<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art><ui>1471-2164-12-338</ui><ji>1471-2164</ji><fm>
<dochead>Research article</dochead>
<bibl>
<title>
<p>
<it>RsaI </it>repetitive DNA in Buffalo <it>Bubalus bubalis </it>representing retrotransposons, conserved in bovids, are part of the functional genes</p>
</title>
<aug>
<au id="A1"><snm>Pathak</snm><fnm>Deepali</fnm><insr iid="I1"/><email>deepali@nii.ac.in</email></au>
<au ca="yes" id="A2"><snm>Ali</snm><fnm>Sher</fnm><insr iid="I1"/><email>alisher@nii.res.in</email></au>
</aug>
<insg>
<ins id="I1"><p>Molecular Genetics Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi -110 067, India</p></ins>
</insg>
<source>BMC Genomics</source>
<issn>1471-2164</issn>
<pubdate>2011</pubdate>
<volume>12</volume>
<issue>1</issue>
<fpage>338</fpage>
<url>http://www.biomedcentral.com/1471-2164/12/338</url>
<xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2164-12-338</pubid><pubid idtype="pmpid">21718551</pubid></pubidlist></xrefbib>
</bibl>
<history><rec><date><day>6</day><month>4</month><year>2011</year></date></rec><acc><date><day>1</day><month>7</month><year>2011</year></date></acc><pub><date><day>1</day><month>7</month><year>2011</year></date></pub></history>
<cpyrt><year>2011</year><collab>Pathak and Ali; licensee BioMed Central Ltd.</collab><note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note></cpyrt>
<abs>
<sec>
<st>
<p>Abstract</p>
</st>
<sec>
<st>
<p>Background</p>
</st>
<p>Repetitive sequences are the major components of the eukaryotic genomes. Association of these repeats with transcribing sequences and their regulation in buffalo <it>Bubalus bubalis </it>has remained largely unresolved.</p>
</sec>
<sec>
<st>
<p>Results</p>
</st>
<p>We cloned and sequenced <it>RsaI </it>repeat fragments pDp1, pDp2, pDp3, pDp4 of 1331, 651, 603 and 339 base pairs, respectively from the buffalo, <it>Bubalus bubalis</it>. Upon characterization, these fragments were found to represent retrotransposons and part of some functional genes. The resultant clones showed cross hybridization only with buffalo, cattle, goat and sheep genomic DNA. Real Time PCR, detected ~2 &#215; 10<sup>4 </sup>copies of pDp1, ~ 3000 copies of pDp2 and pDp3 and ~ 1000 of pDp4 in buffalo, cattle, goat and sheep genomes, respectively. <it>RsaI </it>repeats are transcriptionally active in somatic tissues and spermatozoa. Accordingly, pDp1 showed maximum expression in lung, pDp2 and pDp3 both in Kidney, and pDp4 in ovary. Fluorescence <it>in situ </it>hybridization showed repeats to be distributed all across the chromosomes.</p>
</sec>
<sec>
<st>
<p>Conclusions</p>
</st>
<p>The data suggest that <it>RsaI </it>repeats have been incorporated into the exonic regions of various transcribing genes, possibly contributing towards the architecture and evolution of the buffalo and related genomes. Prospects of our present work in the context of comparative and functional genomics are highlighted.</p>
</sec>
</sec>
</abs>
</fm><bdy>
<sec>
<st>
<p>Background</p>
</st>
<p>Different families of repetitive DNA contribute towards architectural organization of the mammalian genomes <abbrgrp>
<abbr bid="B1">1</abbr>
</abbrgrp>. They represent both, tandemly arranged and interspersed sequences <abbrgrp>
<abbr bid="B2">2</abbr>
</abbrgrp>. Based on their size and mode of propagation, Interspersed elements can be divided into two separate classes, the long terminal repeat (LTR) and non-LTR. The non LTR LINEs (long interspersed repeat elements) and SINEs (Short interspersed repeat elements) are widely distributed occupying a substantial fraction of the eukaryotic genomes. These elements replicate and proliferate themselves through a "copy and paste" mechanism called retrotransposition <abbrgrp>
<abbr bid="B3">3</abbr>
<abbr bid="B4">4</abbr>
</abbrgrp>. In this process, transcription of their genomic copies is followed by an RNA intermediate resulting cDNAs reintegration at a new location in the genome <abbrgrp>
<abbr bid="B5">5</abbr>
</abbrgrp>. Approximately, 100 LINE and SINE families have been reported to date in various eukaryotic genomes <abbrgrp>
<abbr bid="B6">6</abbr>
</abbrgrp>. In mammals, LINE, L1 repeats are dominant retrotransposons type both in the common ancestor and in extant species <abbrgrp>
<abbr bid="B7">7</abbr>
</abbrgrp>. In addition to L1, an element belonging to the retrotransposable element family of autonomous retrotransposons (RTE-1) has been reported in mammals <abbrgrp>
<abbr bid="B8">8</abbr>
</abbrgrp>. Few mammals have active non LTR LINE other than L1 that contribute significantly to repeat composition.</p>
<p>Species specific retrotransposons have been widely used as a tool for Phylogenetic analysis and population studies <abbrgrp>
<abbr bid="B9">9</abbr>
<abbr bid="B10">10</abbr>
</abbrgrp>. Many retrotransposons are inactive, found in the non-coding regions of the genome and are subjected only to the neutral evolution. Thus, rare new insertions have led to some form of advantageous or noteworthy phenotypic variations <abbrgrp>
<abbr bid="B11">11</abbr>
<abbr bid="B12">12</abbr>
<abbr bid="B13">13</abbr>
</abbrgrp>. These and other such discoveries have resulted in a shift from earlier thought of them being "parasite" to functional elements cultivated in the genome for their beneficial attributes.</p>
<p>Retrotransposons have gained novel functions, providing alternative splice sites and/or polyadenylation signals or modifying gene expression <abbrgrp>
<abbr bid="B14">14</abbr>
<abbr bid="B15">15</abbr>
<abbr bid="B16">16</abbr>
</abbrgrp>. These elements account for 46.5% of bovine genome <abbrgrp>
<abbr bid="B17">17</abbr>
</abbrgrp>. The bovine genome is very different in its repeat composition compared to other mammalian genomes. It has unusual composition of LINE RTE type Bov B and its associated SINE elements which together account for 25% of the bovine genome <abbrgrp>
<abbr bid="B17">17</abbr>
</abbrgrp>. The impact of the interspersed repeats on the genomes of human <abbrgrp>
<abbr bid="B18">18</abbr>
<abbr bid="B19">19</abbr>
<abbr bid="B20">20</abbr>
</abbrgrp>, dog <abbrgrp>
<abbr bid="B21">21</abbr>
<abbr bid="B22">22</abbr>
</abbrgrp>, cow <abbrgrp>
<abbr bid="B17">17</abbr>
<abbr bid="B23">23</abbr>
</abbrgrp>, mouse <abbrgrp>
<abbr bid="B24">24</abbr>
</abbrgrp> and opossum <abbrgrp>
<abbr bid="B25">25</abbr>
<abbr bid="B26">26</abbr>
</abbrgrp> has been studied. However fate of these interspersed elements and their association with mRNA transcriptomes in buffalo remains still unclear. Here, we report <it>RsaI </it>family repetitive DNA in the genome of water buffalo "<it>Bubalus bubalis</it>" and their copy number status. We also studied their expression in somatic tissues and spermatozoa. The repeat fraction pDp1, pDp2 and pDp3 were used for fluorescence <it>in situ </it>hybridization (FISH) with buffalo metaphase chromosomes. In addition, we isolated and sequenced <it>ACOT11 (</it>Acyl-coenzyme A thioesterase 11) gene harboring part of pDp1 repeat.</p>
</sec>
<sec>
<st>
<p>Results</p>
</st>
<sec>
<st>
<p>
<it>RsaI </it>enzyme digestion uncovers four repeat fractions</p>
</st>
<p>Digestion of buffalo genomic DNA with <it>RsaI </it>enzyme, besides minor ones, showed four prominent bands ranging from 1331 base pairs, pDp1; 651, pDp2; 603, pDp3; to 339; pDp4 (Figure <figr fid="F1">1</figr>). Approximately, 15-20 recombinant clones subjected to restriction digestion and slot blot hybridization screening yielded ten positive clones for each repeat. Five-six clones from each fragment were then sequenced. The accession numbers of the recombinant clones are given in the Additional File <supplr sid="S1">1</supplr>. All the four major repeat elements were AT rich but sequence-wise, were different from one another (Additional File <supplr sid="S2">2</supplr>). No inter-clonal variations were detected in these sequences. However, random repeats were present in the nucleotide sequences (Table <tblr tid="T1">1</tblr>). Repeat Masker programme revealed presence of LTR LINE, SINE elements within the four fragments (Table <tblr tid="T2">2</tblr>). Blast search for each clone showed 69-98% homology with genomic DNA/contigs and 68-93% with transcribing genes in the database (Additional File <supplr sid="S1">1</supplr>) mostly in UTRs (Additional File <supplr sid="S3">3</supplr>).</p>
<fig id="F1"><title><p>Figure 1</p></title><caption><p>Agarose gel showing restriction digestion of buffalo <it>Bubalus bubalis</it>, genomic DNA with <it>RsaI </it>enzyme</p></caption><text>
   <p><b>Agarose gel showing restriction digestion of buffalo <it>Bubalus bubalis</it>, genomic DNA with <it>RsaI </it>enzyme</b>. The four discernible bands 1331, 651, 603 and 339 bp are highlighted. Molecular weight marker is given on the left in base-pair (bp).</p>
</text><graphic file="1471-2164-12-338-1"/></fig>
<suppl id="S1">
<title>
<p>Additional file 1</p>
</title>
<text>
<p>
<b>Details of the Blast search</b>. Details of the Blast search of <it>RsaI </it>derived repeat sequences of water buffalo <it>Bubalus Bubalis</it>.</p>
</text>
<file name="1471-2164-12-338-S1.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S2">
<title>
<p>Additional file 2</p>
</title>
<text>
<p>
<b>Details of ClustalW alignment</b>. ClustalW alignment of buffalo derived <it>RsaI </it>element pDp1, pDp2, pDp3 and pDp4, showing each one as separate entity.</p>
</text>
<file name="1471-2164-12-338-S2.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<tbl id="T1"><title><p>Table 1</p></title><caption><p>Details of repeat clusters present in <it>RsaI </it>sequences identified by repeat finder <url>http://zlab.bu.edu/repfind/form.html</url></p></caption><tblbdy cols="4">
      <r>
         <c ca="center">
            <p>
               <b>S. No.</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Sequence ID</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Repeat cluster</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Location</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="4">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>1.</p>
         </c>
         <c ca="center">
            <p>pDp1</p>
         </c>
         <c ca="center">
            <p>CGTGAAC</p>
         </c>
         <c ca="center">
            <p>1026,1033</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>ATGTGAA</p>
         </c>
         <c ca="center">
            <p>485, 666, 721, 734</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>GTG</p>
         </c>
         <c ca="center">
            <p>23, 41, 69, 161, 190, 198, 487, 668, 723, 736, 746, 780, 786, 800, 817, 832, 838, 879, 988, 1027, 1034, 1200</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>GTGA</p>
         </c>
         <c ca="center">
            <p>163, 198, 487, 668, 723, 736, 786, 800, 817, 832, 988, 1027, 1034</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>GTGAA</p>
         </c>
         <c ca="center">
            <p>487, 668, 723, 736, 817, 832, 1027, 1034</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>TGTGAA</p>
         </c>
         <c ca="center">
            <p>486, 667, 722, 735, 831,</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>CGTGAA</p>
         </c>
         <c ca="center">
            <p>816, 1026, 1033,</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>GGATTTT</p>
         </c>
         <c ca="center">
            <p>140,147</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>2.</p>
         </c>
         <c ca="center">
            <p>pDp2</p>
         </c>
         <c ca="center">
            <p>AAACTATGG</p>
         </c>
         <c ca="center">
            <p>209, 375,592</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>AAACTAT</p>
         </c>
         <c ca="center">
            <p>209, 375, 468, 592</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>ATACATTTGT</p>
         </c>
         <c ca="center">
            <p>498, 538</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>3.</p>
         </c>
         <c ca="center">
            <p>pDp3</p>
         </c>
         <c ca="center">
            <p>AACATT</p>
         </c>
         <c ca="center">
            <p>469, 481, 488</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>TAT</p>
         </c>
         <c ca="center">
            <p>15, 123, 139, 446, 451, 454, 464, 474, 583</p>
         </c>
      </r>
   </tblbdy></tbl>
<tbl id="T2"><title><p>Table 2</p></title><caption><p>Genome-wide distribution of <it>RsaI </it>repeat fragments and their homologies with SINE and LINEs</p></caption><tblbdy cols="8">
      <r>
         <c ca="center">
            <p>
               <b>S.No.</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Sequence ID</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>GC level</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Type of Elements</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Subclass</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Position of repeat in sequence</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Length occupied (bp)</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Percentage of the sequence in the buffalo genome</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="8">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>1.</p>
         </c>
         <c ca="center">
            <p>pDp1</p>
         </c>
         <c ca="center">
            <p>35.46</p>
         </c>
         <c ca="center">
            <p>LINE2</p>
         </c>
         <c ca="center">
            <p>L2</p>
         </c>
         <c ca="center">
            <p>34-220</p>
         </c>
         <c ca="center">
            <p>501</p>
         </c>
         <c ca="center">
            <p>37.64</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>LINE1</p>
         </c>
         <c ca="center">
            <p>L1MEc</p>
         </c>
         <c ca="center">
            <p>222-722</p>
         </c>
         <c ca="center">
            <p>187</p>
         </c>
         <c ca="center">
            <p>14.05</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>RTE</p>
         </c>
         <c ca="center">
            <p>BovB</p>
         </c>
         <c ca="center">
            <p>730-785</p>
         </c>
         <c ca="center">
            <p>532</p>
         </c>
         <c ca="center">
            <p>39.97</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>BTLTR</p>
         </c>
         <c ca="center">
            <p>786-855</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>BovB</p>
         </c>
         <c ca="center">
            <p>856-1331</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>2.</p>
         </c>
         <c ca="center">
            <p>pDp2</p>
         </c>
         <c ca="center">
            <p>38.25</p>
         </c>
         <c ca="center">
            <p>LINE 1</p>
         </c>
         <c ca="center">
            <p>L1MC1s</p>
         </c>
         <c ca="center">
            <p>9-651</p>
         </c>
         <c ca="center">
            <p>643</p>
         </c>
         <c ca="center">
            <p>98.77</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>3.</p>
         </c>
         <c ca="center">
            <p>pDp3</p>
         </c>
         <c ca="center">
            <p>39.47</p>
         </c>
         <c ca="center">
            <p>LTR Elements (ERV_class I)</p>
         </c>
         <c ca="center">
            <p>MER67C</p>
         </c>
         <c ca="center">
            <p>7-212</p>
         </c>
         <c ca="center">
            <p>206</p>
         </c>
         <c ca="center">
            <p>34.16</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>4.</p>
         </c>
         <c ca="center">
            <p>pDp4</p>
         </c>
         <c ca="center">
            <p>30.68</p>
         </c>
         <c ca="center">
            <p>SINE</p>
         </c>
         <c ca="center">
            <p>BovB</p>
         </c>
         <c ca="center">
            <p>1-159</p>
         </c>
         <c ca="center">
            <p>44</p>
         </c>
         <c ca="center">
            <p>12.98</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>LINE (RTE)</p>
         </c>
         <c ca="center">
            <p>BovA</p>
         </c>
         <c ca="center">
            <p>160-203</p>
         </c>
         <c ca="center">
            <p>159</p>
         </c>
         <c ca="center">
            <p>46.90</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="5">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Low complexity</p>
         </c>
         <c ca="center">
            <p>AT rich</p>
         </c>
         <c ca="center">
            <p>245-310</p>
         </c>
         <c ca="center">
            <p>66</p>
         </c>
         <c ca="center">
            <p>19.47</p>
         </c>
      </r>
   </tblbdy></tbl>
<suppl id="S3">
<title>
<p>Additional file 3</p>
</title>
<text>
<p>
<b>ClustalW alignment with transcribing genes</b>. ClustalW alignment of buffalo <it>RsaI </it>pDp1, pDp2 and pDp4 sequences with <it>Bos taurus </it>transcribing genes (<b>A) </b>
<it>ACOT11 </it>
<b>(B) </b>
<it>VPS24 </it>and <b>(C) </b>
<it>SLCO1A2</it>. Sequences highlighted in yellow indicate UTR. <it>RsaI </it>sequences are marked in blue.</p>
</text>
<file name="1471-2164-12-338-S3.PDF">
   <p>Click here for file</p>
</file>
</suppl>
</sec>
<sec>
<st>
<p>Buffalo derived <it>RsaI </it>Open Reading Frame (ORFs) has amino acid similarity to LINE reverse transcriptase</p>
</st>
<p>Most striking feature of pDp1 sequence was the presence of 489 bp, +1 ORF (nucleotide position, 841-1329) (Figure <figr fid="F2">2B</figr>). BLASTP search with GenBank sequences using conceptual translation of this ORF (162aa) gave matches to putative reverse transcriptase's domain. This region corresponds to central position of the Reverse transcriptase ORF (Figures <figr fid="F2">2A</figr> and <figr fid="F3">3</figr>). Similarly, pDp2, 111 bp, +3 ORF (nucleotide position, 135-245, 65aa) and pDp4, 135 bp, +3 ORF (nucleotide position, 81-215, 44aa) showed homology to endonuclease reverse transcriptase (Figures <figr fid="F2">2B</figr> and <figr fid="F2">2C</figr>). These ORFs corresponded to central endonuclease reverse transcriptase of LINE1 ORF2 (Figure <figr fid="F3">3</figr>). pDp3 sequence,112 bp, +3 ORF (nucleotide position, 492-602, 37 aa) showed no similarity with endonuclease reverse transcriptase.</p>
<fig id="F2"><title><p>Figure 2</p></title><caption><p>Amino acid alignment of buffalo derived <it>RsaI </it>sequences showing positions of pDp1, 2 and 4 based on ORF search</p></caption><text>
   <p><b>Amino acid alignment of buffalo derived <it>RsaI </it>sequences showing positions of pDp1, 2 and 4 based on ORF search</b>. Panel <b>(A) </b>is a diagrammatic illustration showing 5'UTR, ORF1, Endonuclease, Reverse transcriptase and 3'UTS of LINE. Position of pDp1 (Blue), pDp2 and pDp4 (Red) within LINE are shown on top of the figure. The aligned sequences in the panel <b>(B) </b>shows region with homology to reverse transcriptase domain (Blue). Panel <b>(</b><b>C) </b>and (<b>D)</b>, shows region with homology to endonuclease domain (Red).</p>
</text><graphic file="1471-2164-12-338-2"/></fig>
<fig id="F3"><title><p>Figure 3</p></title><caption><p>PCR amplification of bovine genomic DNA using internal primers designed from the ORF of buffalo <it>RsaI </it>sequences</p></caption><text>
   <p><b>PCR amplification of bovine genomic DNA using internal primers designed from the ORF of buffalo <it>RsaI </it>sequences</b>. Schematic representation <b>(A) </b>shows PCR strategy used for amplification of ORF regions of <it>RsaI </it>sequences corresponding to 489, 141, 112 and 135 bp, respectively <b>(a-d)</b>. Panel <b>(B) </b>shows PCR amplification of <it>RsaI </it>ORF regions and &#946;-actin as control. The corresponding position of each PCR product is shown in Panel <b>(A)</b>. Sequence IDs are indicated on left, amplicons size on right and species are mentioned on top of the lanes.</p>
</text><graphic file="1471-2164-12-338-3"/></fig>
</sec>
<sec>
<st>
<p>
<it>RsaI </it>Repeat status among bovids</p>
</st>
<p>Independent cross hybridization of pDp1, pDp2, pDp3 and pDp4 with genomic DNA from different species (mentioned in methods section) under high stringent conditions showed signals only in bovids (Additional File <supplr sid="S4">4</supplr>). PCR conducted using region specific primers (Table <tblr tid="T3">3</tblr>) amplified bands in buffalo, cattle, goat and sheep genomic DNA (Figures <figr fid="F3">3A</figr> &amp; <figr fid="F3">3B</figr>). Southern hybridization of two representative <it>RsaI </it>sequence pDp1, and pDp2 showed same number of bands within the genomic DNA of bovids (Additional File <supplr sid="S5">5</supplr>). Prominent bands within the smear reflect identical size of the fragments dispersed throughout the bovid genomes. ClustalW alignment of 489 bp pDp1derived fragment with cattle (AF060172), goat (AF404302) and sheep (AC148038) showed high level of sequence conservation among the bovids (Additional File <supplr sid="S6">6</supplr>). Phylogenetically, with respect to all the four sequences, cattle and buffalo were found to be closer to each other (Additional File <supplr sid="S7">7</supplr>), constituting the same monophyletic group.</p>
<suppl id="S4">
<title>
<p>Additional file 4</p>
</title>
<text>
<p>
<b>Details of Cross-hybridization studies</b>. Cross-hybridization of <it>RsaI </it>recombinant clones with genomic DNA of different species. Signals were detected only in buffalo, cattle, goat and sheep as shown herein. PC denotes positive control (recombinant plasmids). IDs of the sequences used for hybridization are mentioned on the left.</p>
</text>
<file name="1471-2164-12-338-S4.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<tbl id="T3"><title><p>Table 3</p></title><caption><p>Details of the primers used for PCR amplification (A) Copy number and Relative expression studies by Real time PCR (B) in buffalo <it>Bubalus bubalis</it></p></caption><tblbdy cols="7">
      <r>
         <c ca="left">
            <p>
               <b>S.No.</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Primer/Sequence ID</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Forward</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Reverse</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Amplicon size (bp)</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Annealing Temp (&#176;C)</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Nucleotide position of the primers in the sequence</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>
               <b>(A) PCR Primers</b>
            </p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>1.</p>
         </c>
         <c ca="center">
            <p>pDp1</p>
         </c>
         <c ca="center">
            <p>TGCACTCAATATGCCAGAAAA</p>
         </c>
         <c ca="center">
            <p>TGAAAGCAGTCTGTTGTTCCA</p>
         </c>
         <c ca="center">
            <p>475</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>842-862</p>
            <p>1296-1316</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>2.</p>
         </c>
         <c ca="center">
            <p>pDp2</p>
         </c>
         <c ca="center">
            <p>TGCAGCAATCACAATCCTTG</p>
         </c>
         <c ca="center">
            <p>AACATCCTGGTTGCTTCCAA</p>
         </c>
         <c ca="center">
            <p>124</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>66-85</p>
            <p>170-189</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>3.</p>
         </c>
         <c ca="center">
            <p>pDp3</p>
         </c>
         <c ca="center">
            <p>TTGCACAGAATGAGCAGTGGT</p>
         </c>
         <c ca="center">
            <p>GGCATTAATACTGGGATCAGG</p>
         </c>
         <c ca="center">
            <p>101</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>492-512</p>
            <p>572-592</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>4.</p>
         </c>
         <c ca="center">
            <p>pDp4</p>
         </c>
         <c ca="center">
            <p>GGACAGAAATGGTATGGACCT</p>
         </c>
         <c ca="center">
            <p>TATATTGGAGAAGGCGATGGC</p>
         </c>
         <c ca="center">
            <p>108</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>95-115</p>
            <p>182-202</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>5.</p>
         </c>
         <c ca="center">
            <p>
               <it>BBACOT11</it>
               <b>(a)</b>
            </p>
         </c>
         <c ca="center">
            <p>GAGCCGGCTGTCAGAGTC</p>
         </c>
         <c ca="center">
            <p>AGCCAGACAACCTGGAATGT</p>
         </c>
         <c ca="center">
            <p>2504</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>34-51</p>
            <p>2518-2537</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>6.</p>
         </c>
         <c ca="center">
            <p>
               <it>BBACOT11</it>
               <b>(b)</b>
            </p>
         </c>
         <c ca="center">
            <p>TGAAGCTGAAGCCAACTGTG</p>
         </c>
         <c ca="center">
            <p>TCCTAAAAAGATCTTCATGACCA</p>
         </c>
         <c ca="center">
            <p>2018</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>575-592</p>
            <p>2570-2592</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>7.</p>
         </c>
         <c ca="center">
            <p>
               <it>BBACOT11g</it>
            </p>
         </c>
         <c ca="center">
            <p>AGTGAGGGGGTGTGCCCTGG</p>
         </c>
         <c ca="center">
            <p>TGGTCGCACCCTCCTCGGAG</p>
         </c>
         <c ca="center">
            <p>601</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>1-20</p>
            <p>582-601</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>8.</p>
         </c>
         <c ca="center">
            <p>
               <it>&#946;-Actin</it>
            </p>
         </c>
         <c ca="center">
            <p>CAGATCATGTTCGAGACCTTCAA</p>
         </c>
         <c ca="center">
            <p>GATGATCTTGATCTTCATTGTGCTG</p>
         </c>
         <c ca="center">
            <p>630</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>390-412</p>
            <p>995-1019</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>9.</p>
         </c>
         <c ca="center">
            <p>
               <it>CD45</it>
            </p>
         </c>
         <c ca="center">
            <p>GACATCGCAGTGTTTGTTGC</p>
         </c>
         <c ca="center">
            <p>GGAGGTTCACATTCCTCTCG</p>
         </c>
         <c ca="center">
            <p>239</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>46-65</p>
            <p>265-284</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>10</p>
         </c>
         <c ca="center">
            <p>
               <it>CDH1</it>
            </p>
         </c>
         <c ca="center">
            <p>TCTACAGCATCACTGGCCAACGAGCTG</p>
         </c>
         <c ca="center">
            <p>TGCTTGGACCATCAGGGTGTATGTGGG</p>
         </c>
         <c ca="center">
            <p>476</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>566-592</p>
            <p>1015-1041</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>
               <b>(B) Real Time PCR Primers</b>
            </p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>11.</p>
         </c>
         <c ca="center">
            <p>Dp1</p>
         </c>
         <c ca="center">
            <p>CCTGATGTTCAAGCTGGTTTTAGA</p>
         </c>
         <c ca="center">
            <p>CAGAGGATGTTGGCAATTTGATC</p>
         </c>
         <c ca="center">
            <p>65</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>1042-1065</p>
            <p>1084-1106</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>12.</p>
         </c>
         <c ca="center">
            <p>Dp2</p>
         </c>
         <c ca="center">
            <p>GCAGCAATCACAATCCTTGGA</p>
         </c>
         <c ca="center">
            <p>TGTAGGTTTCTGTGTGGGCATAA</p>
         </c>
         <c ca="center">
            <p>63</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>67-87</p>
            <p>107-129</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>13.</p>
         </c>
         <c ca="center">
            <p>Dp3</p>
         </c>
         <c ca="center">
            <p>CAAAGCAGTGCACAAGAATCAAT</p>
         </c>
         <c ca="center">
            <p>TGCCTTGCCCAACCTTTTTA</p>
         </c>
         <c ca="center">
            <p>63</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>318-340</p>
            <p>361-380</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>14.</p>
         </c>
         <c ca="center">
            <p>Dp4</p>
         </c>
         <c ca="center">
            <p>AAGACCAGGGATCTCTTCAAGAAA</p>
         </c>
         <c ca="center">
            <p>CGAGCTCATCTTTGCATGAAAT</p>
         </c>
         <c ca="center">
            <p>66</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>24-47</p>
            <p>68-89</p>
         </c>
      </r>
      <r>
         <c cspan="7">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="left">
            <p>15.</p>
         </c>
         <c ca="center">
            <p>
               <it>GAPDH</it>
            </p>
         </c>
         <c ca="center">
            <p>GCAAGTTCCACGGCACAGT</p>
         </c>
         <c ca="center">
            <p>GATGGTGATGGCCTTTCCAT</p>
         </c>
         <c ca="center">
            <p>68</p>
         </c>
         <c ca="center">
            <p>60</p>
         </c>
         <c ca="center">
            <p>227-245</p>
            <p>275-294</p>
         </c>
      </r>
   </tblbdy></tbl>
<suppl id="S5">
<title>
<p>Additional file 5</p>
</title>
<text>
<p>
<b>Details of Southern blot hybridization across bovids</b>. Representative blots showing distribution of pDp1 <b>(A) </b>and pDp2 <b>(B) </b>in buffalo, cattle, goat and sheep genome by Southern blot hybridization. Note discernible bands of 1331 and 652 bp in these species.</p>
</text>
<file name="1471-2164-12-338-S5.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S6">
<title>
<p>Additional file 6</p>
</title>
<text>
<p>
<b>Details of pDp1 alignment across the species</b>. ClustalW nucleotide alignment of buffalo pDp1, 489 bp ORF sequence, with cattle, goat and sheep sequences. Note the close sequence homology among the bovids.</p>
</text>
<file name="1471-2164-12-338-S6.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S7">
<title>
<p>Additional file 7</p>
</title>
<text>
<p>
<b>Phylogenetic analysis</b>. Phylogram based on percent identity of pDp1, pDp2, pDp3 and pDp4 <b>(A-D) </b>sequence in different species showing close relationship of buffalo with cattle.</p>
</text>
<file name="1471-2164-12-338-S7.PDF">
   <p>Click here for file</p>
</file>
</suppl>
</sec>
<sec>
<st>
<p>Differential expression of <it>RsaI </it>fragments in somatic tissue and spermatozoa of buffalo</p>
</st>
<p>RT-PCR analysis using internal primers of pDp1, pDp2, pDp3 and pDp4 (see Table <tblr tid="T3">3</tblr>) and cDNA from somatic tissues and spermatozoa of buffalo showed amplification of band across tissues and sperm confirming their transcriptional potentials (Additional File <supplr sid="S8">8</supplr>). Quantitative Real Time PCR analysis of these sequences showed differential expression of <it>RsaI </it>related transcripts across somatic tissues and spermatozoa (Figure <figr fid="F4">4</figr>). pDp1 showed highest expression in lung, pDp2 and pDp3 in Kidney and pDp4 in ovary. Summary of the relative expression (in folds) derived from 2<sup>-&#916;&#916;<it>Ct </it>
</sup>values obtained for various transcripts based on Real Time PCR are given in Table <tblr tid="T4">4</tblr>.</p>
<suppl id="S8">
<title>
<p>Additional file 8</p>
</title>
<text>
<p>
<b>Details of RT PCR</b>. RT-PCR analysis of <it>RsaI </it>repeat sequences using internal primers and cDNA from different somatic tissues and spermatozoa of buffalo, Sequence IDs are indicated on the left and tissues are mentioned on top of the lanes. <it>&#946;-actin </it>was used a positive control. M denotes 100 base pair marker.</p>
</text>
<file name="1471-2164-12-338-S8.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<fig id="F4"><title><p>Figure 4</p></title><caption><p>Bar diagram based on the Real Time PCR amplification plot showing relative expression of pDp1, pDp2, pDp3 and pDp4 sequence, in different somatic tissues and spermatozoa (A-D)</p></caption><text>
   <p><b>Bar diagram based on the Real Time PCR amplification plot showing relative expression of pDp1, pDp2, pDp3 and pDp4 sequence, in different somatic tissues and spermatozoa (A-D)</b>.</p>
</text><graphic file="1471-2164-12-338-4"/></fig>
<tbl id="T4"><title><p>Table 4</p></title><caption><p>Relative expression analysis of the representative <it>Rsa</it>I mRNA transcripts in different somatic tissues and spermatozoa of buffalo <it>Bubalus bubalis</it></p></caption><tblbdy cols="11">
      <r>
         <c ca="center">
            <p>
               <b>S.No.</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Transcript ID</b>
            </p>
         </c>
         <c cspan="9" ca="center">
            <p>
               <b>Relative Expression (in folds) 2<sup>-&#916;&#916;<it>Ct</it></sup></b>
            </p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="9">
            <hr/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>
               <b>Testis</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Ovary</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Spleen</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Liver</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Lung</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Kidney</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Heart</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Brain</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Sperm</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="11">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>1.</p>
         </c>
         <c ca="center">
            <p>pDp1</p>
         </c>
         <c ca="center">
            <p>14.25</p>
         </c>
         <c ca="center">
            <p>15.02</p>
         </c>
         <c ca="center">
            <p>16.11</p>
         </c>
         <c ca="center">
            <p>17.68</p>
         </c>
         <c ca="center">
            <p>30.49</p>
         </c>
         <c ca="center">
            <p>4.34</p>
         </c>
         <c ca="center">
            <p>
               <it>Cb</it>
            </p>
         </c>
         <c ca="center">
            <p>22.06</p>
         </c>
         <c ca="center">
            <p>28.62</p>
         </c>
      </r>
      <r>
         <c cspan="11">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>2.</p>
         </c>
         <c ca="center">
            <p>pDp2</p>
         </c>
         <c ca="center">
            <p>0.99</p>
         </c>
         <c ca="center">
            <p>2.77</p>
         </c>
         <c ca="center">
            <p>10.36</p>
         </c>
         <c ca="center">
            <p>7.88</p>
         </c>
         <c ca="center">
            <p>7.83</p>
         </c>
         <c ca="center">
            <p>10.29</p>
         </c>
         <c ca="center">
            <p>35.09</p>
         </c>
         <c ca="center">
            <p>1.84</p>
         </c>
         <c ca="center">
            <p>
               <it>Cb</it>
            </p>
         </c>
      </r>
      <r>
         <c cspan="11">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>3.</p>
         </c>
         <c ca="center">
            <p>pDp3</p>
         </c>
         <c ca="center">
            <p>1.50</p>
         </c>
         <c ca="center">
            <p>44.01</p>
         </c>
         <c ca="center">
            <p>10.30</p>
         </c>
         <c ca="center">
            <p>57.48</p>
         </c>
         <c ca="center">
            <p>18.37</p>
         </c>
         <c ca="center">
            <p>
               <it>Cb</it>
            </p>
         </c>
         <c ca="center">
            <p>5.20</p>
         </c>
         <c ca="center">
            <p>1.35</p>
         </c>
         <c ca="center">
            <p>6.56</p>
         </c>
      </r>
      <r>
         <c cspan="11">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>4.</p>
         </c>
         <c ca="center">
            <p>pDp4</p>
         </c>
         <c ca="center">
            <p>841.41</p>
         </c>
         <c ca="center">
            <p>1606.828</p>
         </c>
         <c ca="center">
            <p>107.75</p>
         </c>
         <c ca="center">
            <p>39.39</p>
         </c>
         <c ca="center">
            <p>59.71</p>
         </c>
         <c ca="center">
            <p>16.33</p>
         </c>
         <c ca="center">
            <p>
               <it>Cb</it>
            </p>
         </c>
         <c ca="center">
            <p>177.29</p>
         </c>
         <c ca="center">
            <p>404.50</p>
         </c>
      </r>
   </tblbdy><tblfn>
      <p><it>Cb</it>-calibrator</p>
   </tblfn></tbl>
</sec>
<sec>
<st>
<p>Multiple copies of <it>RsaI </it>fragments in bovids</p>
</st>
<p>The pair of internal primers deduced from pDp1-4 used for expression study was also employed for copy number analysis of these fragments in cattle buffalo, goat and sheep using Real Time PCR. Standard curve slope value was between 3.2-3.5. Single melting peak on dissociate curve confirmed primer specificity. pDp1 showed ~2 &#215; 10<sup>4 </sup>copies, pDp2 and pDp3, ~ 3000 copies each and pDp4 showed ~ 1000, in these species (Table <tblr tid="T5">5</tblr> and Additional File <supplr sid="S9">9</supplr>).</p>
<tbl id="T5"><title><p>Table 5</p></title><caption><p>Absolute quantification of pDp1, pDp2, pDp3 and pDp4 copy number in buffalo, cattle, goat and sheep genomes</p></caption><tblbdy cols="6">
      <r>
         <c ca="center">
            <p>
               <b>S. No.</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Sequence ID</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Species</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Ct</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Absolute quantity</b>
            </p>
         </c>
         <c ca="center">
            <p>
               <b>Copies perhaploid genome</b>
            </p>
         </c>
      </r>
      <r>
         <c cspan="6">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>1.</p>
         </c>
         <c ca="center">
            <p>pDp1</p>
         </c>
         <c ca="center">
            <p>Buffalo</p>
         </c>
         <c ca="center">
            <p>19. 89 &#177; 0.01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Cattle</p>
         </c>
         <c ca="center">
            <p>19.89 &#177; 0.01</p>
         </c>
         <c ca="center">
            <p>~ 6.0 &#215; 10<sup>5</sup></p>
         </c>
         <c ca="center">
            <p>~ 2 &#215; 10<sup>4</sup></p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Goat</p>
         </c>
         <c ca="center">
            <p>19.89 &#177; 0.01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Sheep</p>
         </c>
         <c ca="center">
            <p>19.85 &#177; .01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c cspan="6">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>2.</p>
         </c>
         <c ca="center">
            <p>pDp2</p>
         </c>
         <c ca="center">
            <p>Buffalo</p>
         </c>
         <c ca="center">
            <p>28.71 &#177; 0.01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Cattle</p>
         </c>
         <c ca="center">
            <p>28.71 &#177; .01</p>
         </c>
         <c ca="center">
            <p>~ 457 &#215; 10<sup>4</sup></p>
         </c>
         <c ca="center">
            <p>~ 3000</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Goat</p>
         </c>
         <c ca="center">
            <p>28.70 &#177; 0.01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Sheep</p>
         </c>
         <c ca="center">
            <p>28.69 &#177; 0.01</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c cspan="6">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>3.</p>
         </c>
         <c ca="center">
            <p>pDp3</p>
         </c>
         <c ca="center">
            <p>Buffalo</p>
         </c>
         <c ca="center">
            <p>30.30 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Cattle</p>
         </c>
         <c ca="center">
            <p>30.18 &#177; 0.02</p>
         </c>
         <c ca="center">
            <p>~ 448 &#215; 10<sup>4</sup></p>
         </c>
         <c ca="center">
            <p>~ 3000</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Goat</p>
         </c>
         <c ca="center">
            <p>30.18 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Sheep</p>
         </c>
         <c ca="center">
            <p>30.30 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c cspan="6">
            <hr/>
         </c>
      </r>
      <r>
         <c ca="center">
            <p>4.</p>
         </c>
         <c ca="center">
            <p>pDp4</p>
         </c>
         <c ca="center">
            <p>Buffalo</p>
         </c>
         <c ca="center">
            <p>32.09 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Cattle</p>
         </c>
         <c ca="center">
            <p>32.0 &#177; 0.02</p>
         </c>
         <c ca="center">
            <p>~ 308 &#215; 10<sup>3</sup></p>
         </c>
         <c ca="center">
            <p>~ 1000</p>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Goat</p>
         </c>
         <c ca="center">
            <p>32.09 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c cspan="2">
            <hr/>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
      <r>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
         <c ca="center">
            <p>Sheep</p>
         </c>
         <c ca="center">
            <p>32.06 &#177; 0.02</p>
         </c>
         <c>
            <p/>
         </c>
         <c>
            <p/>
         </c>
      </r>
   </tblbdy><tblfn>
      <p>Average &#177; standard deviation</p>
   </tblfn></tbl>
<suppl id="S9">
<title>
<p>Additional file 9</p>
</title>
<text>
<p>
<b>Details of copy number calculation with Real time PCR</b>. Standard curve based on 10 fold dilution series of pDp1, pDp2, pDp3, pDp4 and genomic DNA from buffalo, cattle, goat and sheep showing the amplification plot <b>(a-d) </b>panel <b>(A)</b>, corresponding slopes of -3.3 to -3.5, panel (<b>B) </b>and a single dissociation peak, panel <b>(C)</b>, substantiating maximum efficiency of the PCR reaction and high specificity of the primers with target DNA. Arrow indicates genomic DNA from buffalo, cattle, goat and sheep.</p>
</text>
<file name="1471-2164-12-338-S9.PDF">
   <p>Click here for file</p>
</file>
</suppl>
</sec>
<sec>
<st>
<p>pDp1, pDp2 and pDp3 sequences are dispersed throughout the buffalo genome</p>
</st>
<p>
<it>In silico </it>analysis of pDp1, pDp2, pDp3 and pDp4 sequences using reference cattle genome revealed its multiple locations on the cow chromosomes (Figure <figr fid="F5">5</figr>). Probing of pDp1 to buffalo genomic DNA digested with <it>RsaI </it>enzyme detected a strong hybridization signal (Additional File <supplr sid="S10">10</supplr>) giving rise to a single isomorphic band in all the samples. FISH mapping of pDp1, 2, 3 spectrum red labeled cloned probes showed ubiquitous discernible signals over buffalo metaphase chromosomes (Figures <figr fid="F6">6</figr> and <figr fid="F7">7</figr>). All the chromosomes showed dispersed pattern with all the three probes used independently. In several chromosomes, signals in the centromeric regions were absent or reduced giving rise to inconsistent pattern. FISH with pDp1 sequence showed more localized signals on the metaphase chromosomes as compared to that detected by pDp2 and pDp3. FISH with spectrum red labeled clone pDp4 probe showed background signals even after washing the slides under high stringent conditions (60&#176;C in 0.1&#215; SSC). This might be due to the short length (339 bp) of the probe pDp4 used coupled with its dispersed genomic organization.</p>
<fig id="F5"><title><p>Figure 5</p></title><caption><p><it>In silico </it>mapping of <it>RsaI </it>sequences, pDp1 (A), pDp2 (B) pDp3 (C) and pDp4 (D) using existing cattle genomic map data (cow build 4 genome database)</p></caption><text>
   <p><b><it>In silico </it>mapping of <it>RsaI </it>sequences, pDp1 (A), pDp2 (B) pDp3 (C) and pDp4 (D) using existing cattle genomic map data (cow build 4 genome database)</b>. Note presence of pDp1, pDp2 and pDp4 sequences at multiple locations on cattle chromosomes. Color bar having percent homology of <it>RsaI </it>sequences with cattle genome is shown on right side of the figure.</p>
</text><graphic file="1471-2164-12-338-5"/></fig>
<suppl id="S10">
<title>
<p>Additional file 10</p>
</title>
<text>
<p>
<b>Southern hybridization with pDp1 clone</b>. Southern hybridization of <it>Bubalus bubalis RsaI </it>digested genomic DNA with pDp1 clone <b>(A)</b>. The strongest isomorphic band corresponds to 1331 bp, indicated by an arrow <b>(B)</b>.</p>
</text>
<file name="1471-2164-12-338-S10.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<fig id="F6"><title><p>Figure 6</p></title><caption><p>Fluorescence <it>in situ </it>hybridization (FISH) of pDp1 (A) clone on buffalo metaphase chromosomes (a) and karyotype (b)</p></caption><text>
   <p><b>Fluorescence <it>in situ </it>hybridization (FISH) of pDp1 (A) clone on buffalo metaphase chromosomes (a) and karyotype (b)</b>. Note the dispersed signals over the metaphase chromosomes. Scale bar used is given below the figure.</p>
</text><graphic file="1471-2164-12-338-6"/></fig>
<fig id="F7"><title><p>Figure 7</p></title><caption><p>Fluorescence <it>in situ </it>hybridization (FISH) of pDp2 (A) and pDp3 (B) clones onto buffalo metaphase chromosomes</p></caption><text>
   <p><b>Fluorescence <it>in situ </it>hybridization (FISH) of pDp2 (A) and pDp3 (B) clones onto buffalo metaphase chromosomes</b>. Note the dispersed signals over the chromosome arms. Scale bar used is given below the figure.</p>
</text><graphic file="1471-2164-12-338-7"/></fig>
</sec>
<sec>
<st>
<p>Full length cDNA sequence of <it>ACOT11 </it>gene in Buffalo</p>
</st>
<p>Blast search using reference mRNA sequence revealed <it>RsaI </it>repeats to be part of Acyl-coenzyme A thioesterase 11(<it>ACOT11</it>), <it>V</it>acuolar Protein Sorting 24 (<it>VPS24</it>) and Solute carrier organic anion transporter family member 1A2 (<it>SLCO1A2</it>) genes (Additional File <supplr sid="S1">1</supplr>) Full length Buffalo <it>ACOT11 </it>cDNA was generated using end point PCR and gene specific (<it>B. taurus ACOT11</it>) primers (Table <tblr tid="T3">3</tblr>). Assembled cDNA sequence of 2592 base pair fragment lacking poly A tail representing six exons (Additional Files <supplr sid="S11">11</supplr> and <supplr sid="S12">12</supplr>) were deposited in the GenBank (<ext-link ext-link-id="HQ848649" ext-link-type="gen">HQ848649</ext-link> and <ext-link ext-link-id="HQ848650" ext-link-type="gen">HQ848650</ext-link>).</p>
<suppl id="S11">
<title>
<p>Additional file 11</p>
</title>
<text>
<p>
<b>Status of Exons in <it>ACOT11 </it>gene</b>. Pictorial representation showing <it>Bos taurus </it>
<b>(A) </b>and <it>Bubalus bubalis ACOT11 </it>gene <b>(B) </b>with their representative exons. Nucleotide position 730 to 1331 indicates region of pDp1 showing 92% homology to <it>Bos taurus ACOT11</it>. Full length sequence of <it>Bubalus bubalis ACOT11 </it>gene lacking poly A tail and exons are given in <b>(C)</b>.</p>
</text>
<file name="1471-2164-12-338-S11.PDF">
   <p>Click here for file</p>
</file>
</suppl>
<suppl id="S12">
<title>
<p>Additional file 12</p>
</title>
<text>
<p>
<b>ClustalW alignment of <it>ACOT11 </it>gene</b>. ClustalW alignment of buffalo <it>ACOT11 </it>gene with cattle (<ext-link ext-link-id="NM_001103275.1" ext-link-type="gen">NM_001103275.1</ext-link>). Note the high level of sequence homology (92%) between the two species.</p>
</text>
<file name="1471-2164-12-338-S12.PDF">
   <p>Click here for file</p>
</file>
</suppl>
</sec>
</sec>
<sec>
<st>
<p>Discussion</p>
</st>
<p>We have studied four (pDp1, pDp2, pDp3 and pDp4) <it>RsaI </it>fragments from the buffalo genome which are AT rich, though buffalo genome on the whole is GC rich (40.69%, NC_006295). Database searches with the repeat-maskers revealed the presence of several LTR, LINE and SINE element in the four sequences (Table <tblr tid="T2">2</tblr>). Apparently, SINEs occupy the (G+C)-rich regions while LINEs are mainly located on the (A+T)-rich regions. Reports suggest that very large number of highly truncated insertions of L1 have occurred in the bovine genome <abbrgrp>
<abbr bid="B8">8</abbr>
</abbrgrp>. Full length copies of the human L1 contain two open reading frames, ORF1 and 2. ORF1 encodes a DNA binding protein and ORF2 includes endonuclease and reverse transcriptase domains <abbrgrp>
<abbr bid="B27">27</abbr>
</abbrgrp>. Presence of partial reverse transcriptase and endonuclease domains in pDp1, pDp2 and pDp4 reported herein led to the hypothesis that <it>RsaI </it>repeats might be related to a novel retrotransposable element.</p>
<p>Interspersed repeats get inserted into a new genomic location through the process of retrotransposition <abbrgrp>
<abbr bid="B28">28</abbr>
<abbr bid="B29">29</abbr>
</abbrgrp>. This is reflected by our FISH results of pDp1, 2 and 3 showing signals on all over the chromosomes with varying intensity. <it>In silico </it>analysis of pDp3 on the reference cattle genome showed fewer distribution suggesting its poor characterization in the cattle genome. This is supported by the fact that using real time PCR, we detected similar copy number of pDp3 in the bovids. Repetitive sequences in centromeric regions are dynamic components, ever prone to mutation, recombination, deletion, and translocation leading eventually to their alterations <abbrgrp>
<abbr bid="B30">30</abbr>
</abbrgrp>. Absence of <it>RsaI </it>sequences in the centromere of several chromosomes may be undergoing such events. All the four sequences showed no homology with each other as revealed by clustalW alignment (Additional File <supplr sid="S2">2</supplr>). Startlingly, these four repeat elements were not detected in any of the non-bovid species. This suggests that irrespective of their origin and biological significance, their evolutions have been confined to limited number of species. Most likely, in non-bovid species, they were not favored evolutionarily and therefore purged slowly and gradually in due course of time. We presume that amplifications of repeat elements could have originated from its discrete blocks. Reintegration of extra chromosomal copies of these repeat elements <abbrgrp>
<abbr bid="B31">31</abbr>
</abbrgrp> could have allowed its further dissemination in the genome. However, it is not clear whether all the repeats have similar significance in the buffalo genome. It is likely that these repeats are collectively involved in the evolution and sustenance of bovid chromosomes. Reports suggest that new retrotransposons are conserved within the same group of species <abbrgrp>
<abbr bid="B32">32</abbr>
</abbrgrp>. This is corroborated by our Slot blot and PCR results. Real time PCR results showed approximately similar copy numbers for pDp1, 2, 3 and 4 in cattle, goat and sheep genomes as mentioned earlier. The copy number assessment of these repeats in different known and non-descript breeds of buffalo may enable to establish a correlation, if any, towards the delineation of different breeds.</p>
<p>Retrotransposons copies are reportedly involved in the regulation of transcription <abbrgrp>
<abbr bid="B33">33</abbr>
<abbr bid="B34">34</abbr>
<abbr bid="B35">35</abbr>
<abbr bid="B36">36</abbr>
</abbrgrp>. Presence of <it>RsaI </it>repeats in exonic database of various transcribing genes suggests that these sequences function as parts of mRNA. Since repeat sequences were also present in the introns, it is possible that they are transcribed as pre-mRNA and contribute to the processing of mRNA and splicing. Thus, differential expression of transcripts in somatic tissue and spermatozoa might be under the influence of post transcriptional regulation required for various cellular processes. Presence of transcribing retroelements within the buffalo spermatozoa reported here seems to be first such observation. Studies have shown existence of an RT-dependent mechanism operating in the spermatozoa, responsible for the genesis of new biologically active retrogenes <abbrgrp>
<abbr bid="B37">37</abbr>
</abbrgrp>. These retrogenes may be delivered to the embryos during fertilization and propagated subsequently in the tissues of adult individuals <abbrgrp>
<abbr bid="B37">37</abbr>
</abbrgrp>.</p>
<p>
<it>RsaI </it>elements were found to be part of the three functional genes <it>(ACOT11</it>, <it>VPS24 and SLCO1A2</it>) mostly present in 3' UTR. Our work corroborates recent reports that most part of retrotransposons inserts themselves in first and last exons and in untranslated regions (UTRs) <abbrgrp>
<abbr bid="B38">38</abbr>
</abbrgrp>. In human, this type of insertion has been shown to create new non-conserved polyadenylation signals <abbrgrp>
<abbr bid="B39">39</abbr>
</abbrgrp>, influencing the level of gene expression <abbrgrp>
<abbr bid="B40">40</abbr>
</abbrgrp>. However, how these insertions affect expression of buffalo transcriptomes is still a matter of speculation.</p>
</sec>
<sec>
<st>
<p>Conclusions</p>
</st>
<p>Buffalo has several known and non-descript breeds of which a few are considered to be superior with respect to productivity and economic return. Whether, <it>RsaI </it>repeat in different breeds of buffalo would show similar organization and expression pattern is not known. However, if informative in breed delineation, these would prove to be useful biomarkers.</p>
</sec>
<sec>
<st>
<p>Methods</p>
</st>
<sec>
<st>
<p>Species sample and DNA extraction</p>
</st>
<p>Approximately, 10 ml blood samples from both the sexes of buffalo, goat and sheep were collected from local slaughterhouse, Delhi following the guidelines of institute's Ethical and Biosafety Committee. Cattle blood sample was procured from the owner of the animal. Blood samples of human, fish, bird, rat, jungle cat, bonnet monkey, were available from other projects in the lab. Tiger, Indian rhinoceros and leopard samples were obtained with due permission from the competent authorities of the state and union government of India following strictly the guidelines of the Institute's Ethical and Biosafety Committee. Genomic DNA was extracted according to standard phenol-chloroform procedure <abbrgrp>
<abbr bid="B41">41</abbr>
</abbrgrp>.</p>
</sec>
<sec>
<st>
<p>Restriction digestion of buffalo genomic DNA, cloning and sequencing</p>
</st>
<p>Approximately, 5 &#956;g of buffalo genomic DNA from both the sexes was digested with <it>RsaI </it>restriction enzyme following supplier's (NEB) specification. Fragments were separated on 1% agarose gel in 1&#215; TBE. Distinct bands within the smear were sliced from the gel, purified and cloned into dephosphorylated pBluescript II SK+ vector (Stratagene, USA), using standard protocol <abbrgrp>
<abbr bid="B42">42</abbr>
</abbrgrp>. Approximately, ten clones, representing each fragment, were screened with restriction enzyme <it>Xho</it>1<it>/Nde</it>1 for the presence of insert. Slot-blot hybridization was conducted using <it>RsaI </it>fragments as probe labeled by random priming (RediprimeTM II kit, Amersham Pharmacia biotech, USA). Finally, positive clones were selected for sequencing.</p>
</sec>
<sec>
<st>
<p>
<it>In silico </it>analysis</p>
</st>
<p>Multiple sequence alignment and Phylogenetic tree construction were carried out using ClustalW program. Blast search were performed with the sequences in GenBank using BLASTN program (<url>http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&amp;BLAST_PROGRAMS=megaBlast&amp;PAGE_TYPE=BlastSearch&amp;SHOW_DEFAULTS=on&amp;LINK_LOC=blasthome</url> version 2.2.18+) with default parameters. Repeats were calculated using Repeat masker <url>http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker</url>. Clustered repeats were found out using <url>http://zlab.bu.edu/repfind/form.html</url> ORFs and amino acid sequence identification was done using <url>http://www.ncbi.nlm.nih.gov/gorf/gorf.html</url> Conserved domain was determined using site <url>http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi</url> Cattle chromosome map was constructed using NCBI <it>Bos taurus </it>genome view.</p>
</sec>
<sec>
<st>
<p>Buffalo genomic DNA analysis</p>
</st>
<p>For cross hybridization studies, approximately 500 ng heat denatured genomic DNA from 14 species each mentioned earlier were slot-blotted onto the nylon membrane (Amersham) along with cloned plasmid as positive control and 2&#215; SSC as negative control following standard protocol <abbrgrp>
<abbr bid="B41">41</abbr>
</abbrgrp>. For Southern hybridization, approximately, 4-5 &#956;g of buffalo, cattle, goat and sheep genomic DNA were subjected to restriction digestion using <it>RsaI </it>enzyme following supplier's (NEB) specifications. The digested DNA was resolved on 1.5% agarose gel and transferred onto the nylon membrane (Amersham) following standard protocol <abbrgrp>
<abbr bid="B42">42</abbr>
</abbrgrp>. Membranes were rinsed in 2&#215; SSC, dried and UV cross-linked. Blots were hybridized at 60&#176;C overnight with &#945;-32P-dCTP labeled recombinant plasmid (25 ng) using random priming method (rediprimeTM II kit, Amersham Pharmacia biotech, USA). Washing of the membranes was done using standard protocols and signals were recorded by exposure of the blot to X-ray film <abbrgrp>
<abbr bid="B41">41</abbr>
</abbrgrp>.</p>
</sec>
<sec>
<st>
<p>PCR</p>
</st>
<p>The extent of sequence conservation across bovid genomes was further determined by PCR analysis. Primers were designed from ORF using Primer 3 software (Table <tblr tid="T3">3</tblr>). 50 ng of genomic DNA from buffalo, cattle, goat and sheep were PCR amplified using reaction conditions 95&#176;C for 5 minutes followed by 35 cycles each consisting 95&#176;C for 1 minute, 60&#176;C for 1 minute and 72&#176;C for 1 minute, and final extension at 72&#176;C for 10 minutes for all the four fragments. Amplified fragments were resolved on 1.5% agarose gel in 1% TAE buffer (Table <tblr tid="T3">3</tblr>).</p>
</sec>
<sec>
<st>
<p>RNA isolation and synthesis of cDNA</p>
</st>
<p>Total RNA was extracted from testis, kidney, liver, spleen, lung, heart, ovary, brain and sperm using TRIzol (Molecular Research Center, Inc., Cincinnati, OH) following manufacturer's instructions <abbrgrp>
<abbr bid="B43">43</abbr>
<abbr bid="B44">44</abbr>
</abbrgrp>. Tissues were procured from the local slaughterhouse, Delhi. Fresh ejaculated semen samples from buffalo bulls were obtained from the animal farm, Lucknow, U.P., India, strictly following the guidelines of the Institutes Ethical and Biosafety Committee. To check the contamination of mRNA from the cells other than spermatozoa, RNA extractions from the sperms were tested by RT-PCR for both the <it>CDH1 </it>(E-cadherin) GenBank Accession no. <ext-link ext-link-id="AJ400864" ext-link-type="gen">AJ400864</ext-link> and <it>CD45 </it>(tyrosine phosphatase) GenBank Accession no. <ext-link ext-link-id="NM_001002763" ext-link-type="gen">NM_001002763</ext-link>
<abbrgrp>
<abbr bid="B45">45</abbr>
</abbrgrp>. Similarly, presence of DNA was ruled out by PCR using &#946;-actin primers, GenBank accession no. <ext-link ext-link-id="DQ661647" ext-link-type="gen">DQ661647</ext-link> (Table <tblr tid="T3">3</tblr>). Following this, approximately 10 &#956;g of RNA from different tissues and spermatozoa was reverse transcribed into cDNA using commercially available high capacity cDNA RT kit (Applied Biosystems, USA). The success of cDNA synthesis was confirmed by 35 cycles of PCR amplification using buffalo derived &#946;-actin primers.</p>
</sec>
<sec>
<st>
<p>RT-PCR and Relative expression analysis</p>
</st>
<p>Expression analysis of pDp1, pDp2, pDp3 and pDp4 transcripts using 50 ng cDNA from different somatic tissues and spermatozoa of buffalo was done with sequence specific internal primers designed by Primer 3 software (Table <tblr tid="T3">3</tblr>). PCR conditions were same as that mentioned earlier. &#946;-actin was used as positive control. Relative expression analysis for the four transcripts was done using SYBR Green and Real time PCR Sequence Detection System-7500 (ABI, USA). The primers specific to the sequence were designed using Primer Express Software V2.0 (ABI) (Table <tblr tid="T3">3</tblr>). Primers for the housekeeping gene <it>GAPDH </it>(Glyceraldehyde 3-phosphate dehydrogenase) GenBank Accession no. <ext-link ext-link-id="XR_083674.1" ext-link-type="gen">XR_083674.1</ext-link> was used to normalize the values for each sample. The specificity of each primer pair and efficiency of the amplification were tested by assaying serial dilutions of the cDNA. Each reaction was performed in triplicates and the mean value was used for the analyses <abbrgrp>
<abbr bid="B46">46</abbr>
</abbrgrp>. The cyclic conditions comprise 50&#176;C for 2 min and 95&#176;C for 10 min, followed by 40 cycles each of 95&#176;C for 10 s and 60&#176;C for 1 min. Each experiment was repeated three times to ensure consistency of the results. The expression level of the desired sequence in different tissues and spermatozoa was calculated in the form of 2<sup>-&#916;&#916;Ct </sup>value <url>http://www3.appliedbiosystems.com/cms/groups/mcb_support/documents/generaldocuments/cms_042176.pdf</url>
<abbrgrp>
<abbr bid="B46">46</abbr>
</abbrgrp>.</p>
</sec>
<sec>
<st>
<p>Copy number calculation</p>
</st>
<p>Real-time qPCR assays were performed in a 25 &#956;l reaction volume containing 12.5 &#956;l 2&#215; SYBR Green<sup>&#174; </sup>PCR Master Mix (Applied Biosystems, Foster City, CA, USA), genomic DNA (0.1, 1.0 and 5 ng), forward and reverse primers at final concentration of 100 &#956;M. Copy number estimation for four <it>RsaI </it>fragments in buffalo, cattle, goat and sheep genomes were done using 10 fold dilutions series of recombinant plasmids in the range 30,00,00000 to 3 copies (assuming haploid genome of farm animals =3.3 pg, wt per base pair = 1.096 &#215; 10<sup>-21 </sup>gm). Reactions were performed in 96-well MicroAmp Optical Reaction Plates (Applied Biosystems) in triplicates using the Real time PCR Sequence Detection System-7000 (ABI, USA) and SYBR Green dye. Primers and assay conditions were similar to those used for Relative expression studies (Table <tblr tid="T3">3</tblr>). Reaction specificity was confirmed with melting curves analysis. The standard curve was prepared using 10 folds dilution series of the recombinant plasmids and buffalo, cattle, goat and sheep genomic DNA <abbrgrp>
<abbr bid="B45">45</abbr>
<abbr bid="B46">46</abbr>
</abbrgrp>.</p>
</sec>
<sec>
<st>
<p>Chromosome preparation and fluorescence in situ hybridization (FISH)</p>
</st>
<p>Approximately, 200 &#956;l of the whole blood from buffalo was cultured for chromosome preparation following standard protocols <abbrgrp>
<abbr bid="B46">46</abbr>
</abbrgrp>. FISH was conducted with spectrum red labeled pDp1, pDp2 and pDp3 and pDp4 cloned probes (Abbott Molecular) on the metaphase chromosomes using Nick Translation Kit, Abbott Molecular, (Illinois, USA). Hybridization was carried out in 20 &#956;l volume containing 50% formamide, 10% Dextran sulphate, Cot 1 DNA and 2&#215; SSC, pH 7 for 16 hours at 37&#176;C in a moist chamber. Post hybridization washes were done in 2&#215; SSC at 37&#176;C (low stringent condition) and then at 60&#176;C in 0.1&#215; SSC (under high stringent condition). Slides were counterstained with DAPI, screened under Olympus Fluorescence Microscope (BX51) and images were captured with Olympus U-CMAD-2 CCD camera. Chromosome mapping was done following the International System for Chromosome Nomenclature (ISCND 2000) for Bovids <abbrgrp>
<abbr bid="B47">47</abbr>
</abbrgrp>.</p>
</sec>
<sec>
<st>
<p>Generation of full length buffalo <it>ACOT11 </it>mRNA using endpoint PCR</p>
</st>
<p>Blast search with pDp1 sequences showed 91% homology with <it>B. taurus ACOT11 </it>gene from nucleotide position 730-1331 encompassing 602 bp. Full length buffalo <it>ACOT11 </it>mRNA was generated using primers designed from <it>B. taurus ACOT 11 </it>(Accession No. <ext-link ext-link-id="NM_001103275" ext-link-type="gen">NM_001103275</ext-link>). Details of Primer sequences and product size are given in Table <tblr tid="T3">3</tblr>. PCR amplified products were cloned into and pGEMT-easy vector and sequenced. Finally, buffalo <it>ACOT11 </it>gene sequences were assembled and full length sequence was deposited in the GenBank.</p>
</sec>
</sec>
<sec>
<st>
<p>Abbreviations</p>
</st>
<p>CD45: Cluster of differentiation 45; CDH1: Cadherin-1; cDNA: complementary Deoxyribonucleic acid; Ct: Cycle threshold; DAPI: 4',6-diamidino-2-phenylindole; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; mRNA: Messenger ribonucleic acid; RT-PCR: Reverse transcriptase Polymerase chain reaction; RTE: Retrotransposable element; RT-PCR: Reverse Transcriptase-Polymerase Chain Reaction; TAE: Tris/Acetic acid/EDTA; TBE: Tris/Borate/EDTA; UTR: Untranslated region.</p>
</sec>
<sec>
<st>
<p>Authors' contributions</p>
</st>
<p>DP carried out the experiments and <it>in-silico </it>analysis, interpreted the data, and wrote the manuscript. SA conceived and designed the study, interpreted the results and revised the manuscript critically. All the authors read and approved the final manuscript</p>
</sec>
</bdy><bm>
<ack>
<sec>
<st>
<p>Acknowledgements</p>
</st>
<p>This work was supported by a DST Grant No.SR/WOSA/LS-92/2005 to DP, DBT Grants No. BT/PR14102/AAQ/01/438/2010 to SA and a core grant from the Department of Biotechnology, Govt. of India to the National Institute of Immunology, New Delhi. SA thanks Alexander Von Humboldt Foundation, Bonn, Germany for equipment donation and Shri Khem Singh Negi for technical assistance.</p>
</sec>
</ack>
<refgrp><bibl id="B1"><title><p>The evolutionary dynamics of repetitive DNA in eukaryotes</p></title><aug><au><snm>Charlesworth</snm><fnm>B</fnm></au><au><snm>Sniegowski</snm><fnm>P</fnm></au><au><snm>Stephan</snm><fnm>W</fnm></au></aug><source>Nature</source><pubdate>1994</pubdate><volume>371</volume><fpage>215</fpage><lpage>220</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/371215a0</pubid><pubid idtype="pmpid" link="fulltext">8078581</pubid></pubidlist></xrefbib></bibl><bibl id="B2"><title><p>The origin of interspersed repeats in the human genome</p></title><aug><au><snm>Smit</snm><fnm>AF</fnm></au></aug><source>Curr Opin Genet Dev</source><pubdate>1996</pubdate><volume>6</volume><fpage>743</fpage><lpage>748</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S0959-437X(96)80030-X</pubid><pubid idtype="pmpid" link="fulltext">8994846</pubid></pubidlist></xrefbib></bibl><bibl id="B3"><title><p>SINEs LINEs: highly repeated short long interspersed sequences in mammalian genomes</p></title><aug><au><snm>Singer</snm><fnm>MF</fnm></au></aug><source>Cell</source><pubdate>1982</pubdate><volume>28</volume><fpage>433</fpage><lpage>434</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/0092-8674(82)90194-5</pubid><pubid idtype="pmpid" link="fulltext">6280868</pubid></pubidlist></xrefbib></bibl><bibl id="B4"><title><p>Origins of repeated DNA</p></title><aug><au><snm>Rogers</snm><fnm>J</fnm></au></aug><source>Nature</source><pubdate>1985</pubdate><volume>317</volume><fpage>765</fpage><lpage>766</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/317765a0</pubid><pubid idtype="pmpid">4058584</pubid></pubidlist></xrefbib></bibl><bibl id="B5"><title><p>CetSINEs AREs are not SINEs but are parts of cetartiodactyl L1</p></title><aug><au><snm>Nikaido</snm><fnm>M</fnm></au><au><snm>Okada</snm><fnm>N</fnm></au></aug><source>Mamm Genome</source><pubdate>2000</pubdate><volume>11</volume><fpage>1123</fpage><lpage>1126</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1007/s003350010221</pubid><pubid idtype="pmpid" link="fulltext">11130982</pubid></pubidlist></xrefbib></bibl><bibl id="B6"><title><p>Short retroposons in eukaryotic genomes</p></title><aug><au><snm>Kramerov</snm><fnm>DA</fnm></au><au><snm>Vassetzky</snm><fnm>NS</fnm></au></aug><source>Int Rev Cytol</source><pubdate>2005</pubdate><volume>247</volume><fpage>165</fpage><lpage>221</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">16344113</pubid></xrefbib></bibl><bibl id="B7"><title><p>Genome sequence comparative analysis haplotype structure of the domestic dog</p></title><aug><au><snm>Lindblad-Toh</snm><fnm>K</fnm></au><au><snm>Wade</snm><fnm>CM</fnm></au><au><snm>Mikkelsen</snm><fnm>TS</fnm></au><au><snm>Karlsson</snm><fnm>EK</fnm></au><au><snm>Jaffe</snm><fnm>DB</fnm></au><au><snm>Kamal</snm><fnm>M</fnm></au><au><snm>Clamp</snm><fnm>M</fnm></au><au><snm>Chang</snm><fnm>JL</fnm></au><etal/></aug><source>Nature</source><pubdate>2005</pubdate><volume>438</volume><fpage>803</fpage><lpage>819</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature04338</pubid><pubid idtype="pmpid" link="fulltext">16341006</pubid></pubidlist></xrefbib></bibl><bibl id="B8"><title><p>The RTE class of non-LTR retrotransposons is widely distributed in animals is the origin of many SINEs</p></title><aug><au><snm>Malik</snm><fnm>HS</fnm></au><au><snm>Eickbush</snm><fnm>TH</fnm></au></aug><source>Mol Biol Evol</source><pubdate>1998</pubdate><volume>15</volume><fpage>1123</fpage><lpage>1134</lpage><xrefbib><pubid idtype="pmpid" link="fulltext">9729877</pubid></xrefbib></bibl><bibl id="B9"><title><p>SINEs of a nearly perfect character</p></title><aug><au><snm>Ray</snm><fnm>DA</fnm></au><au><snm>Xing</snm><fnm>J</fnm></au><au><snm>Salem</snm><fnm>AH</fnm></au><au><snm>Batzer</snm><fnm>MA</fnm></au></aug><source>Syst boil</source><pubdate>2006</pubdate><volume>55</volume><fpage>928</fpage><lpage>935</lpage><xrefbib><pubid idtype="doi">10.1080/10635150600865419</pubid></xrefbib></bibl><bibl id="B10"><title><p>SINE insertions: powerful tools for molecular systematic</p></title><aug><au><snm>Shedlock</snm><fnm>AM</fnm></au><au><snm>Okada</snm><fnm>N</fnm></au></aug><source>Bioessays</source><pubdate>2000</pubdate><volume>22</volume><fpage>148</fpage><lpage>160</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1002/(SICI)1521-1878(200002)22:2&lt;148::AID-BIES6&gt;3.0.CO;2-Z</pubid><pubid idtype="pmpid" link="fulltext">10655034</pubid></pubidlist></xrefbib></bibl><bibl id="B11"><title><p>Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1</p></title><aug><au><snm>Sayah</snm><fnm>DM</fnm></au><au><snm>Sokolskaja</snm><fnm>E</fnm></au><au><snm>Berthoux</snm><fnm>L</fnm></au><au><snm>Luban</snm><fnm>J</fnm></au></aug><source>Nature</source><pubdate>2004</pubdate><volume>430</volume><fpage>569</fpage><lpage>573</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature02777</pubid><pubid idtype="pmpid" link="fulltext">15243629</pubid></pubidlist></xrefbib></bibl><bibl id="B12"><title><p>Retrotransposon insertion in SILV is responsible for merle patterning of the domestic dog</p></title><aug><au><snm>Clark</snm><fnm>LA</fnm></au><au><snm>Wahl</snm><fnm>JM</fnm></au><au><snm>Rees</snm><fnm>CA</fnm></au><au><snm>Murphy</snm><fnm>KE</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>2006</pubdate><volume>103</volume><fpage>1376</fpage><lpage>1381</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.0506940103</pubid><pubid idtype="pmcid">1360527</pubid><pubid idtype="pmpid" link="fulltext">16407134</pubid></pubidlist></xrefbib></bibl><bibl id="B13"><title><p>Retrotransposon-induced mutations in grape skin color</p></title><aug><au><snm>Kobayashi</snm><fnm>S</fnm></au><au><snm>Goto-Yamamoto</snm><fnm>N</fnm></au><au><snm>Hirochika</snm><fnm>H</fnm></au></aug><source>Science</source><pubdate>2004</pubdate><volume>304</volume><fpage>982</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1126/science.1095011</pubid><pubid idtype="pmpid" link="fulltext">15143274</pubid></pubidlist></xrefbib></bibl><bibl id="B14"><title><p>A distal enhancer an ultraconserved exon are derived from a novel retroposon</p></title><aug><au><snm>Bejerano</snm><fnm>G</fnm></au><au><snm>Lowe</snm><fnm>CB</fnm></au><au><snm>Ahituv</snm><fnm>N</fnm></au><au><snm>King</snm><fnm>B</fnm></au><au><snm>Siepel</snm><fnm>A</fnm></au><au><snm>Salama</snm><fnm>SR</fnm></au><au><snm>Rubin</snm><fnm>EM</fnm></au><au><snm>Kent</snm><fnm>WJ</fnm></au><au><snm>Haussler</snm><fnm>D</fnm></au></aug><source>Nature</source><pubdate>2006</pubdate><volume>441</volume><fpage>87</fpage><lpage>90</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature04696</pubid><pubid idtype="pmpid" link="fulltext">16625209</pubid></pubidlist></xrefbib></bibl><bibl id="B15"><title><p>Species-specific endogenous retroviruses shape the transcriptional network of the human tumor suppressor protein p53</p></title><aug><au><snm>Wang</snm><fnm>T</fnm></au><au><snm>Zeng</snm><fnm>J</fnm></au><au><snm>Lowe</snm><fnm>CB</fnm></au><au><snm>Sellers</snm><fnm>RG</fnm></au><au><snm>Salama</snm><fnm>SR</fnm></au><au><snm>Yang</snm><fnm>M</fnm></au><au><snm>Burgess</snm><fnm>SM</fnm></au><au><snm>Brachmann</snm><fnm>RK</fnm></au><au><snm>Haussler</snm><fnm>D</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>2007</pubdate><volume>104</volume><fpage>18613</fpage><lpage>18618</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.0703637104</pubid><pubid idtype="pmcid">2141825</pubid><pubid idtype="pmpid" link="fulltext">18003932</pubid></pubidlist></xrefbib></bibl><bibl id="B16"><title><p>Transposable elements the evolution of regulatory networks</p></title><aug><au><snm>Feschotte</snm><fnm>C</fnm></au></aug><source>Nat Rev Genet</source><pubdate>2008</pubdate><volume>9</volume><fpage>397</fpage><lpage>405</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nrg2337</pubid><pubid idtype="pmcid">2596197</pubid><pubid idtype="pmpid" link="fulltext">18368054</pubid></pubidlist></xrefbib></bibl><bibl id="B17"><title><p>Characterization Distribution of Retro-transposons Simple Sequence Repeats in the Bovine Genome</p></title><aug><au><snm>Adelson</snm><fnm>DL</fnm></au><au><snm>Raison</snm><fnm>JM</fnm></au><au><snm>Edgar</snm><fnm>RC</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>2009</pubdate><volume>106</volume><fpage>12855</fpage><lpage>12860</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.0901282106</pubid><pubid idtype="pmcid">2722308</pubid><pubid idtype="pmpid" link="fulltext">19625614</pubid></pubidlist></xrefbib></bibl><bibl id="B18"><title><p>The birth of an alternatively spliced exon: 3' splice-site selection in <it>Alu </it>exons</p></title><aug><au><snm>Lev-Maor</snm><fnm>G</fnm></au><au><snm>Sorek</snm><fnm>R</fnm></au><au><snm>Shomron</snm><fnm>N</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au></aug><source>Science</source><pubdate>2003</pubdate><volume>300</volume><fpage>1246</fpage><lpage>1247</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1126/science.1085690</pubid><pubid idtype="pmpid" link="fulltext">12764185</pubid></pubidlist></xrefbib></bibl><bibl id="B19"><title><p><it>Alu</it>-containing exons are alternatively spliced</p></title><aug><au><snm>Sorek</snm><fnm>R</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au><au><snm>Graur</snm><fnm>D</fnm></au></aug><source>Genome Res</source><pubdate>2002</pubdate><volume>12</volume><fpage>1060</fpage><lpage>1067</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1101/gr.229302</pubid><pubid idtype="pmcid">186627</pubid><pubid idtype="pmpid" link="fulltext">12097342</pubid></pubidlist></xrefbib></bibl><bibl id="B20"><title><p>Minimal conditions for exonization of intronic sequences: 5' splice site formation in <it>Alu </it>exons</p></title><aug><au><snm>Sorek</snm><fnm>R</fnm></au><au><snm>Lev-Maor</snm><fnm>G</fnm></au><au><snm>Reznik</snm><fnm>M</fnm></au><au><snm>Dagan</snm><fnm>T</fnm></au><au><snm>Belinky</snm><fnm>F</fnm></au><au><snm>Graur</snm><fnm>D</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au></aug><source>Mol Cell</source><pubdate>2004</pubdate><volume>14</volume><fpage>221</fpage><lpage>231</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S1097-2765(04)00181-9</pubid><pubid idtype="pmpid" link="fulltext">15099521</pubid></pubidlist></xrefbib></bibl><bibl id="B21"><title><p>Short interspersed elements (SINEs) are a major source of canine genomic diversity</p></title><aug><au><snm>Wang</snm><fnm>W</fnm></au><au><snm>Kirkness</snm><fnm>EF</fnm></au></aug><source>Genome Res</source><pubdate>2005</pubdate><volume>15</volume><fpage>1798</fpage><lpage>1808</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1101/gr.3765505</pubid><pubid idtype="pmcid">1356118</pubid><pubid idtype="pmpid" link="fulltext">16339378</pubid></pubidlist></xrefbib></bibl><bibl id="B22"><title><p>Teaching old dog new tricks: SINEs of canine genomic diversity</p></title><aug><au><snm>Cordaux</snm><fnm>R</fnm></au><au><snm>Batzer</snm><fnm>MA</fnm></au></aug><source>Proc Natl Acad Sci USA</source><pubdate>2006</pubdate><volume>103</volume><fpage>1157</fpage><lpage>1158</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1073/pnas.0510714103</pubid><pubid idtype="pmcid">1360598</pubid><pubid idtype="pmpid" link="fulltext">16432182</pubid></pubidlist></xrefbib></bibl><bibl id="B23"><title><p>Report of a chimeric origin of transposable elements in a bovine-coding gene</p></title><aug><au><snm>Almeida</snm><fnm>LM</fnm></au><au><snm>Amaral</snm><fnm>ME</fnm></au><au><snm>Silva</snm><fnm>IT</fnm></au><au><snm>Silva</snm><fnm>WA</fnm><suf>Jr</suf></au><au><snm>Riggs</snm><fnm>PK</fnm></au><au><snm>Carareto</snm><fnm>CM</fnm></au></aug><source>Genet Mol Res</source><pubdate>2008</pubdate><volume>7</volume><fpage>107</fpage><lpage>116</lpage><xrefbib><pubidlist><pubid idtype="doi">10.4238/vol7-1gmr371</pubid><pubid idtype="pmpid" link="fulltext">18273826</pubid></pubidlist></xrefbib></bibl><bibl id="B24"><title><p>Comparative analysis of transposed element insertion within human mouse genomes reveals <it>Alu's </it>unique role in shaping the human transcriptome</p></title><aug><au><snm>Sela</snm><fnm>N</fnm></au><au><snm>Mersch</snm><fnm>B</fnm></au><au><snm>Gal-Mark</snm><fnm>N</fnm></au><au><snm>Lev-Maor</snm><fnm>G</fnm></au><au><snm>Hotz-Wagenblatt</snm><fnm>A</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au></aug><source>Genome Biol</source><pubdate>2007</pubdate><volume>8</volume><fpage>127</fpage><xrefbib><pubid idtype="doi">10.1186/gb-2007-8-6-r127</pubid></xrefbib></bibl><bibl id="B25"><title><p>Evolutionary dynamics of transposable elements in the short-tailed opossum <it>Monodelphis domestica</it></p></title><aug><au><snm>Gentles</snm><fnm>AJ</fnm></au><au><snm>Wakefield</snm><fnm>MJ</fnm></au><au><snm>Kohany</snm><fnm>O</fnm></au><au><snm>Gu</snm><fnm>W</fnm></au><au><snm>Batzer</snm><fnm>MA</fnm></au><au><snm>Pollock</snm><fnm>DD</fnm></au><au><snm>Jurka</snm><fnm>J</fnm></au></aug><source>Genome Res</source><pubdate>2007</pubdate><volume>17</volume><fpage>992</fpage><lpage>1004</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1101/gr.6070707</pubid><pubid idtype="pmcid">1899126</pubid><pubid idtype="pmpid" link="fulltext">17495012</pubid></pubidlist></xrefbib></bibl><bibl id="B26"><title><p>SINEs evolution genome structure in the opossum</p></title><aug><au><snm>Gu</snm><fnm>W</fnm></au><au><snm>Ray</snm><fnm>DA</fnm></au><au><snm>Walker</snm><fnm>JA</fnm></au><au><snm>Barnes</snm><fnm>EW</fnm></au><au><snm>Gentles</snm><fnm>AJ</fnm></au><au><snm>Samollow</snm><fnm>PB</fnm></au><au><snm>Jurka</snm><fnm>J</fnm></au><au><snm>Batzer</snm><fnm>MA</fnm></au><au><snm>Pollock</snm><fnm>DD</fnm></au></aug><source>Gene</source><pubdate>2007</pubdate><volume>396</volume><fpage>46</fpage><lpage>58</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.gene.2007.02.028</pubid><pubid idtype="pmpid" link="fulltext">17442506</pubid></pubidlist></xrefbib></bibl><bibl id="B27"><title><p>Transcriptional disruption by the L1 retrotransposon implications for mammalian transcriptomes</p></title><aug><au><snm>Han</snm><fnm>JS</fnm></au><au><snm>Szak</snm><fnm>ST</fnm></au><au><snm>Boeke</snm><fnm>JD</fnm></au></aug><source>Nature</source><pubdate>2004</pubdate><volume>429</volume><fpage>268</fpage><lpage>274</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nature02536</pubid><pubid idtype="pmpid" link="fulltext">15152245</pubid></pubidlist></xrefbib></bibl><bibl id="B28"><title><p>Recently mobilized transposons in the human chimpanzee genomes</p></title><aug><au><snm>Mills</snm><fnm>RE</fnm></au><au><snm>Bennett</snm><fnm>EA</fnm></au><au><snm>Iskow</snm><fnm>RC</fnm></au><au><snm>Luttig</snm><fnm>CT</fnm></au><au><snm>Tsui</snm><fnm>C</fnm></au><au><snm>Pittard</snm><fnm>WS</fnm></au><au><snm>Devine</snm><fnm>SE</fnm></au></aug><source>Am J Hum Genet</source><pubdate>2006</pubdate><volume>78</volume><fpage>671</fpage><lpage>679</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1086/501028</pubid><pubid idtype="pmcid">1424692</pubid><pubid idtype="pmpid" link="fulltext">16532396</pubid></pubidlist></xrefbib></bibl><bibl id="B29"><title><p>The impact of retrotransposons on human genome evolution</p></title><aug><au><snm>Cordaux</snm><fnm>R</fnm></au><au><snm>Batzer</snm><fnm>MA</fnm></au></aug><source>Nat Rev Genet</source><pubdate>2009</pubdate><volume>10</volume><fpage>691</fpage><lpage>703</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/nrg2640</pubid><pubid idtype="pmcid">2884099</pubid><pubid idtype="pmpid" link="fulltext">19763152</pubid></pubidlist></xrefbib></bibl><bibl id="B30"><title><p>Complex genome rearrangements reveal evolutionary dynamics of pericentromeric regions in the Triticeae</p></title><aug><au><snm>Qi</snm><fnm>L</fnm></au><au><snm>Friebe</snm><fnm>B</fnm></au><au><snm>Gill</snm><fnm>BS</fnm></au></aug><source>Genome</source><pubdate>2006</pubdate><volume>49</volume><fpage>1628</fpage><lpage>1639</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1139/g06-123</pubid><pubid idtype="pmpid" link="fulltext">17426778</pubid></pubidlist></xrefbib></bibl><bibl id="B31"><title><p>The multicopy appearance of a large inverted duplication the sequence at the inversion joint suggest a new model for gene amplification</p></title><aug><au><snm>Hyrien</snm><fnm>O</fnm></au><au><snm>Debatisse</snm><fnm>M</fnm></au><au><snm>Buttin</snm><fnm>G</fnm></au><au><snm>de Saint Vincent</snm><fnm>BR</fnm></au></aug><source>EMBO J</source><pubdate>1988</pubdate><volume>7</volume><fpage>407</fpage><lpage>417</lpage><xrefbib><pubidlist><pubid idtype="pmcid">454335</pubid><pubid idtype="pmpid">3366118</pubid></pubidlist></xrefbib></bibl><bibl id="B32"><title><p><it>PstI </it>repeat: a family of short interspersednucleotide element (SINE)-like sequences in the genomes of cattle goat buffalo</p></title><aug><au><snm>Sheikh</snm><fnm>FG</fnm></au><au><snm>Mukhopadhyay</snm><fnm>SS</fnm></au><au><snm>Gupta</snm><fnm>P</fnm></au></aug><source>Genome</source><pubdate>2002</pubdate><volume>45</volume><fpage>44</fpage><lpage>50</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1139/g01-122</pubid><pubid idtype="pmpid">11908667</pubid></pubidlist></xrefbib></bibl><bibl id="B33"><title><p>Mobile elements inserted in the distant past have taken on important functions</p></title><aug><au><snm>Britten</snm><fnm>RJ</fnm></au></aug><source>Gene</source><pubdate>1997</pubdate><volume>205</volume><fpage>177</fpage><lpage>182</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/S0378-1119(97)00399-5</pubid><pubid idtype="pmpid">9461392</pubid></pubidlist></xrefbib></bibl><bibl id="B34"><title><p>Genomes were forged by massive bombardments with retroelements retrosequences</p></title><aug><au><snm>Brosius</snm><fnm>J</fnm></au></aug><source>Genetica</source><pubdate>1999</pubdate><volume>107</volume><fpage>209</fpage><lpage>238</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1023/A:1004018519722</pubid><pubid idtype="pmpid" link="fulltext">10952214</pubid></pubidlist></xrefbib></bibl><bibl id="B35"><title><p>Altruistic functions for selfish DNA</p></title><aug><au><snm>Faulkner</snm><fnm>GJ</fnm></au><au><snm>Carninci</snm><fnm>P</fnm></au></aug><source>Cell Cycle</source><pubdate>2009</pubdate><volume>8</volume><fpage>2895</fpage><lpage>2900</lpage><xrefbib><pubidlist><pubid idtype="doi">10.4161/cc.8.18.9536</pubid><pubid idtype="pmpid" link="fulltext">19736519</pubid></pubidlist></xrefbib></bibl><bibl id="B36"><title><p>The regulated retrotransposon transcriptome of mammalian cells</p></title><aug><au><snm>Faulkner</snm><fnm>GJ</fnm></au><au><snm>Kimura</snm><fnm>Y</fnm></au><au><snm>Daub</snm><fnm>CO</fnm></au><au><snm>Wani</snm><fnm>S</fnm></au><au><snm>Plessy</snm><fnm>C</fnm></au><au><snm>Irvine</snm><fnm>KM</fnm></au><au><snm>Schroder</snm><fnm>K</fnm></au><au><snm>Cloonan</snm><fnm>N</fnm></au><au><snm>Steptoe</snm><fnm>AL</fnm></au><au><snm>Lassmann</snm><fnm>T</fnm></au><au><snm>Waki</snm><fnm>K</fnm></au><au><snm>Hornig</snm><fnm>N</fnm></au><au><snm>Arakawa</snm><fnm>T</fnm></au><au><snm>Takahashi</snm><fnm>H</fnm></au><au><snm>Kawai</snm><fnm>J</fnm></au><au><snm>Forrest</snm><fnm>AR</fnm></au><au><snm>Suzuki</snm><fnm>H</fnm></au><au><snm>Hayashizaki</snm><fnm>Y</fnm></au><au><snm>Hume</snm><fnm>DA</fnm></au><au><snm>Orlando</snm><fnm>V</fnm></au><au><snm>Grimmond</snm><fnm>SM</fnm></au><au><snm>Carninci</snm><fnm>P</fnm></au></aug><source>Nat Genet</source><pubdate>2009</pubdate><volume>41</volume><fpage>563</fpage><lpage>571</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1038/ng.368</pubid><pubid idtype="pmpid" link="fulltext">19377475</pubid></pubidlist></xrefbib></bibl><bibl id="B37"><title><p>Retrotransposons reverse transcriptase the genesis of new genetic information</p></title><aug><au><snm>Sciamanna</snm><fnm>I</fnm></au><au><snm>Vitullo</snm><fnm>P</fnm></au><au><snm>Curatolo</snm><fnm>A</fnm></au><au><snm>Spadafora</snm><fnm>C</fnm></au></aug><source>Gene</source><pubdate>2009</pubdate><volume>448</volume><fpage>180</fpage><lpage>186</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1016/j.gene.2009.07.011</pubid><pubid idtype="pmpid" link="fulltext">19631262</pubid></pubidlist></xrefbib></bibl><bibl id="B38"><title><p>Comparative analysis of transposed element insertion within human mouse genomes reveals <it>Alu's </it>unique role in shaping the human transcriptome</p></title><aug><au><snm>Sela</snm><fnm>N</fnm></au><au><snm>Mersch</snm><fnm>B</fnm></au><au><snm>Gal-Mark</snm><fnm>N</fnm></au><au><snm>Lev-Maor</snm><fnm>G</fnm></au><au><snm>Hotz-Wagenblatt</snm><fnm>A</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au></aug><source>Genome Biol</source><pubdate>2007</pubdate><volume>8</volume><fpage>127</fpage><xrefbib><pubid idtype="doi">10.1186/gb-2007-8-6-r127</pubid></xrefbib></bibl><bibl id="B39"><title><p>The pivotal roles of TIA proteins in 5' splice-site selection of alu exons across evolution</p></title><aug><au><snm>Gal-Mark</snm><fnm>N</fnm></au><au><snm>Schwartz</snm><fnm>S</fnm></au><au><snm>Ram</snm><fnm>O</fnm></au><au><snm>Eyras</snm><fnm>E</fnm></au><au><snm>Ast</snm><fnm>G</fnm></au></aug><source>PLoS Genet</source><pubdate>2009</pubdate><volume>5</volume><fpage>e1000717</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1371/journal.pgen.1000717</pubid><pubid idtype="pmcid">2766253</pubid><pubid idtype="pmpid" link="fulltext">19911040</pubid></pubidlist></xrefbib></bibl><bibl id="B40"><title><p>Phylogenetic analysis of mRNA polyadenylation sites reveals a role of transposable elements in evolution of the 3'-end of genes</p></title><aug><au><snm>Lee</snm><fnm>JY</fnm></au><au><snm>Ji</snm><fnm>Z</fnm></au><au><snm>Tian</snm><fnm>B</fnm></au></aug><source>Nucleic Acids Res</source><pubdate>2008</pubdate><volume>36</volume><fpage>5581</fpage><lpage>5590</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1093/nar/gkn540</pubid><pubid idtype="pmcid">2553571</pubid><pubid idtype="pmpid" link="fulltext">18757892</pubid></pubidlist></xrefbib></bibl><bibl id="B41"><title><p>Synthetic DNA-based genetic markers reveal intra-inter-species DNA sequence variability in the Bubalus bubalis related genomes</p></title><aug><au><snm>John</snm><fnm>MV</fnm></au><au><snm>Ali</snm><fnm>S</fnm></au></aug><source>DNA Cell Biol</source><pubdate>1997</pubdate><volume>16</volume><fpage>369</fpage><lpage>378</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1089/dna.1997.16.369</pubid><pubid idtype="pmpid">9115646</pubid></pubidlist></xrefbib></bibl><bibl id="B42"><title><p>Molecular cloning</p></title><aug><au><snm>Sambrook</snm><fnm>J</fnm></au><au><snm>Fritschi</snm><fnm>EF</fnm></au><au><snm>Maniatis</snm><fnm>T</fnm></au></aug><source>Cold Spring Harbor Laboratory Press New York</source><pubdate>1989</pubdate></bibl><bibl id="B43"><title><p>Organization differential expression of the GACA/GATA tagged somatic spermatozoal transcriptomes in Buffalo Bubalus <it>bubalis</it></p></title><aug><au><snm>Srivastava</snm><fnm>J</fnm></au><au><snm>Premi</snm><fnm>S</fnm></au><au><snm>Kumar</snm><fnm>S</fnm></au><au><snm>Ali</snm><fnm>S</fnm></au></aug><source>BMC Genomics</source><pubdate>2008</pubdate><volume>9</volume><fpage>132</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2164-9-132</pubid><pubid idtype="pmcid">2346481</pubid><pubid idtype="pmpid" link="fulltext">18366692</pubid></pubidlist></xrefbib></bibl><bibl id="B44"><title><p>Expressional dynamics of minisatellite 33.15 tagged spermatozoal transcriptome in Bubalus bubalis</p></title><aug><au><snm>Srivastava</snm><fnm>J</fnm></au><au><snm>Premi</snm><fnm>S</fnm></au><au><snm>Kumar</snm><fnm>S</fnm></au><au><snm>Ali</snm><fnm>S</fnm></au></aug><source>BMC Genomics</source><pubdate>2009</pubdate><volume>10</volume><fpage>303</fpage><xrefbib><pubidlist><pubid idtype="doi">10.1186/1471-2164-10-303</pubid><pubid idtype="pmcid">2713999</pubid><pubid idtype="pmpid" link="fulltext">19583837</pubid></pubidlist></xrefbib></bibl><bibl id="B45"><title><p>Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo <it>Bubalus </it><it>bubalis </it>employing minisatellite-associated sequence amplification</p></title><aug><au><snm>Pathak</snm><fnm>D</fnm></au><au><snm>Srivastava</snm><fnm>J</fnm></au><au><snm>Samad</snm><fnm>R</fnm></au><au><snm>Parwez</snm><fnm>I</fnm></au><au><snm>Kumar</snm><fnm>S</fnm></au><au><snm>Ali</snm><fnm>S</fnm></au></aug><source>Chromosome Res</source><pubdate>2010</pubdate><volume>18</volume><fpage>441</fpage><lpage>458</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1007/s10577-010-9132-0</pubid><pubid idtype="pmpid" link="fulltext">20480223</pubid></pubidlist></xrefbib></bibl><bibl id="B46"><title><p>Chromosomal localization copy number assessment transcriptional status of BamHI repeat fractions in water buffalo Bubalus bubalis</p></title><aug><au><snm>Pathak</snm><fnm>D</fnm></au><au><snm>Srivastava</snm><fnm>J</fnm></au><au><snm>Premi</snm><fnm>S</fnm></au><au><snm>Tiwari</snm><fnm>M</fnm></au><au><snm>Garg</snm><fnm>LC</fnm></au><au><snm>Kumar</snm><fnm>S</fnm></au><au><snm>Ali</snm><fnm>S</fnm></au></aug><source>DNA Cell Biol</source><pubdate>2006</pubdate><volume>25</volume><fpage>206</fpage><lpage>214</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1089/dna.2006.25.206</pubid><pubid idtype="pmpid" link="fulltext">16629593</pubid></pubidlist></xrefbib></bibl><bibl id="B47"><title><p>International System for Chromosome Nomenclature of Domestic Bovids (ISCNDB 2000)</p></title><aug><au><snm>Cribiu</snm><fnm>EP</fnm></au><au><snm>Di Berardino</snm><fnm>D</fnm></au><au><snm>Di Meo</snm><fnm>GP</fnm></au><au><snm>Eggen</snm><fnm>A</fnm></au><au><snm>Gallagher</snm><fnm>DS</fnm></au><au><snm>Gustavsson</snm><fnm>I</fnm></au><au><snm>Hayes</snm><fnm>H</fnm></au><au><snm>Iannuzzi</snm><fnm>L</fnm></au><au><snm>Popescu</snm><fnm>CP</fnm></au><au><snm>Rubes</snm><fnm>J</fnm></au><au><snm>Schmutz</snm><fnm>S</fnm></au><au><snm>Stranzinger</snm><fnm>G</fnm></au><au><snm>Vaiman</snm><fnm>A</fnm></au><au><snm>Womack</snm><fnm>J</fnm></au></aug><source>Cytogenet Cell Genet</source><pubdate>2001</pubdate><volume>92</volume><fpage>283</fpage><lpage>299</lpage><xrefbib><pubidlist><pubid idtype="doi">10.1159/000056917</pubid><pubid idtype="pmpid" link="fulltext">11435702</pubid></pubidlist></xrefbib></bibl></refgrp>
</bm></art>