				<volume>9</volume>
				<fpage>868</fpage>
				<lpage>877</lpage>
				<xrefbib>
					<pubidlist>
						<pubid idtype="doi">10.1101/gr.9.9.868</pubid>
						<pubid idtype="pmpid" link="fulltext">10508846</pubid>
					</pubidlist>
				</xrefbib>
			</bibl>
			<bibl id="B45">
				<title>
					<p>Primer 3</p>
				</title>
				<aug>
					<au>
						<snm>Rozen</snm>
						<fnm>S</fnm>
					</au>
					<au>
						<snm>Skaletsky</snm>
						<fnm>HJ</fnm>
					</au>
				</aug>
				<pubdate>1999</pubdate>
				<url>http://frodo.wi.mit.edu/primer3/primer3_code.html</url>
			</bibl>
			<bibl id="B46">
				<title>
					<p>MapManager QTX</p>
				</title>
				<aug>
					<au>
						<snm>Meer</snm>
						<fnm>JM</fnm>
					</au>
					<au>
						<snm>Cudmore</snm>
						<fnm>RH</fnm>
						<suf>Jr</suf>
					</au>
					<au>
						<snm>Manly</snm>
						<fnm>KF</fnm>
					</au>
				</aug>
				<pubdate>2004</pubdate>
				<url>http://www.mapmanager.org/mmQTX.html</url>
			</bibl>
		</refgrp>
	</bm>
</art>
