<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art><ui>1471-2164-12-474</ui><ji>1471-2164</ji><fm>
<dochead>Research article</dochead>
<bibl>
<title>
<p>High degree of sex chromosome differentiation in stickleback fishes</p>
</title>
<aug>
<au ca="yes" id="A1"><snm>Shikano</snm><fnm>Takahito</fnm><insr iid="I1"/><email>takahito.shikano@helsinki.fi</email></au>
<au id="A2"><snm>Natri</snm><mi>M</mi><fnm>Heini</fnm><insr iid="I1"/><email>heini.natri@helsinki.fi</email></au>
<au id="A3"><snm>Shimada</snm><fnm>Yukinori</fnm><insr iid="I1"/><email>yukinori.shimada@helsinki.fi</email></au>
<au id="A4"><snm>Meril&#228;</snm><fnm>Juha</fnm><insr iid="I1"/><email>juha.merila@helsinki.fi</email></au>
</aug>
<insg>
<ins id="I1"><p>Ecological Genetics Research Unit, Department of Biosciences, University of Helsinki, P.O. Box 65, FI-00014, Helsinki, Finland</p></ins>
</insg>
<source>BMC Genomics</source>
<issn>1471-2164</issn>
<pubdate>2011</pubdate>
<volume>12</volume>
<issue>1</issue>
<fpage>474</fpage>
<url>http://www.biomedcentral.com/1471-2164/12/474</url>
<xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2164-12-474</pubid><pubid idtype="pmpid">21958112</pubid></pubidlist></xrefbib>
</bibl>
<history><rec><date><day>7</day><month>3</month><year>2011</year></date></rec><acc><date><day>29</day><month>9</month><year>2011</year></date></acc><pub><date><day>29</day><month>9</month><year>2011</year></date></pub></history>
<cpyrt><year>2011</year><collab>Shikano et al; licensee BioMed Central Ltd.</collab><note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note></cpyrt>
<abs>
<sec>
<st>
<p>Abstract</p>
</st>
<sec>
<st>
<p>Background</p>
</st>
<p>Studies of closely related species with different sex chromosome systems can provide insights into the processes of sex chromosome differentiation and evolution. To investigate the potential utility of molecular markers in studying sex chromosome differentiation at early stages of their divergence, we examined the levels and patterns of genetic differentiation between sex chromosomes in nine-spined (<it>Pungitius pungitius</it>) and three-spined sticklebacks (<it>Gasterosteus aculeatus</it>) using microsatellite markers.</p>
</sec>
<sec>
<st>
<p>Results</p>
</st>
<p>A set of novel microsatellite markers spanning the entire length of the sex chromosomes were developed for nine-spined sticklebacks using the sequenced genomes of other fish species. Sex-specific patterns of genetic variability and male-specific alleles were identified at most of these loci, indicating a high degree of differentiation between the X and Y chromosomes in nine-spined sticklebacks. In three-spined sticklebacks, male-specific alleles were detected at some loci confined to two chromosomal regions. In addition, male-specific null alleles were identified at several other loci, implying the absence of Y chromosomal alleles at these loci. Overall, male-specific alleles and null alleles were found over a region spanning 81% of the sex chromosomes in three-spined sticklebacks.</p>
</sec>
<sec>
<st>
<p>Conclusions</p>
</st>
<p>High levels but distinct patterns of sex chromosome differentiation were uncovered in the stickleback species that diverged 13 million years ago. Our results suggest that the Y chromosome is highly degenerate in three-spined sticklebacks, but not in nine-spined sticklebacks. In general, the results demonstrate that microsatellites can be useful in identifying the degree and patterns of sex chromosome differentiation in species at initial stages of sex chromosome evolution.</p>
</sec>
</sec>
</abs>
</fm><bdy>
<sec>
<st>
<p>Background</p>
</st>
<p>Recent advances in comparative genomic and molecular cytogenetic studies have greatly increased our understanding about the extent and pace of sex chromosome evolution <abbrgrp>
<abbr bid="B1">1</abbr>
<abbr bid="B2">2</abbr>
</abbrgrp>. For instance, therian and avian sex chromosomes are known to have originated independently from two different autosomal regions in a common ancestor <abbrgrp>
<abbr bid="B1">1</abbr>
<abbr bid="B3">3</abbr>
</abbrgrp>. In contrast, lower vertebrates exhibit a wide variety of sex chromosome and sex determination systems, implying multiple and independent origins of sex chromosomes <abbrgrp>
<abbr bid="B4">4</abbr>
<abbr bid="B5">5</abbr>
<abbr bid="B6">6</abbr>
</abbrgrp>. Recent studies have shown that sex chromosomes of <it>Oryzias </it>fishes and sticklebacks (Gasterosteidae) have emerged 10 million years ago or even later <abbrgrp>
<abbr bid="B7">7</abbr>
<abbr bid="B8">8</abbr>
<abbr bid="B9">9</abbr>
<abbr bid="B10">10</abbr>
</abbrgrp>. Likewise, different heterogametic sex determination systems have been found in tilapia fishes and the frog <it>Rana rugosa </it>
<abbrgrp>
<abbr bid="B11">11</abbr>
<abbr bid="B12">12</abbr>
</abbrgrp>.</p>
<p>Despite the substantial progress in understanding the evolutionary history of sex chromosomes, there are still gaps in our knowledge about the process of sex chromosome differentiation. For instance, it has been hypothesized that sex chromosomes would typically evolve from a pair of autosomes that cease to recombine with each other after acquiring a sex determining role <abbrgrp>
<abbr bid="B13">13</abbr>
<abbr bid="B14">14</abbr>
<abbr bid="B15">15</abbr>
</abbrgrp>. Suppression of recombination leads to further differentiation of the sex chromosomes and degeneration of the heterogametic chromosome (i.e. Y or W), resulting in morphologically differentiated sex chromosomes <abbrgrp>
<abbr bid="B14">14</abbr>
<abbr bid="B16">16</abbr>
</abbrgrp>. Accordingly, a heteromorphic sex chromosome pair is generally thought to have evolved through increasing stages of differentiation <abbrgrp>
<abbr bid="B14">14</abbr>
</abbrgrp>. However, since chromosomal rearrangements can produce heteromorphism, even newly evolved sex chromosomes can be heteromorphic <abbrgrp>
<abbr bid="B2">2</abbr>
</abbrgrp>. In addition, neither suppressed recombination nor heteromorphism always evolve in old-established sex chromosomes <abbrgrp>
<abbr bid="B2">2</abbr>
</abbrgrp>.</p>
<p>Studies of model organisms with young sex chromosomes have uncovered molecular characteristics at the initial stages of differentiation that align with theoretical expectations <abbrgrp>
<abbr bid="B5">5</abbr>
<abbr bid="B15">15</abbr>
<abbr bid="B17">17</abbr>
</abbrgrp>. Yet, molecular differentiation of sex chromosomes has been assessed mainly from sequence analyses, which are not easily accomplished without access to sequenced genomes or equivalent genomic resources <abbrgrp>
<abbr bid="B17">17</abbr>
</abbrgrp>. Thus, simple and accurate methods of evaluating sex chromosome differentiation in non-model organisms would be desirable. One potential approach is to use allelic variation in genetic markers. Since allelic differentiation at microsatellite loci is expected to be in a linear relationship with time since divergence <abbrgrp>
<abbr bid="B18">18</abbr>
<abbr bid="B19">19</abbr>
</abbrgrp>, microsatellite variation might be able to uncover the patterns and degree of sex chromosome differentiation. Indeed, although microsatellite markers have been rarely used for this purpose, they have been shown to be useful in detecting genetic differentiation between sex chromosomes in <it>Drosophila </it>
<abbrgrp>
<abbr bid="B20">20</abbr>
</abbrgrp>. Moreover, since a large proportion of microsatellite loci appear to be conserved in closely related species <abbrgrp>
<abbr bid="B21">21</abbr>
<abbr bid="B22">22</abbr>
</abbrgrp>, the use of microsatellite markers may also allow comparative genomic analyses in this context. Conversely, the sequenced genomes of closely related species can be used to predict microsatellite locations in the genome of a target species lacking the reference genome sequence <abbrgrp>
<abbr bid="B22">22</abbr>
</abbrgrp>. An obvious limitation in the development of markers is that mutations in the regions flanking microsatellite loci make it difficult to develop primers that work in a target species. Yet, this problem can be circumvented by designing primers in conserved regions, which are identifiable using the genome sequences of multiple species in the same taxon. Accordingly, based on microsatellite locations in the genome of a related species, microsatellite markers can be developed for target chromosomes and genomic regions in other species lacking sequenced genomes.</p>
<p>Sticklebacks are widely used as model organisms in evolutionary biology <abbrgrp>
<abbr bid="B23">23</abbr>
<abbr bid="B24">24</abbr>
</abbrgrp>. The genome sequence of the three-spined stickleback (<it>Gasterosteus aculeatus</it>) provides a useful resource for studying the genetic basis of several phenotypic traits <abbrgrp>
<abbr bid="B25">25</abbr>
</abbrgrp>. A sex determining region has been mapped to linkage group (LG) 19 in three-spined sticklebacks - a species possessing an XY sex chromosome system <abbrgrp>
<abbr bid="B8">8</abbr>
</abbrgrp>. Their sex chromosomes are cytologically indistinguishable in the absence of molecular cytogenetic information <abbrgrp>
<abbr bid="B26">26</abbr>
</abbrgrp>. In contrast, nine-spined sticklebacks (<it>Pungitius pungitius</it>) have a heteromorphic XY pair corresponding to three-spined stickleback LG 12 <abbrgrp>
<abbr bid="B10">10</abbr>
<abbr bid="B27">27</abbr>
</abbrgrp>. In particular, their sex chromosomes are characterized by a large Y chromosome which might be a result of a tandem duplication of the ancient Y chromosome or a duplication of an autosomal segment followed by insertion into the Y chromosome <abbrgrp>
<abbr bid="B28">28</abbr>
</abbrgrp>. These different sex chromosome systems suggest their independent evolution in stickleback species <abbrgrp>
<abbr bid="B10">10</abbr>
</abbrgrp>. Because of the rapid turnover of sex chromosome systems in closely related species, sticklebacks provide an ideal system to study the initial stages of sex chromosome differentiation <abbrgrp>
<abbr bid="B8">8</abbr>
<abbr bid="B10">10</abbr>
</abbrgrp>.</p>
<p>The aim of this study was to compare the level and patterns of genetic differentiation of sex chromosomes in nine-spined and three-spined sticklebacks using microsatellite markers. Since stickleback species exhibit a rapid turnover of sex chromosomes, their sex chromosomes are thought to be at the early stages of evolution. Therefore, we expected that the degree of genetic differentiation between sex chromosomes would be similar in nine-spined and three-spined sticklebacks. To facilitate the comparative genomic analyses, we devised a simple method for the development of microsatellite markers for target chromosomes and genomic regions in nine-spined sticklebacks using the sequenced genomes of other fish species.</p>
</sec>
<sec>
<st>
<p>Results</p>
</st>
<sec>
<st>
<p>Nine-spined sticklebacks</p>
</st>
<p>Twenty-three polymorphic markers, including 14 for LG 12 (Ppsm), were developed for nine-spined sticklebacks (Table <tblr tid="T1">1</tblr>). On average, 10.6 alleles per locus (range = 2-47) were detected across the two populations (Table <tblr tid="T1">1</tblr>). The mean number of observed alleles and average expected heterozygosities were 10.3 and 0.66 in the Baltic Sea and 2.0 and 0.27 in Py&#246;re&#228;lampi, respectively (Additional file <supplr sid="S1">1</supplr>). Out of the 14 Ppsm loci, 10 were homozygous in all females and heterozygous in all males in the Py&#246;re&#228;lampi population (Figure <figr fid="F1">1</figr>, Additional file <supplr sid="S1">1</supplr>). Consequently, the number of observed alleles and expected and observed heterozygosities were significantly higher in males than females in this population (Wilcoxon signed rank test, <it>P </it>&lt; 0.01 for allele number, <it>P </it>&lt; 0.001 for heterozygosities). In the Baltic Sea population, observed heterozygosity was higher in males than females (<it>P </it>&lt; 0.01; Figure <figr fid="F1">1</figr>), but no significant differences were found in the number of alleles and expected heterozygosity (<it>P </it>&gt; 0.05). While no loci showed significant <it>F</it>
<sub>IS </sub>in females, negative <it>F</it>
<sub>IS </sub>was detected in males at 11 Ppsm loci in the Baltic Sea and at 13 Ppsm loci in Py&#246;re&#228;lampi (Figure <figr fid="F1">1</figr>, Additional file <supplr sid="S1">1</supplr>). Linkage disequilibrium was observed in all pairs of polymorphic Ppsm loci in Py&#246;re&#228;lampi, although 47 out of the 91 comparisons were not significant in the Baltic Sea (Additional file <supplr sid="S2">2</supplr>). In particular, linkage disequilibrium was not detected in several combinations including highly polymorphic loci (e.g. Ppsm3-5 and Ppsm14). The trend test identified significant associations between phenotypic sex and Ppsm loci in both populations (Additional file <supplr sid="S3">3</supplr>). All polymorphic Ppsm loci showed an association with sex in Py&#246;re&#228;lampi, whereas significant association was not observed for four Ppsm loci (Ppsm1, Ppsm3, Ppsm4 and Ppsm14) in the Baltic Sea (Additional file <supplr sid="S3">3</supplr>).</p>
<tbl id="T1"><title><p>Table 1</p></title><caption><p>Location of 23 microsatellites in the three-spined stickleback genome and primer sequences for nine-spined sticklebacks</p></caption><tblbdy cols="7">
      <r>
         <c ca="left">
            <p>
               <b>Locus</b>
            </p>
         </c>
         <c cspan="3" ca="left">
            <p>
               <b>Three-spined stickleback genome</b>
            </p>
         </c>
         <c cspan="3" ca="left">
            <p>
               <b>Microsatellite marker for nine-spined stickleback</b>
            </p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c cspan="3">
            <hr/>
         </c>
         <c cspan="3">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>
               <b>LG</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Position (bp)</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Repeat motif</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Primer sequence (5'-3')</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>
                  <it>A</it>
               </b>
            </p>
         </c>
         <c indent="1" ca="left">
            <p>
               <b>Allele size (bp)</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm1</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>188976</p>
         </c>
         <c ca="left">
            <p>(CCT)<sub>6</sub></p>
         </c>
         <c ca="left">
            <p>F: GGCTCTTCCGATGAGTTCTC</p>
         </c>
         <c ca="left">
            <p>6</p>
         </c>
         <c indent="1" ca="left">
            <p>298-308</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: GTCTGCGCGTCAGCATCC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm2</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>3625645</p>
         </c>
         <c ca="left">
            <p>(AC)<sub>24</sub></p>
         </c>
         <c ca="left">
            <p>F: GCCTCCCAGTCCTCTGT</p>
         </c>
         <c ca="left">
            <p>5</p>
         </c>
         <c indent="1" ca="left">
            <p>175-183</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: GCCATGGAGTACGACATCATG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm3</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>4802750</p>
         </c>
         <c ca="left">
            <p>(GT)<sub>16</sub></p>
         </c>
         <c ca="left">
            <p>F: GAACGATGATTAATTTCACTC</p>
         </c>
         <c ca="left">
            <p>42</p>
         </c>
         <c indent="1" ca="left">
            <p>161-271</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTGACCCTGACTGGAGG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm4</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>4843632</p>
         </c>
         <c ca="left">
            <p>(CA)<sub>15</sub></p>
         </c>
         <c ca="left">
            <p>F: CCAGCTGCTCTGTTTTGTTAAC</p>
         </c>
         <c ca="left">
            <p>16</p>
         </c>
         <c indent="1" ca="left">
            <p>223-267</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CCTGGCCTCATTACAGTAAC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm5</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>5616109</p>
         </c>
         <c ca="left">
            <p>(GAG)<sub>7</sub></p>
         </c>
         <c ca="left">
            <p>F: ATCACGACTCTGAGGAGAG</p>
         </c>
         <c ca="left">
            <p>10</p>
         </c>
         <c indent="1" ca="left">
            <p>208-241</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: TTCTTCAGCTCCACGGG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm6</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>7178391</p>
         </c>
         <c ca="left">
            <p>(AC)<sub>12</sub></p>
         </c>
         <c ca="left">
            <p>F: ATCGCCCTGCTGGTGGAG</p>
         </c>
         <c ca="left">
            <p>5</p>
         </c>
         <c indent="1" ca="left">
            <p>231-239</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: GGAGCGCTGTTTCCGCC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm7</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>7695994</p>
         </c>
         <c ca="left">
            <p>(GT)<sub>13</sub></p>
         </c>
         <c ca="left">
            <p>F: GCAGCACTGTTGTCCAA</p>
         </c>
         <c ca="left">
            <p>9</p>
         </c>
         <c indent="1" ca="left">
            <p>73-143</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTACTTGAACGATGCTC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm8</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>9015356</p>
         </c>
         <c ca="left">
            <p>(GT)<sub>15</sub></p>
         </c>
         <c ca="left">
            <p>F: CCAAAGGCAATTTCAAATCTC</p>
         </c>
         <c ca="left">
            <p>4</p>
         </c>
         <c indent="1" ca="left">
            <p>203-217</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: GAATGACAGGCTGTTTGTCTG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm9</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>10780938</p>
         </c>
         <c ca="left">
            <p>(TG)<sub>16</sub></p>
         </c>
         <c ca="left">
            <p>F: CAAGATGGACTACTCAAGG</p>
         </c>
         <c ca="left">
            <p>3</p>
         </c>
         <c indent="1" ca="left">
            <p>247-252</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTATCAACCTCTCCAGCTTC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm10</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>12581231</p>
         </c>
         <c ca="left">
            <p>(TG)<sub>7</sub></p>
         </c>
         <c ca="left">
            <p>F: GCTTAGTGTTAATTGGTTCCTG</p>
         </c>
         <c ca="left">
            <p>7</p>
         </c>
         <c indent="1" ca="left">
            <p>218-232</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: TAGACCCTGAGGGTGTG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm11</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>15639505</p>
         </c>
         <c ca="left">
            <p>(AT)<sub>8</sub></p>
         </c>
         <c ca="left">
            <p>F: AACAACGGTGCTATCTCCTCT</p>
         </c>
         <c ca="left">
            <p>7</p>
         </c>
         <c indent="1" ca="left">
            <p>186-198</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: TGGAATCCCATGCAGCGCAC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm12</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>16027500</p>
         </c>
         <c ca="left">
            <p>(TG)<sub>8</sub></p>
         </c>
         <c ca="left">
            <p>F: GCATGGTCATCATCTGGAG</p>
         </c>
         <c ca="left">
            <p>4</p>
         </c>
         <c indent="1" ca="left">
            <p>251-263</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: ATGACACATGCATGGAGT</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm13</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>16138995</p>
         </c>
         <c ca="left">
            <p>(TG)<sub>13</sub></p>
         </c>
         <c ca="left">
            <p>F: GCCTGCTACAAAGCTGA</p>
         </c>
         <c ca="left">
            <p>3</p>
         </c>
         <c indent="1" ca="left">
            <p>256-280</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTTGAAGGACTCAAAGAAGCC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm14</p>
         </c>
         <c ca="left">
            <p>XII</p>
         </c>
         <c ca="left">
            <p>18276705</p>
         </c>
         <c ca="left">
            <p>(CA)<sub>11</sub></p>
         </c>
         <c ca="left">
            <p>F: CCGATGGCCTGGTTCAC</p>
         </c>
         <c ca="left">
            <p>47</p>
         </c>
         <c indent="1" ca="left">
            <p>263-445</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: GGCGTCATCATCACCGG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm1</p>
         </c>
         <c ca="left">
            <p>III</p>
         </c>
         <c ca="left">
            <p>4656850</p>
         </c>
         <c ca="left">
            <p>(TG)<sub>15</sub></p>
         </c>
         <c ca="left">
            <p>F: TGTGCTGCAGACCTCCAC</p>
         </c>
         <c ca="left">
            <p>5</p>
         </c>
         <c indent="1" ca="left">
            <p>202-214</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: TGGCGTCACGGAGCTGAAG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm2</p>
         </c>
         <c ca="left">
            <p>IV</p>
         </c>
         <c ca="left">
            <p>62968</p>
         </c>
         <c ca="left">
            <p>(CA)<sub>13</sub></p>
         </c>
         <c ca="left">
            <p>F: GATACAGCTCCTGCTCCAG</p>
         </c>
         <c ca="left">
            <p>4</p>
         </c>
         <c indent="1" ca="left">
            <p>163-169</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CCAGGATGAACCAGGTGAG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm3</p>
         </c>
         <c ca="left">
            <p>IV</p>
         </c>
         <c ca="left">
            <p>15800213</p>
         </c>
         <c ca="left">
            <p>(GT)<sub>21</sub></p>
         </c>
         <c ca="left">
            <p>F: GGCTTCTATTTCTGCCTCCC</p>
         </c>
         <c ca="left">
            <p>23</p>
         </c>
         <c indent="1" ca="left">
            <p>344-392</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: TACCTGAGCAGCTCGCAG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm4</p>
         </c>
         <c ca="left">
            <p>V</p>
         </c>
         <c ca="left">
            <p>4991466</p>
         </c>
         <c ca="left">
            <p>(TGT)<sub>6</sub></p>
         </c>
         <c ca="left">
            <p>F: GCTGGGCAGTATTCTGTGG</p>
         </c>
         <c ca="left">
            <p>7</p>
         </c>
         <c indent="1" ca="left">
            <p>288-306</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: AACATCCTCATCCACAGCAGC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm5</p>
         </c>
         <c ca="left">
            <p>XV</p>
         </c>
         <c ca="left">
            <p>21776</p>
         </c>
         <c ca="left">
            <p>(AC)<sub>16</sub></p>
         </c>
         <c ca="left">
            <p>F: ATCCCAACGTCATCCAGCTC</p>
         </c>
         <c ca="left">
            <p>2</p>
         </c>
         <c indent="1" ca="left">
            <p>193-194</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CAGCAGGAAGGTGTGCAG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm6</p>
         </c>
         <c ca="left">
            <p>XV</p>
         </c>
         <c ca="left">
            <p>8323413</p>
         </c>
         <c ca="left">
            <p>(CA)<sub>13</sub></p>
         </c>
         <c ca="left">
            <p>F: CTGGAGCGTTTACAGGTGG</p>
         </c>
         <c ca="left">
            <p>8</p>
         </c>
         <c indent="1" ca="left">
            <p>364-382</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTGCTGAGCTGAACAGGC</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm7</p>
         </c>
         <c ca="left">
            <p>XVI</p>
         </c>
         <c ca="left">
            <p>3587216</p>
         </c>
         <c ca="left">
            <p>(AC)<sub>10</sub></p>
         </c>
         <c ca="left">
            <p>F: CTGGAGACCAACAAGTTGAGG</p>
         </c>
         <c ca="left">
            <p>12</p>
         </c>
         <c indent="1" ca="left">
            <p>274-298</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTTAACAAAGATCCTGCTGGACG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm8</p>
         </c>
         <c ca="left">
            <p>XVIII</p>
         </c>
         <c ca="left">
            <p>10203501</p>
         </c>
         <c ca="left">
            <p>(GT)<sub>25</sub></p>
         </c>
         <c ca="left">
            <p>F: CACCCATGTTCCTGTGCTTC</p>
         </c>
         <c ca="left">
            <p>11</p>
         </c>
         <c indent="1" ca="left">
            <p>306-380</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: ACAAAGCCCTGCTCTCGAG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Pprm9</p>
         </c>
         <c ca="left">
            <p>XX</p>
         </c>
         <c ca="left">
            <p>5366535</p>
         </c>
         <c ca="left">
            <p>(CA)<sub>14</sub></p>
         </c>
         <c ca="left">
            <p>F: TCCTCATGATGTTGACCAGTGC</p>
         </c>
         <c ca="left">
            <p>3</p>
         </c>
         <c indent="1" ca="left">
            <p>166-172</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>R: CTGGCCTATGGAAACCAGG</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
   </tblbdy><tblfn>
      <p>LG, linkage group. F, forward; R, reverse. <it>A</it>, number of observed alleles.</p>
   </tblfn></tbl>
<suppl id="S1">
<title>
<p>Additional file 1</p>
</title>
<text>
<p>
<b>Number of observed alleles (<it>A</it>), observed and expected heterozygosities (<it>H</it>
<sub>O </sub>and <it>H</it>
<sub>E</sub>) and <it>F</it>
<sub>IS </sub>at 23 loci in two populations of nine-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S1.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<fig id="F1"><title><p>Figure 1</p></title><caption><p>Observed heterozygosity (<it>H</it><sub>O</sub>), <it>F</it><sub>IS </sub>and <it>F</it><sub>ST </sub>between females and males at 14 Ppsm loci in nine-spined sticklebacks</p></caption><text>
   <p><b>Observed heterozygosity (<it>H</it><sub>O</sub>), <it>F</it><sub>IS </sub>and <it>F</it><sub>ST </sub>between females and males at 14 Ppsm loci in nine-spined sticklebacks</b>. <b>A</b> and <b>D</b>, <it>H</it><sub>O </sub>in females (white) and males (gray); <b>B </b>and <b>E</b>, <it>F</it><sub>IS </sub>in females (white) and males (gray); <b>C </b>and <b>F</b>, <it>F</it><sub>ST </sub>between females and males. <b>A</b>-<b>C</b>, Baltic Sea; <b>D</b>-<b>F</b>, Py&#246;re&#228;lampi. *<it>P </it>&lt; 0.05, **<it>P </it>&lt; 0.01 and ***<it>P </it>&lt; 0.001. The blue colour indicates the loci where significant <it>F</it><sub>ST </sub>was observed. Physical locations of loci were determined based on the three-spined stickleback genome.</p>
</text><graphic file="1471-2164-12-474-1" hint_layout="double"/></fig>
<suppl id="S2">
<title>
<p>Additional file 2</p>
</title>
<text>
<p>
<b>Significance of linkage disequilibrium among 23 loci in the Baltic Sea (below the diagonal) and Py&#246;re&#228;lampi (above the diagonal) of nine-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S2.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S3">
<title>
<p>Additional file 3</p>
</title>
<text>
<p>
<b>Association between phenotypic sex and loci in two populations of nine-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S3.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<p>The analyses of genotypic frequencies at Ppsm loci identified several alleles that were observed only in males (Table <tblr tid="T2">2</tblr>). All males from Py&#246;re&#228;lampi possessed both male-specific and nonspecific alleles at each of the polymorphic loci (Table <tblr tid="T2">2</tblr>). No polymorphism was detected in the male-specific alleles in this population. Male-specific alleles were found at nine loci in all males of the Baltic Sea (Table <tblr tid="T2">2</tblr>). Although a male-specific allele was not detected at Ppsm5, the same allele (229) was observed in most (23 out of 24) males and a few (2 out of 24) females. <it>F</it>
<sub>ST </sub>values between females and males were significant for 13 Ppsm loci in both populations (Figure <figr fid="F1">1</figr>). For these loci, <it>F</it>
<sub>ST </sub>values were larger in the Py&#246;re&#228;lampi than in the Baltic Sea.</p>
<tbl id="T2"><title><p>Table 2</p></title><caption><p>Male-specific alleles at 14 Ppsm loci in two populations of nine-spined sticklebacks</p></caption><tblbdy cols="5">
      <r>
         <c ca="left">
            <p>
               <b>Locus</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Baltic Sea</b>
            </p>
         </c>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>
               <b>Py&#246;re&#228;lampi</b>
            </p>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>
               <b>Male-specific allele*</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Other allele</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Male-specific allele*</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Other allele</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm1</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>298-308</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm2</p>
         </c>
         <c ca="left">
            <p>179 (100.0)</p>
         </c>
         <c ca="left">
            <p>175-181</p>
         </c>
         <c ca="left">
            <p>179 (100.0)</p>
         </c>
         <c ca="left">
            <p>181-183</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm3</p>
         </c>
         <c ca="left">
            <p>171 (54.2)</p>
         </c>
         <c ca="left">
            <p>161-271</p>
         </c>
         <c ca="left">
            <p>191 (100.0)</p>
         </c>
         <c ca="left">
            <p>209-215</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm4</p>
         </c>
         <c ca="left">
            <p>247 (70.8)</p>
         </c>
         <c ca="left">
            <p>223-267</p>
         </c>
         <c ca="left">
            <p>247 (100.0)</p>
         </c>
         <c ca="left">
            <p>227</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm5</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>208-241</p>
         </c>
         <c ca="left">
            <p>229 (100.0)</p>
         </c>
         <c ca="left">
            <p>235</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm6</p>
         </c>
         <c ca="left">
            <p>232 (100.0)</p>
         </c>
         <c ca="left">
            <p>231-239</p>
         </c>
         <c ca="left">
            <p>232 (100.0)</p>
         </c>
         <c ca="left">
            <p>235</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm7</p>
         </c>
         <c ca="left">
            <p>125-143 (100.0)</p>
         </c>
         <c ca="left">
            <p>73-77</p>
         </c>
         <c ca="left">
            <p>141 (100.0)</p>
         </c>
         <c ca="left">
            <p>75</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm8</p>
         </c>
         <c ca="left">
            <p>203 (100.0)</p>
         </c>
         <c ca="left">
            <p>211-217</p>
         </c>
         <c ca="left">
            <p>203 (100.0)</p>
         </c>
         <c ca="left">
            <p>215</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm9</p>
         </c>
         <c ca="left">
            <p>247 (100.0)</p>
         </c>
         <c ca="left">
            <p>251-252</p>
         </c>
         <c ca="left">
            <p>247 (100.0)</p>
         </c>
         <c ca="left">
            <p>252</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm10</p>
         </c>
         <c ca="left">
            <p>222 (100.0)</p>
         </c>
         <c ca="left">
            <p>218-232</p>
         </c>
         <c ca="left">
            <p>222 (100.0)</p>
         </c>
         <c ca="left">
            <p>220</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm11</p>
         </c>
         <c ca="left">
            <p>197 (100.0)</p>
         </c>
         <c ca="left">
            <p>186-198</p>
         </c>
         <c ca="left">
            <p>197 (100.0)</p>
         </c>
         <c ca="left">
            <p>188</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm12</p>
         </c>
         <c ca="left">
            <p>251-253 (100.0)</p>
         </c>
         <c ca="left">
            <p>257-263</p>
         </c>
         <c ca="left">
            <p>253 (100.0)</p>
         </c>
         <c ca="left">
            <p>257</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm13</p>
         </c>
         <c ca="left">
            <p>280 (100.0)</p>
         </c>
         <c ca="left">
            <p>256-258</p>
         </c>
         <c ca="left">
            <p>280 (100.0)</p>
         </c>
         <c ca="left">
            <p>256</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Ppsm14</p>
         </c>
         <c ca="left">
            <p>287 (75.0)</p>
         </c>
         <c ca="left">
            <p>263-445</p>
         </c>
         <c ca="left">
            <p>279 (100.0)</p>
         </c>
         <c ca="left">
            <p>281-287</p>
         </c>
      </r>
   </tblbdy><tblfn>
      <p>*The percentage of males having the allele(s) is indicated in parentheses. Minor alleles (&lt; 15%) are not shown except for Ppsm7 and Ppsm12.</p>
   </tblfn></tbl>
</sec>
<sec>
<st>
<p>Three-spined sticklebacks</p>
</st>
<p>A total of 161 alleles were observed at 14 loci, with an average of 11.5 alleles per locus (range = 2-31) in three-spined sticklebacks (Additional files <supplr sid="S4">4</supplr> and <supplr sid="S5">5</supplr>). Linkage disequilibrium was observed in only eight out of the 91 comparisons (Additional file <supplr sid="S6">6</supplr>). Expected heterozygosity ranged from 0.39 to 0.93 among the loci with a mean of 0.70 (Additional file <supplr sid="S5">5</supplr>). Several loci showed different levels of observed heterozygosity between females and males (Figure <figr fid="F2">2</figr>, Additional file <supplr sid="S5">5</supplr>). Although no loci showed significant <it>F</it>
<sub>IS </sub>in females, 12 loci exhibited significant <it>F</it>
<sub>IS </sub>in males (Figure <figr fid="F2">2</figr>, Additional file <supplr sid="S5">5</supplr>). Out of these 12 loci, five were heterozygous in all males, showing negative <it>F</it>
<sub>IS</sub>. At these loci, which were located in two chromosomal regions (i.e. 3.2-4.0 Mb and 9.4-11.8 Mb), male-specific alleles were detected in all males in heterozygous states (Table <tblr tid="T3">3</tblr>). In contrast, although two to 20 alleles were observed for each locus, no heterozygous males were found at seven loci that showed positive <it>F</it>
<sub>IS </sub>(Figure <figr fid="F2">2</figr>, Additional file <supplr sid="S5">5</supplr>). No male-specific alleles were identified at these loci (Table <tblr tid="T3">3</tblr>). MICRO-CHECKER analyses indicated the presence of null alleles at the seven loci in males, but not in females. These loci were located sequentially in two separate chromosomal regions (i.e. 5.1-7.4 Mb and 14.7-19.6 Mb) of LG 19 (Figure <figr fid="F2">2</figr>, Additional file <supplr sid="S4">4</supplr>).</p>
<suppl id="S4">
<title>
<p>Additional file 4</p>
</title>
<text>
<p>
<b>Location of 14 microsatellites and primer sequences for three-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S4.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S5">
<title>
<p>Additional file 5</p>
</title>
<text>
<p>
<b>Number of observed alleles (<it>A</it>), observed and expected heterozygosities (<it>H</it>
<sub>O </sub>and <it>H</it>
<sub>E</sub>) and <it>F</it>
<sub>IS </sub>at 14 loci in three-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S5.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S6">
<title>
<p>Additional file 6</p>
</title>
<text>
<p>
<b>Significance of linkage disequilibrium among 14 loci in three-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S6.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<fig id="F2"><title><p>Figure 2</p></title><caption><p>Observed heterozygosity (<it>H</it><sub>O</sub>), <it>F</it><sub>IS </sub>and <it>F</it><sub>ST </sub>between females and males at 14 loci in three-spined sticklebacks</p></caption><text>
   <p><b>Observed heterozygosity (<it>H</it><sub>O</sub>), <it>F</it><sub>IS </sub>and <it>F</it><sub>ST </sub>between females and males at 14 loci in three-spined sticklebacks</b>. <b>A</b>, <it>H</it><sub>O </sub>in females (white) and males (gray); <b>B</b>, <it>F</it><sub>IS </sub>in females (white) and males (gray); <b>C</b>, <it>F</it><sub>ST </sub>between females and males. **<it>P </it>&lt; 0.01 and ***<it>P </it>&lt; 0.001. The blue colour indicates the loci where significant <it>F</it><sub>ST </sub>was observed, and the red colour represents the loci where no heterozygous males were found. Physical locations of loci were determined based on the three-spined stickleback genome but modified according to Ross and Peichel <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>.</p>
</text><graphic file="1471-2164-12-474-2" hint_layout="single"/></fig>
<tbl id="T3"><title><p>Table 3</p></title><caption><p>Male-specific alleles at 14 loci in three-spined sticklebacks</p></caption><tblbdy cols="3">
      <r>
         <c ca="left">
            <p>
               <b>Locus</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Baltic Sea</b>
            </p>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c ca="left">
            <p>
               <b>Male-specific allele*</b>
            </p>
         </c>
         <c ca="left">
            <p>
               <b>Other allele</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="3">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn290</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>100-178</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn185</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>152-160</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Gasm5</p>
         </c>
         <c ca="left">
            <p>82 (100.0)</p>
         </c>
         <c ca="left">
            <p>85-89</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Gasm20</p>
         </c>
         <c ca="left">
            <p>191 (100.0)</p>
         </c>
         <c ca="left">
            <p>313-371</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn187</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>156-184</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Gasm17</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>193-213</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn235</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>127-155</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>RhCG1</p>
         </c>
         <c ca="left">
            <p>254 (100.0)</p>
         </c>
         <c ca="left">
            <p>241-275</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn190</p>
         </c>
         <c ca="left">
            <p>231-279 (100.0)</p>
         </c>
         <c ca="left">
            <p>183</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Stn194</p>
         </c>
         <c ca="left">
            <p>123-129 (100.0)</p>
         </c>
         <c ca="left">
            <p>85-91</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>MYOD</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>150-162</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>PKMa</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>269-271</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Gasm11</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>424-456</p>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>Gasm8</p>
         </c>
         <c ca="left">
            <p>-</p>
         </c>
         <c ca="left">
            <p>376-406</p>
         </c>
      </r>
   </tblbdy><tblfn>
      <p>*The percentage of males having the allele(s) is indicated in parentheses. Minor alleles (&lt; 15%) are not shown except for Stn194 and Stn190.</p>
   </tblfn></tbl>
<p>Significant associations between phenotypic sex and loci were detected for the five loci that possessed male-specific alleles (Additional file <supplr sid="S7">7</supplr>). <it>F</it>
<sub>ST </sub>between females and males was significant for these, but not for the other loci (Figure <figr fid="F2">2</figr>).</p>
<suppl id="S7">
<title>
<p>Additional file 7</p>
</title>
<text>
<p>
<b>Association between phenotypic sex and loci in three-spined sticklebacks</b>.</p>
</text>
<file name="1471-2164-12-474-S7.PDF">
   <p>Click here for file</p>
</file>
</suppl>
</sec>
</sec>
<sec>
<st>
<p>Discussion</p>
</st>
<p>Our study uncovered sex-specific patterns of genetic variability and male-specific alleles at several loci in both stickleback species. In addition, male-specific null alleles were identified at several loci in three-spined sticklebacks, suggesting the absence of Y chromosomal alleles at these loci. The high allelic heterogeneity between sexes indicates high levels of sex chromosome differentiation, which likely reflects recombination suppression between these chromosomes. In the following, we discuss these issues, as well as our approach to develop microsatellite markers in a non-model organism.</p>
<sec>
<st>
<p>Differentiation of stickleback sex chromosomes</p>
</st>
<p>Our results indicate that 13 markers (Ppsm2-14) are linked to each other, and are associated with phenotypic sex in nine-spined sticklebacks. These indications were more robust in a population with low genetic diversity (Py&#246;re&#228;lampi) than in one with high genetic diversity (Baltic Sea). Indeed, all males of Py&#246;re&#228;lampi possessed one particular male-specific allele for each of the 13 loci. Given the male heterogametic inheritance of this species <abbrgrp>
<abbr bid="B28">28</abbr>
</abbrgrp>, these alleles should be located on the Y chromosome. Accordingly, only one Y chromosome haplotype was identified in this population. In contrast, three out of the 13 loci did not exhibit an association with phenotypic sex in the Baltic Sea population. Since these three loci were highly polymorphic, this could be due to their high mutation rates. Even in this highly variable population, the male-specific allele was monomorphic at seven loci. However, polymorphisms were detected in the remaining alleles, which are putatively located on the X chromosome. The different level of polymorphism between the sex chromosomes is explainable by the fact that the effective population size of the Y chromosome is one-third of that of the X chromosome <abbrgrp>
<abbr bid="B29">29</abbr>
</abbrgrp>. In general, our results indicate that sex chromosomes are highly differentiated throughout most of their length in nine-spined sticklebacks.</p>
<p>Based on karyotype analyses, the Y chromosome of nine-spined sticklebacks is characterized by a much larger size than the other chromosomes <abbrgrp>
<abbr bid="B10">10</abbr>
<abbr bid="B28">28</abbr>
</abbrgrp>. Because none of the autosomes or autosomal arms are missing, the additional segment observed in the Y chromosome is assumed to have originated from a tandem duplication of the ancient Y chromosome or a duplication of an autosomal segment followed by insertion into the Y chromosome <abbrgrp>
<abbr bid="B28">28</abbr>
</abbrgrp>. Although we examined allelic variation along the sex chromosomes with several markers - for which primers were developed in conserved sequences of divergent species - no loci showed the patterns of multilocus amplification which can be an indication of the Y chromosome duplication. Thus, an extra segment of the Y chromosome is more likely to be derived from a duplication of an autosome than that of the Y chromosome.</p>
<p>In three-spined sticklebacks, an allozyme of isocitrate dehydrogenase (<it>IDH</it>) has been found to be associated with phenotypic sex <abbrgrp>
<abbr bid="B30">30</abbr>
<abbr bid="B31">31</abbr>
</abbrgrp>. In accordance with this observation, a linkage mapping analysis showed that the sex determining region is located near the <it>IDH </it>gene of LG 19 <abbrgrp>
<abbr bid="B8">8</abbr>
</abbrgrp>. In our study, male-specific alleles, which should be located on the Y chromosome, were identified at five loci. Indeed, three of these loci were closely linked to the <it>IDH </it>gene (11.3 Mb). However, the remaining two loci were found in a chromosomal region (3.2-4.0 Mb) far from the <it>IDH </it>gene, implying that there is extensive differentiation. In addition, male-specific null alleles were identified at several loci located in two different chromosomal regions. This lack of heterozygous males suggests that amplification of Y chromosomal alleles is absent at these loci. This could be due to complete deletion of the microsatellite loci or polymorphisms in the primer binding sites of these loci in the Y chromosome. Overall, Y specific alleles and null alleles were identified over 16.4 Mb of a chromosomal region (3.2-19.6 Mb), which corresponds to 81% of the X chromosome. A large deletion of the Y chromosome was also suggested by a previous study using fluorescence <it>in situ </it>hybridization <abbrgrp>
<abbr bid="B26">26</abbr>
</abbrgrp>. Indeed, the deletion was assumed to be present in one of the regions where Y chromosomal null alleles were identified (i.e. 14.7-19.6 Mb). Other Y chromosomal null alleles were found in the region where multiple inversions appear to have occurred <abbrgrp>
<abbr bid="B26">26</abbr>
</abbrgrp>. It has also been demonstrated by sequence analysis that the Y chromosome exhibits substantial nucleotide divergence from the homologous region on the X chromosome mainly due to multiple insertions and deletions <abbrgrp>
<abbr bid="B8">8</abbr>
</abbrgrp>. Together with these studies, our results suggest that the Y chromosome is highly degenerate in three-spined sticklebacks. Since closely related stickleback species exhibit the rapid turnover of sex chromosomes and sex determination systems, their sex chromosomes are thought to be at the early stages of evolution, as is generally observed in lower vertebrates <abbrgrp>
<abbr bid="B8">8</abbr>
<abbr bid="B10">10</abbr>
</abbrgrp>. Our study uncovered high levels but distinct patterns of sex chromosome differentiation in closely related stickleback species, which diverged about 13 million years ago <abbrgrp>
<abbr bid="B32">32</abbr>
</abbrgrp>. In contrast to three-spined sticklebacks, we did not detect signatures of Y chromosome degeneration in the nine-spined stickleback despite the apparent sex chromosome heteromorphy in this species <abbrgrp>
<abbr bid="B28">28</abbr>
</abbrgrp>. Therefore, it is unlikely that the Y chromosome of the nine-spined stickleback has degenerated as much as that of the three-spined stickleback.</p>
<p>Sexually antagonistic selection is expected to facilitate the suppression of recombination between sex chromosomes, and thus assumed to be the primary driving force behind sex chromosome differentiation <abbrgrp>
<abbr bid="B14">14</abbr>
</abbrgrp>. Additionally, chromosome rearrangements, such as inversions, translocations and centric fusions involving an autosome and a sex chromosome, are known to reduce or suppress crossing over in the regions around the breakpoints in heterozygotes with the standard arrangement <abbrgrp>
<abbr bid="B14">14</abbr>
</abbrgrp>. Such rearrangements can create linkage between sexually antagonistic genes and sex chromosomes, and thereby can be favored by natural selection <abbrgrp>
<abbr bid="B14">14</abbr>
<abbr bid="B33">33</abbr>
</abbrgrp>. As such, the high genetic divergence between the sex chromosomes of nine-spined and three-spined sticklebacks could be a result of both sexually antagonistic selection and chromosome rearrangements. Further research needs to be focused on the role of sexually antagonistic selection in sex chromosome differentiation in these species. In addition, it should be interesting to investigate intraspecific variation of sex chromosome differentiation and rearrangements among genetically divergent populations.</p>
</sec>
<sec>
<st>
<p>Marker development for non-model organisms</p>
</st>
<p>To facilitate comparative genomic analyses, we devised a simple method for the development of microsatellite markers at target chromosomes and genomic regions using the sequenced genomes of other species. Our approach is similar to cross-species transfer of microsatellite markers, which can be performed without sequence information from a target species, but is different in the sense that conserved microsatellite flanking regions in divergent species are used as primer binding sites. Thus, it is possible to minimize amplification failures, which are a general concern in the cross-species utility of microsatellite markers <abbrgrp>
<abbr bid="B34">34</abbr>
</abbrgrp>. In fact, when primers are designed using three-spined stickleback sequences alone, amplification success in nine-spined sticklebacks is low (28.6%) <abbrgrp>
<abbr bid="B22">22</abbr>
</abbrgrp>. Moreover, our approach has an advantage over traditional cross-species amplification approaches because microsatellite markers can be developed for specific chromosomes and genomic regions based on the sequenced genome of other species. Furthermore, since primers are developed for conserved sequences in divergent species, these markers should be useful also in other stickleback species. Therefore, our approach for the development of microsatellite markers can facilitate comparative genomic analyses of stickleback species. In light of the rapidly increasing numbers of sequenced genomes and genomic resources, molecular tools for species lacking sequenced genomes can be developed using available genomic information of other species, as demonstrated in this study.</p>
</sec>
</sec>
<sec>
<st>
<p>Conclusions</p>
</st>
<p>To summarize, we uncovered high levels of sex chromosome differentiation in two stickleback species, suggesting that sex chromosomes have rapidly differentiated from each other. Our results further imply that the Y chromosome is highly degenerate in three-spined sticklebacks, but not in nine-spined sticklebacks. In general, our study demonstrates that microsatellites can be useful in identifying the degree and patterns of sex chromosome differentiation. Further comparative genomic analyses within and between stickleback species - possibly with the aid of the approach for the development of molecular markers described in this study - should facilitate our understanding of the evolutionary mechanisms underlying sex chromosome differentiation.</p>
</sec>
<sec>
<st>
<p>Methods</p>
</st>
<sec>
<st>
<p>Fish samples</p>
</st>
<p>Mature nine-spined sticklebacks were collected from the Baltic Sea (60&#176;12' N, 25&#176;11' E) and from Py&#246;re&#228;lampi pond (66&#176;16' N, 29&#176;26' E) in 2008. These populations were selected to cover different levels of genetic diversity (average heterozygosity at 12 microsatellite loci, <it>H</it>
<sub>E </sub>= 0.590 in Baltic Sea and <it>H</it>
<sub>E </sub>= 0.004 in Py&#246;re&#228;lampi) <abbrgrp>
<abbr bid="B35">35</abbr>
</abbrgrp>, which can influence the identification of sex chromosome differentiation using microsatellite markers. Three-spined sticklebacks were sampled from the Baltic Sea (60&#176;12' N, 25&#176;11' E) in 2008. Phenotypic sex was determined by examining gonads after the fish had been anesthetised with an overdose of MS-222 (tricane methanesulphonate). All procedures were performed under license from the Animal Experiment Board in Finland (ELLA; STH379A).</p>
</sec>
<sec>
<st>
<p>Microsatellite primer development</p>
</st>
<p>Using the three-spined stickleback genome <abbrgrp>
<abbr bid="B36">36</abbr>
</abbrgrp>, microsatellites were surveyed in regions randomly chosen over a wide range of LG 12 (Table <tblr tid="T1">1</tblr>), which corresponds to the sex chromosomes in nine-spined sticklebacks <abbrgrp>
<abbr bid="B10">10</abbr>
<abbr bid="B27">27</abbr>
</abbrgrp>. To design primers for nine-spined sticklebacks, conserved regions were searched in microsatellite flanking regions by aligning sequences of the three-spined stickleback and medaka <abbrgrp>
<abbr bid="B37">37</abbr>
</abbrgrp>. Based on the location of microsatellites and conserved regions, primer sequences were designed manually, targeting appropriate melting temperature and GC content (Table <tblr tid="T1">1</tblr>). In addition to LG 12, some primers were developed for other linkage groups to verify variability of marker loci on sex chromosomes and autosomes (Table <tblr tid="T1">1</tblr>). For three-spined sticklebacks, 14 microsatellites covering a wide range of the sex chromosomes of this species (LG 19) were selected based on the sequenced genome <abbrgrp>
<abbr bid="B36">36</abbr>
</abbrgrp> (Additional file <supplr sid="S4">4</supplr>). Of these, nine markers were previously reported <abbrgrp>
<abbr bid="B38">38</abbr>
<abbr bid="B39">39</abbr>
</abbrgrp>, and new primers were developed for the remaining five loci with the genome sequences using WebSat <abbrgrp>
<abbr bid="B40">40</abbr>
</abbrgrp>. Since the genome sequences were obtained from a female specimen <abbrgrp>
<abbr bid="B25">25</abbr>
</abbrgrp>, the novel primers were assumed to be designed based on the X chromosome sequences. All novel microsatellite primers were deposited in the National Center for Biotechnology Information (NCBI) Probe Database [PUIDs: 10552794-10552816, 10701232-10701236].</p>
</sec>
<sec>
<st>
<p>Microsatellite genotyping</p>
</st>
<p>Total DNA was extracted from fin clips using a silica-fine based purification <abbrgrp>
<abbr bid="B41">41</abbr>
</abbrgrp> following proteinase K digestion. Each forward primer was labelled with a fluorescent dye (FAM, HEX or TET), and the 5'-end of each reverse primer was modified with a GTTT-tail <abbrgrp>
<abbr bid="B42">42</abbr>
</abbrgrp>. For efficient screening, PCRs were conducted using the Qiagen Multiplex PCR Kit (Qiagen) in 10 &#956;l reaction volumes containing 1&#215; Multiplex PCR Master Mix, 0.5&#215; Q-Solution, 2 pmol of each primer and 10-20 ng of template DNA. The reactions were performed by the following cycle: an initial activation step at 95&#176;C for 15 min, followed by 30 s at 94&#176;C, 90 s at 53&#176;C and 60 s at 72&#176;C for 30 cycles with a final extension at 60&#176;C for 5 min. PCR products were visualized with a MegaBACE 1000 automated sequencer (Amersham Biosciences) and their sizes were determined with ET-ROX 550 size standard (Amersham Biosciences). Polymorphism was initially screened using 24 individuals (12 females and 12 males) of nine-spined or three-spined sticklebacks from the Baltic Sea. For the identified polymorphic loci, a total of 48 individuals (24 females and 24 males for nine-spined sticklebacks and 25 females and 23 males for three-spined sticklebacks) were genotyped in each population. Alleles were scored using Fragment Profiler 1.2 (Amersham Biosciences) with visual inspection and manual corrections of alleles.</p>
</sec>
<sec>
<st>
<p>Data analyses</p>
</st>
<p>Locus specific heterozygosity and <it>F</it>
<sub>IS </sub>were calculated using FSTAT 2.9.3 <abbrgrp>
<abbr bid="B43">43</abbr>
</abbrgrp>. The significance of <it>F</it>
<sub>IS </sub>was assessed by 10 000 permutations. For marker loci located on sex chromosomes, <it>F</it>
<sub>IS </sub>is expected to be lower in heterogametic males than in homogametic females if alleles are not shared between the sex chromosomes. Linkage disequilibrium was tested between pairs of loci in each population. An association between phenotypic sex and alleles at marker loci was investigated using the trend test <abbrgrp>
<abbr bid="B44">44</abbr>
<abbr bid="B45">45</abbr>
</abbrgrp> as implemented in PowerMarker 3.25 <abbrgrp>
<abbr bid="B46">46</abbr>
</abbrgrp>. To identify Y chromosome specific alleles, genotypic frequencies and allele distributions were compared between males and females. In addition, to evaluate genetic differentiation between sex chromosomes, <it>F</it>
<sub>ST </sub>was estimated between females and males using the method of Weir and Cockerham <abbrgrp>
<abbr bid="B47">47</abbr>
</abbrgrp> as implemented in GENEPOP 4.0 <abbrgrp>
<abbr bid="B48">48</abbr>
</abbrgrp>. Statistical significance of <it>F</it>
<sub>ST </sub>values was determined using 10 000 permutations. In three-spined sticklebacks, some polymorphic loci appeared to be homozygous in all males (see Results). For these loci, the presence of sex-specific null alleles was tested using MICRO-CHECKER <abbrgrp>
<abbr bid="B49">49</abbr>
</abbrgrp>. Since a large proportion of microsatellites are conserved between three-spined and nine-spined sticklebacks <abbrgrp>
<abbr bid="B22">22</abbr>
<abbr bid="B27">27</abbr>
</abbrgrp>, microsatellite locations on LG 12 in nine-spined sticklebacks were estimated based on the three-spined stickleback genome. Based on the fact that the orientation of supercontig 3 of LG 19 in Ensembl is inverted as compared to the genetic map <abbrgrp>
<abbr bid="B26">26</abbr>
</abbrgrp>, marker locations on LG 19 were determined by reversing the sequence of this supercontig according to Ross and Peichel <abbrgrp>
<abbr bid="B26">26</abbr>
</abbrgrp> (Additional file <supplr sid="S4">4</supplr>). Sequential Bonferroni corrections <abbrgrp>
<abbr bid="B50">50</abbr>
</abbrgrp> were applied for all multiple comparisons to minimize type I errors.</p>
</sec>
</sec>
<sec>
<st>
<p>Authors' contributions</p>
</st>
<p>TS conceived of the study, performed the molecular work, conducted the data analyses and wrote the manuscript. HMN participated in the molecular work. YS collected the fish samples and assisted with the laboratory work. JM contributed to writing the manuscript. All authors read and approved the final manuscript.</p>
</sec>
</bdy><bm>
<ack>
<sec>
<st>
<p>Acknowledgements</p>
</st>
<p>We thank Abigel Gonda, John Loehr and people at the Oulanka Research Station, for help in obtaining samples. Thanks are also due to Chikako Matsuba for comments on an earlier version of this manuscript and Jacquelin DeFaveri for proofreading. Our study was supported by the Academy of Finland (JM, TS) and the Japan Society for the Promotion of Science (TS, YS).</p>
</sec>
</ack>
<refgrp><bibl id="B1"><title><p>Relationships between vertebrate ZW and XY sex chromosome systems</p></title><aug><au><snm>Ezaz</snm><fnm>T</fnm></au><au><snm>Stiglec</snm><fnm>R</fnm></au><au><snm>Veyrunes</snm><fnm>F</fnm></au><au><snm>Graves</snm><fnm>JAM</fnm></au></aug><source>Curr Biol</source><pubdate>2006</pubdate><volume>16</volume><fpage>R736</fpage><lpage>R743</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.cub.2006.08.021</pubid><pubid idtype="pmpid" link="fulltext">16950100</pubid></pubidlist></xrefbib></bibl><bibl id="B2"><title><p>The birds and the bees and the flowers and the trees: Lessons from genetic mapping of sex determination in plants and animals</p></title><aug><au><snm>Charlesworth</snm><fnm>D</fnm></au><au><snm>Mank</snm><fnm>JE</fnm></au></aug><source>Genetics</source><pubdate>2010</pubdate><volume>186</volume><fpage>9</fpage><lpage>31</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1534/genetics.110.117697</pubid><pubid idtype="pmcid">2940314</pubid><pubid idtype="pmpid" link="fulltext">20855574</pubid></pubidlist></xrefbib></bibl><bibl id="B3"><title><p>Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes</p></title><aug><au><snm>Veyrunes</snm><fnm>F</fnm></au><au><snm>Waters</snm><fnm>PD</fnm></au><au><snm>Miethke</snm><fnm>P</fnm></au><au><snm>Rens</snm><fnm>W</fnm></au><au><snm>McMillan</snm><fnm>D</fnm></au><au><snm>Alsop</snm><fnm>AE</fnm></au><au><snm>Gr&#252;tzner</snm><fnm>F</fnm></au><au><snm>Deakin</snm><fnm>JE</fnm></au><au><snm>Whittington</snm><fnm>CM</fnm></au><au><snm>Schatzkamer</snm><fnm>K</fnm></au><au><snm>Kremitzki</snm><fnm>CL</fnm></au><au><snm>Graves</snm><fnm>T</fnm></au><au><snm>Ferguson-Smith</snm><fnm>MA</fnm></au><au><snm>Warren</snm><fnm>W</fnm></au><au><snm>Marshall Graves</snm><fnm>JA</fnm></au></aug><source>Genome Res</source><pubdate>2008</pubdate><volume>18</volume><fpage>965</fpage><lpage>973</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1101/gr.7101908</pubid><pubid idtype="pmcid">2413164</pubid><pubid idtype="pmpid" link="fulltext">18463302</pubid></pubidlist></xrefbib></bibl><bibl id="B4"><title><p>Evolution of alternative sex-determining mechanisms in teleost fishes</p></title><aug><au><snm>Mank</snm><fnm>JE</fnm></au><au><snm>Promislow</snm><fnm>DEL</fnm></au><au><snm>Avise</snm><fnm>JC</fnm></au></aug><source>Biol J Linn Soc</source><pubdate>2006</pubdate><volume>87</volume><fpage>83</fpage><lpage>93</lpage><xrefbib><pubid idtype="doi">10.1111/j.1095-8312.2006.00558.x</pubid></xrefbib></bibl><bibl id="B5"><title><p>Governing sex determination in fish: regulatory putsches and ephemeral dictators</p></title><aug><au><snm>Volff</snm><fnm>JN</fnm></au><au><snm>Nanda</snm><fnm>I</fnm></au><au><snm>Schmid</snm><fnm>M</fnm></au><au><snm>Shartl</snm><fnm>M</fnm></au></aug><source>Sex Dev</source><pubdate>2007</pubdate><volume>2007</volume><fpage>85</fpage><lpage>99</lpage></bibl><bibl id="B6"><title><p>Genomic analyses of sex chromosome evolution</p></title><aug><au><snm>Wilson</snm><fnm>MA</fnm></au><au><snm>Makova</snm><fnm>KD</fnm></au></aug><source>Annu Rev Genomics Hum Genet</source><pubdate>2009</pubdate><volume>10</volume><fpage>333</fpage><lpage>354</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1146/annurev-genom-082908-150105</pubid><pubid idtype="pmpid" link="fulltext">19630566</pubid></pubidlist></xrefbib></bibl><bibl id="B7"><title><p>Evolutionary origin of the medaka Y chromosome</p></title><aug><au><snm>Kondo</snm><fnm>M</fnm></au><au><snm>Nanda</snm><fnm>I</fnm></au><au><snm>Hornung</snm><fnm>U</fnm></au><au><snm>Schmid</snm><fnm>M</fnm></au><au><snm>Schartl</snm><fnm>M</fnm></au></aug><source>Curr Biol</source><pubdate>2004</pubdate><volume>14</volume><fpage>1664</fpage><lpage>1669</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.cub.2004.09.026</pubid><pubid idtype="pmpid" link="fulltext">15380069</pubid></pubidlist></xrefbib></bibl><bibl id="B8"><title><p>The master sex-determination locus in threespine sticklebacks is on a nascent y chromosome</p></title><aug><au><snm>Peichel</snm><fnm>CL</fnm></au><au><snm>Ross</snm><fnm>JA</fnm></au><au><snm>Matson</snm><fnm>CK</fnm></au><au><snm>Dickson</snm><fnm>M</fnm></au><au><snm>Grimwood</snm><fnm>J</fnm></au><au><snm>Schmutz</snm><fnm>J</fnm></au><au><snm>Myers</snm><fnm>RM</fnm></au><au><snm>Mori</snm><fnm>S</fnm></au><au><snm>Schluter</snm><fnm>D</fnm></au><au><snm>Kingsley</snm><fnm>DM</fnm></au></aug><source>Curr Biol</source><pubdate>2004</pubdate><volume>14</volume><fpage>1416</fpage><lpage>1424</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.cub.2004.08.030</pubid><pubid idtype="pmpid" link="fulltext">15324658</pubid></pubidlist></xrefbib></bibl><bibl id="B9"><title><p>Evidence for different origins of sex chromosomes in closely related Oryzias fishes: substitution of the master sex-determining gene</p></title><aug><au><snm>Tanaka</snm><fnm>K</fnm></au><au><snm>Takehana</snm><fnm>Y</fnm></au><au><snm>Naruse</snm><fnm>K</fnm></au><au><snm>Hamaguchi</snm><fnm>S</fnm></au><au><snm>Sakaizumi</snm><fnm>M</fnm></au></aug><source>Genetics</source><pubdate>2007</pubdate><volume>177</volume><fpage>2075</fpage><lpage>2081</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1534/genetics.107.075598</pubid><pubid idtype="pmcid">2219477</pubid><pubid idtype="pmpid" link="fulltext">17947439</pubid></pubidlist></xrefbib></bibl><bibl id="B10"><title><p>Turnover of sex chromosomes in the stickleback fishes (Gasterosteidae)</p></title><aug><au><snm>Ross</snm><fnm>JA</fnm></au><au><snm>Urton</snm><fnm>JR</fnm></au><au><snm>Boland</snm><fnm>J</fnm></au><au><snm>Shapiro</snm><fnm>MD</fnm></au><au><snm>Peichel</snm><fnm>CL</fnm></au></aug><source>PLoS Genet</source><pubdate>2009</pubdate><volume>5</volume><fpage>e1000391</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1371/journal.pgen.1000391</pubid><pubid idtype="pmcid">2638011</pubid><pubid idtype="pmpid" link="fulltext">19229325</pubid></pubidlist></xrefbib></bibl><bibl id="B11"><title><p>Genetics of sex determination in tilapiine species</p></title><aug><au><snm>Cnaani</snm><fnm>A</fnm></au><au><snm>Lee</snm><fnm>B-Y</fnm></au><au><snm>Zilberman</snm><fnm>N</fnm></au><au><snm>Ozouf-Costaz</snm><fnm>C</fnm></au><au><snm>Hulata</snm><fnm>G</fnm></au><au><snm>Ron</snm><fnm>M</fnm></au><au><snm>D&apos;Hont</snm><fnm>A</fnm></au><au><snm>Baroiller</snm><fnm>J-F</fnm></au><au><snm>D&apos;Cotta</snm><fnm>H</fnm></au><au><snm>Penman</snm><fnm>DJ</fnm></au><au><snm>Tomasino</snm><fnm>E</fnm></au><au><snm>Coutanceau</snm><fnm>J-P</fnm></au><au><snm>Pepey</snm><fnm>E</fnm></au><au><snm>Shirak</snm><fnm>A</fnm></au><au><snm>Kocher</snm><fnm>TD</fnm></au></aug><source>Sex Dev</source><pubdate>2008</pubdate><volume>2</volume><fpage>43</fpage><lpage>54</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1159/000117718</pubid><pubid idtype="pmpid" link="fulltext">18418034</pubid></pubidlist></xrefbib></bibl><bibl id="B12"><title><p>An evolutionary witness: the frog <it>Rana rugosa </it>underwent change of heterogametic sex from XY male to ZW female</p></title><aug><au><snm>Miura</snm><fnm>I</fnm></au></aug><source>Sex Dev</source><pubdate>2007</pubdate><volume>1</volume><fpage>323</fpage><lpage>331</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1159/000111764</pubid><pubid idtype="pmpid" link="fulltext">18391544</pubid></pubidlist></xrefbib></bibl><bibl id="B13"><title><p>Sex chromosome evolution in non-mammalian vertebrates</p></title><aug><au><snm>Schartl</snm><fnm>M</fnm></au></aug><source>Curr Opin Genet Dev</source><pubdate>2004</pubdate><volume>14</volume><fpage>634</fpage><lpage>641</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.gde.2004.09.005</pubid><pubid idtype="pmpid" link="fulltext">15531158</pubid></pubidlist></xrefbib></bibl><bibl id="B14"><title><p>Steps in the evolution of heteromorphic sex chromosomes</p></title><aug><au><snm>Charlesworth</snm><fnm>D</fnm></au><au><snm>Charlesworth</snm><fnm>B</fnm></au><au><snm>Marais</snm><fnm>G</fnm></au></aug><source>Heredity</source><pubdate>2005</pubdate><volume>95</volume><fpage>118</fpage><lpage>128</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/sj.hdy.6800697</pubid><pubid idtype="pmpid" link="fulltext">15931241</pubid></pubidlist></xrefbib></bibl><bibl id="B15"><title><p>A dynamic view of sex chromosome evolution</p></title><aug><au><snm>Bachtrog</snm><fnm>A</fnm></au></aug><source>Curr Opin Genet Dev</source><pubdate>2006</pubdate><volume>16</volume><fpage>578</fpage><lpage>585</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.gde.2006.10.007</pubid><pubid idtype="pmpid" link="fulltext">17055249</pubid></pubidlist></xrefbib></bibl><bibl id="B16"><title><p>The degeneration of Y chromosomes</p></title><aug><au><snm>Charlesworth</snm><fnm>B</fnm></au><au><snm>Charlesworth</snm><fnm>D</fnm></au></aug><source>Phil Trans R Soc Lond B</source><pubdate>2000</pubdate><volume>355</volume><fpage>1563</fpage><lpage>1572</lpage><xrefbib><pubid idtype="doi">10.1098/rstb.2000.0717</pubid></xrefbib></bibl><bibl id="B17"><title><p>Genomics of sex chromosomes</p></title><aug><au><snm>Ming</snm><fnm>R</fnm></au><au><snm>Moore</snm><fnm>PH</fnm></au></aug><source>Curr Opin Plant Biol</source><pubdate>2007</pubdate><volume>10</volume><fpage>123</fpage><lpage>130</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.pbi.2007.01.013</pubid><pubid idtype="pmpid" link="fulltext">17300986</pubid></pubidlist></xrefbib></bibl><bibl id="B18"><title><p>Genetic absolute dating based on microsatellites and the origin of modern humans</p></title><aug><au><snm>Goldstein</snm><fnm>DB</fnm></au><au><snm>Ru&#237;z-Linares</snm><fnm>A</fnm></au><au><snm>Feldman</snm><fnm>M</fnm></au><au><snm>Cavalli-Sforza</snm><fnm>LL</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>1995</pubdate><volume>92</volume><fpage>6720</fpage><lpage>6727</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.92.15.6720</pubid><pubid idtype="pmcid">41400</pubid><pubid idtype="pmpid" link="fulltext">7624309</pubid></pubidlist></xrefbib></bibl><bibl id="B19"><title><p>Microsatellites are molecular clocks that support accurate inferences about history</p></title><aug><au><snm>Sun</snm><fnm>JX</fnm></au><au><snm>Mullikin</snm><fnm>JC</fnm></au><au><snm>Patterson</snm><fnm>N</fnm></au><au><snm>Reich</snm><fnm>DE</fnm></au></aug><source>Mol Biol Evol</source><pubdate>2009</pubdate><volume>26</volume><fpage>1017</fpage><lpage>1027</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1093/molbev/msp025</pubid><pubid idtype="pmcid">2734136</pubid><pubid idtype="pmpid" link="fulltext">19221007</pubid></pubidlist></xrefbib></bibl><bibl id="B20"><title><p>Microsatellite analysis indicates genetic differentiation of the neo-sex chromosomes in <it>Drosophila americana americana</it></p></title><aug><au><snm>Schl&#246;tterer</snm><fnm>C</fnm></au></aug><source>Heredity</source><pubdate>2000</pubdate><volume>85</volume><fpage>610</fpage><lpage>616</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1046/j.1365-2540.2000.00797.x</pubid><pubid idtype="pmpid">11240628</pubid></pubidlist></xrefbib></bibl><bibl id="B21"><title><p>Quantifying ascertainment bias and species-specific length differences in human and chimpanzee microsatellites using genome sequences</p></title><aug><au><snm>Vowles</snm><fnm>EJ</fnm></au><au><snm>Amos</snm><fnm>W</fnm></au></aug><source>Mol Biol Evol</source><pubdate>2006</pubdate><volume>23</volume><fpage>598</fpage><lpage>607</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">16301296</pubid></xrefbib></bibl><bibl id="B22"><title><p>Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (<it>Pungitius pungitius</it>)</p></title><aug><au><snm>Shikano</snm><fnm>T</fnm></au><au><snm>Ramadevi</snm><fnm>J</fnm></au><au><snm>Shimada</snm><fnm>Y</fnm></au><au><snm>Meril&#228;</snm><fnm>J</fnm></au></aug><source>BMC Genomics</source><pubdate>2010</pubdate><volume>11</volume><fpage>334</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2164-11-334</pubid><pubid idtype="pmcid">2891615</pubid><pubid idtype="pmpid" link="fulltext">20507571</pubid></pubidlist></xrefbib></bibl><bibl id="B23"><title><p>Introduction to the evolutionary biology of the threespine stickleback</p></title><aug><au><snm>Bell</snm><fnm>MA</fnm></au><au><snm>Foster</snm><fnm>SA</fnm></au></aug><source>The Evolutionary Biology of the Threespine Stickleback</source><publisher>Oxford: Oxford University Press</publisher><editor>Bell MA, Foster SA</editor><pubdate>1994</pubdate><fpage>1</fpage><lpage>27</lpage></bibl><bibl id="B24"><title><p>The biology of other sticklebacks</p></title><aug><au><snm>&#214;stlund-Nilsson</snm><fnm>S</fnm></au><au><snm>Mayer</snm><fnm>I</fnm></au></aug><source>Biology of the Three-Spined Stickleback</source><publisher>Boca Raton: CRC Press</publisher><editor>&#214;stlund-Nilsson S, Mayer I, Huntingford FA</editor><pubdate>2007</pubdate><fpage>353</fpage><lpage>372</lpage></bibl><bibl id="B25"><title><p>The molecular genetics of evolutionary change in sticklebacks</p></title><aug><au><snm>Kingsley</snm><fnm>DM</fnm></au><au><snm>Peichel</snm><fnm>CL</fnm></au></aug><source>Biology of the Three-Spine Stickleback</source><publisher>Boca Raton: CRC Press</publisher><editor>&#214;stlund-Nilsson S, Mayer I, Huntingford FA</editor><pubdate>2007</pubdate><fpage>41</fpage><lpage>81</lpage></bibl><bibl id="B26"><title><p>Molecular cytogenetic evidence of rearrangements on the Y chromosome of threespine stickleback fish</p></title><aug><au><snm>Ross</snm><fnm>JA</fnm></au><au><snm>Peichel</snm><fnm>CL</fnm></au></aug><source>Genetics</source><pubdate>2008</pubdate><volume>179</volume><fpage>2173</fpage><lpage>2182</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1534/genetics.108.088559</pubid><pubid idtype="pmcid">2516089</pubid><pubid idtype="pmpid" link="fulltext">18689886</pubid></pubidlist></xrefbib></bibl><bibl id="B27"><title><p>The genetic architecture of skeletal convergence and sex determination in ninespine sticklebacks</p></title><aug><au><snm>Shapiro</snm><fnm>MD</fnm></au><au><snm>Summers</snm><fnm>BR</fnm></au><au><snm>Balabhadra</snm><fnm>S</fnm></au><au><snm>Aldenhoven</snm><fnm>JT</fnm></au><au><snm>Miller</snm><fnm>AL</fnm></au><au><snm>Cunningham</snm><fnm>C</fnm></au><au><snm>Bell</snm><fnm>MA</fnm></au><au><snm>Kingsley</snm><fnm>DM</fnm></au></aug><source>Curr Biol</source><pubdate>2009</pubdate><volume>19</volume><fpage>1140</fpage><lpage>1145</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.cub.2009.05.029</pubid><pubid idtype="pmcid">2735127</pubid><pubid idtype="pmpid" link="fulltext">19500990</pubid></pubidlist></xrefbib></bibl><bibl id="B28"><title><p>Heteromorphic sex chromosomes in the ninespine stickleback <it>Pungitius pungitius</it></p></title><aug><au><snm>Ocalewicz</snm><fnm>K</fnm></au><au><snm>Fopp-Bayat</snm><fnm>D</fnm></au><au><snm>Woznicki</snm><fnm>P</fnm></au><au><snm>Jankun</snm><fnm>M</fnm></au></aug><source>J Fish Biol</source><pubdate>2008</pubdate><volume>73</volume><fpage>456</fpage><lpage>462</lpage><xrefbib><pubid idtype="doi">10.1111/j.1095-8649.2008.01902.x</pubid></xrefbib></bibl><bibl id="B29"><title><p>The human Y chromosome: an evolutionary marker comes of age</p></title><aug><au><snm>Jobling</snm><fnm>MA</fnm></au><au><snm>Tyler-Smith</snm><fnm>C</fnm></au></aug><source>Nat Rev Genet</source><pubdate>2003</pubdate><volume>4</volume><fpage>598</fpage><lpage>612</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">12897772</pubid></xrefbib></bibl><bibl id="B30"><title><p>Genetics of plate morphology in an unusual of threespine sticklebacks (<it>Gasterosteus aculeatus</it>)</p></title><aug><au><snm>Avise</snm><fnm>JC</fnm></au></aug><source>Genet Res</source><pubdate>1976</pubdate><volume>27</volume><fpage>33</fpage><lpage>46</lpage><xrefbib><pubid idtype="doi">10.1017/S0016672300016219</pubid></xrefbib></bibl><bibl id="B31"><title><p>Genetic variability in freshwater and anadromous sticklebacks (<it>Gasterosteus aculeatus</it>) of Southern British Columbia</p></title><aug><au><snm>Withler</snm><fnm>RE</fnm></au><au><snm>McPhail</snm><fnm>JD</fnm></au></aug><source>Can J Zool</source><pubdate>1985</pubdate><volume>63</volume><fpage>528</fpage><lpage>533</lpage><xrefbib><pubid idtype="doi">10.1139/z85-078</pubid></xrefbib></bibl><bibl id="B32"><title><p>The world's oldest fossil threespine stickleback fish</p></title><aug><au><snm>Bell</snm><fnm>MA</fnm></au><au><snm>Stewart</snm><fnm>JD</fnm></au><au><snm>Park</snm><fnm>PJ</fnm></au></aug><source>Copeia</source><pubdate>2009</pubdate><volume>2009</volume><fpage>256</fpage><lpage>265</lpage><xrefbib><pubid idtype="doi">10.1643/CG-08-059</pubid></xrefbib></bibl><bibl id="B33"><title><p>Sex differences in fitness and selection for centric fusions between sex-chromosomes and autosomes</p></title><aug><au><snm>Charlesworth</snm><fnm>D</fnm></au><au><snm>Charlesworth</snm><fnm>B</fnm></au></aug><source>Genet Res</source><pubdate>1980</pubdate><volume>35</volume><fpage>205</fpage><lpage>214</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1017/S0016672300014051</pubid><pubid idtype="pmpid">6930353</pubid></pubidlist></xrefbib></bibl><bibl id="B34"><title><p>Cross-species transfer of nuclear microsatellite markers: potential and limitations</p></title><aug><au><snm>Barbar&#225;</snm><fnm>T</fnm></au><au><snm>Palma-Silva</snm><fnm>C</fnm></au><au><snm>Paggi</snm><fnm>GM</fnm></au><au><snm>Bered</snm><fnm>F</fnm></au><au><snm>Fay</snm><fnm>MF</fnm></au><au><snm>Lexer</snm><fnm>C</fnm></au></aug><source>Mol Ecol</source><pubdate>2007</pubdate><volume>16</volume><fpage>3759</fpage><lpage>3767</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-294X.2007.03439.x</pubid><pubid idtype="pmpid" link="fulltext">17850543</pubid></pubidlist></xrefbib></bibl><bibl id="B35"><title><p>History vs. habitat type: explaining the genetic structure of European nine-spined stickleback (<it>Pungitius pungitius</it>) populations</p></title><aug><au><snm>Shikano</snm><fnm>T</fnm></au><au><snm>Shimada</snm><fnm>Y</fnm></au><au><snm>Herczeg</snm><fnm>G</fnm></au><au><snm>Meril&#228;</snm><fnm>J</fnm></au></aug><source>Mol Ecol</source><pubdate>2010</pubdate><volume>19</volume><fpage>1147</fpage><lpage>1161</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1365-294X.2010.04553.x</pubid><pubid idtype="pmpid" link="fulltext">20163545</pubid></pubidlist></xrefbib></bibl><bibl id="B36"><title><p>Ensembl Stickleback</p></title><url>http://www.ensembl.org/Gasterosteus_aculeatus/Info/Index</url></bibl><bibl id="B37"><title><p>Ensembl Medaka</p></title><url>http://www.ensembl.org/Oryzias_latipes/Info/Index</url></bibl><bibl id="B38"><title><p>The genetic architecture of divergence between threespine stickleback species</p></title><aug><au><snm>Peichel</snm><fnm>CL</fnm></au><au><snm>Nereng</snm><fnm>K</fnm></au><au><snm>Ohgi</snm><fnm>KA</fnm></au><au><snm>Cole</snm><fnm>BLE</fnm></au><au><snm>Colosimo</snm><fnm>PF</fnm></au><au><snm>Buerkle</snm><fnm>CA</fnm></au><au><snm>Schluter</snm><fnm>D</fnm></au><au><snm>Kingsley</snm><fnm>DM</fnm></au></aug><source>Nature</source><pubdate>2001</pubdate><volume>414</volume><fpage>901</fpage><lpage>905</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/414901a</pubid><pubid idtype="pmpid" link="fulltext">11780061</pubid></pubidlist></xrefbib></bibl><bibl id="B39"><title><p>A high incidence of selection on physiologically important genes in the three-spined stickleback, <it>Gasterosteus aculeatus</it></p></title><aug><au><snm>Shimada</snm><fnm>Y</fnm></au><au><snm>Shikano</snm><fnm>T</fnm></au><au><snm>Meril&#228;</snm><fnm>J</fnm></au></aug><source>Mol Biol Evol</source><pubdate>2011</pubdate><volume>28</volume><fpage>181</fpage><lpage>193</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1093/molbev/msq181</pubid><pubid idtype="pmpid" link="fulltext">20660084</pubid></pubidlist></xrefbib></bibl><bibl id="B40"><title><p>WebSat - A web software for microsatellite marker development</p></title><aug><au><snm>Martins</snm><fnm>WS</fnm></au><au><snm>Lucas</snm><fnm>DCS</fnm></au><au><snm>Neves</snm><fnm>KFS</fnm></au><au><snm>Bertioli</snm><fnm>DJ</fnm></au></aug><source>Bioinformation</source><pubdate>2009</pubdate><volume>3</volume><fpage>282</fpage><lpage>283</lpage><xrefbib><pubidlist><pubid idtype="pmcid">2646864</pubid><pubid idtype="pmpid">19255650</pubid></pubidlist></xrefbib></bibl><bibl id="B41"><title><p>An inexpensive and high-throughput procedure to extract and purify total genomic DNA for population studies</p></title><aug><au><snm>Elphinstone</snm><fnm>MS</fnm></au><au><snm>Hinten</snm><fnm>GN</fnm></au><au><snm>Anderson</snm><fnm>MJ</fnm></au><au><snm>Nock</snm><fnm>CJ</fnm></au></aug><source>Mol Ecol Notes</source><pubdate>2003</pubdate><volume>3</volume><fpage>317</fpage><lpage>320</lpage><xrefbib><pubid idtype="doi">10.1046/j.1471-8286.2003.00397.x</pubid></xrefbib></bibl><bibl id="B42"><title><p>Modulation of non-templated nucleotide addition by <it>Taq </it>DNA polymerase: primer modifications that facilitate genotyping</p></title><aug><au><snm>Brownstein</snm><fnm>MJ</fnm></au><au><snm>Carpten</snm><fnm>JD</fnm></au><au><snm>Smith</snm><fnm>JR</fnm></au></aug><source>BioTechniques</source><pubdate>1996</pubdate><volume>20</volume><fpage>1004</fpage><lpage>1010</lpage><xrefbib><pubid idtype="pmpid">8780871</pubid></xrefbib></bibl><bibl id="B43"><title><p>FSTAT (Version 1.2): a computer program to calculate F-statistics</p></title><aug><au><snm>Goudet</snm><fnm>J</fnm></au></aug><source>J Hered</source><pubdate>1995</pubdate><volume>86</volume><fpage>485</fpage><lpage>486</lpage></bibl><bibl id="B44"><title><p>Tests for linear trends in proportions and frequencies</p></title><aug><au><snm>Armitage</snm><fnm>P</fnm></au></aug><source>Biometrics</source><pubdate>1955</pubdate><volume>11</volume><fpage>375</fpage><lpage>386</lpage><xrefbib><pubid idtype="doi">10.2307/3001775</pubid></xrefbib></bibl><bibl id="B45"><title><p>Evaluation of candidate genes in case-control studies: a statistical method to account for related subjects</p></title><aug><au><snm>Slager</snm><fnm>SL</fnm></au><au><snm>Schaid</snm><fnm>DJ</fnm></au></aug><source>Am J Hum Genet</source><pubdate>2001</pubdate><volume>68</volume><fpage>1457</fpage><lpage>1462</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1086/320608</pubid><pubid idtype="pmcid">1226132</pubid><pubid idtype="pmpid" link="fulltext">11353403</pubid></pubidlist></xrefbib></bibl><bibl id="B46"><title><p>PowerMarker: an integrated analysis environment for genetic marker analysis</p></title><aug><au><snm>Liu</snm><fnm>K</fnm></au><au><snm>Muse</snm><fnm>SV</fnm></au></aug><source>Bioinformatics</source><pubdate>2005</pubdate><volume>21</volume><fpage>2128</fpage><lpage>2129</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1093/bioinformatics/bti282</pubid><pubid idtype="pmpid" link="fulltext">15705655</pubid></pubidlist></xrefbib></bibl><bibl id="B47"><title><p>Estimating <it>F</it>-statistics for the analysis of population structure</p></title><aug><au><snm>Weir</snm><fnm>BS</fnm></au><au><snm>Cockerham</snm><fnm>CC</fnm></au></aug><source>Evolution</source><pubdate>1984</pubdate><volume>38</volume><fpage>1358</fpage><lpage>1370</lpage><xrefbib><pubid idtype="doi">10.2307/2408641</pubid></xrefbib></bibl><bibl id="B48"><title><p>Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux</p></title><aug><au><snm>Rousset</snm><fnm>F</fnm></au></aug><source>Mol Ecol Resour</source><pubdate>2008</pubdate><volume>8</volume><fpage>103</fpage><lpage>106</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1111/j.1471-8286.2007.01931.x</pubid><pubid idtype="pmpid">21585727</pubid></pubidlist></xrefbib></bibl><bibl id="B49"><title><p>MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data</p></title><aug><au><snm>Van Oosterhout</snm><fnm>C</fnm></au><au><snm>Hutchinson</snm><fnm>WF</fnm></au><au><snm>Wills</snm><fnm>DP</fnm></au><au><snm>Shipley</snm><fnm>P</fnm></au></aug><source>Mol Ecol Notes</source><pubdate>2004</pubdate><volume>4</volume><fpage>535</fpage><lpage>538</lpage><xrefbib><pubid idtype="doi">10.1111/j.1471-8286.2004.00684.x</pubid></xrefbib></bibl><bibl id="B50"><title><p>Analyzing tables of statistical tests</p></title><aug><au><snm>Rice</snm><fnm>WR</fnm></au></aug><source>Evolution</source><pubdate>1989</pubdate><volume>43</volume><fpage>223</fpage><lpage>225</lpage><xrefbib><pubid idtype="doi">10.2307/2409177</pubid></xrefbib></bibl></refgrp>
</bm></art>