<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2164-1-1</ui>
   <ji>1471-2164</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Mapping of the Mouse Actin Capping Protein Beta Subunit Gene</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Hart</snm>
               <fnm>Marilyn C</fnm>
               <insr iid="I2"/>
               <email>mhart@VAX2.WINONA.MSUS.EDU</email>
            </au>
            <au id="A2" ca="yes">
               <snm>Korshunova</snm>
               <fnm>Yulia O</fnm>
               <insr iid="I3"/>
               <email>yuliak@sequencer.wustl.edu</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Cooper</snm>
               <fnm>John A</fnm>
               <insr iid="I1"/>
               <email>jcooper@cellbio.wustl.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110, USA</p>
            </ins>
            <ins id="I2">
               <p>Winona State University, Winona, MN 55987, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Genetics, Washington University, St. Louis, MO 63110, USA</p>
            </ins>
         </insg>
         <source>BMC Genomics</source>
         <issn>1471-2164</issn>
         <pubdate>2000</pubdate>
         <volume>1</volume>
         <issue>1</issue>
         <fpage>1</fpage>
         <lpage>1</lpage>
         <url>http://www.biomedcentral.com/1471-2164/1/1</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/1471-2164-1-1</pubid>
               <pubid idtype="pmpid">11001587</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>11</day>
               <month>7</month>
               <year>2000</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>27</day>
               <month>7</month>
               <year>2000</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>27</day>
               <month>7</month>
               <year>2000</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2000</year>
         <collab>Hart et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Capping protein (CP), a heterodimer of &#945; and &#946; subunits, is found in all eukaryotes. CP binds to the barbed ends of actin filaments <it>in vitro</it> and controls actin assembly and cell motility <it>in vivo</it>. Vertebrates have three isoforms of CP&#946; produced by alternatively splicing from one gene; lower organisms have one gene and one isoform.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We isolated genomic clones corresponding to the &#946; subunit of mouse CP and identified its chromosomal location by interspecies backcross mapping.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>The CP&#946; gene (<it>Cappb1</it>) mapped to Chromosome 4 between <it>Cdc42</it> and <it>D4Mit312</it>. Three mouse mutations, snubnose, curly tail, and cribriform degeneration, map in the vicinity of the &#946; gene.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Capping protein (CP) is a ubiquitous actin binding protein that regulates actin assembly and cell motility. CP is a heterodimer composed of &#945; and &#946; subunits, each approximately 30 kD. Lower organisms, including <it>Saccharomyces cerevisiae, Caenorhabditis elegans</it> and <it>Drosophila melanogaster,</it> have one gene and one isoform for each of the CP&#945; and &#946; subunits [<abbr bid="B1">1</abbr>,<abbr bid="B2">2</abbr>,<abbr bid="B3">3</abbr>]. Vertebrates contain three &#945; subunit isoforms encoded by three different genes and three &#946; subunit isoforms (&#946;1, &#946;2, &#946;3) produced from one gene by alternative splicing [<abbr bid="B4">4</abbr>,<abbr bid="B5">5</abbr>,<abbr bid="B6">6</abbr>].</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <p>To confirm the genomic complexity of the &#946; subunit of mouse CP, Southern blots of mouse genomic DNA were cleaved with several restriction enzymes and independently probed with mouse &#946;1 and &#946;2 cDNAs. The &#946;1 and &#946;2 probes each hybridized to one identical band. To obtain genomic clones that correspond to this pattern, a 129SV genomic library in the lambda FIXII vector (Stratagene) was screened using the complete &#946;1 cDNA as probe. Positive plaques were purified according to standard procedures [<abbr bid="B7">7</abbr>] and the phage DNA isolated using DEAE-cellulose [<abbr bid="B8">8</abbr>]. Comparison of the hybridization pattern for the genomic clones with the mouse genomic DNA revealed that the patterns were identical, confirming the presence of a single &#946; gene in the mouse genome.</p>
         <p>In chicken, the &#946;1 and &#946;2 isoforms have been described as the differentially spliced products of a single gene, with the &#946;1 cDNA containing a 113 bp exon that is absent in the &#946;2 cDNA [<abbr bid="B4">4</abbr>]. To determine if the murine &#946;2 isoform is spliced in a manner identical to that of chicken, the sequence of the &#946;2 cDNA was compared to the corresponding genomic region. Sequence comparison revealed that alternative splicing of the &#946;2 gene occurs in an identical manner in mice. The mouse intron is also 113 bp in length with the exon sequence and surrounding intron sequence containing the canonical splice donor (AGA) and acceptor (AGG) sites at either end of the intron. The human gene for CP&#946; has a similar structure, based on the sequence of clone HS657E11, located at Chr1 p35.1-p36.23, from the Sanger Centre (<url>http://www.sanger.ac.uk/HGP/Chr1/</url>).</p>
         <p>To determine the chromosomal location of marine <it>Cappb1</it>, we identified interspecies variations of genomic sequences and mapped their chromosomal locations using an interspecies backcross panel from Jackson Laboratory [<abbr bid="B9">9</abbr>]. The mapping panel is anchored to maps from crosses by various known genes, retroviral loci, and the <it>D#Mit</it> loci. The strain distribution pattern of each polymorphism in the interspecific backcross was determined and used to position the <it>Cappb1</it> gene on the map (Figure <figr fid="F1">1</figr>).</p>
         <p>A region corresponding to the 3' UTR of the <it>Cappb1</it> gene was PCR-amplified using parental genomic DNA and gene-specific primers (5'TTTTCCCTCTTCCTTTCC3' and 5'ACTCCAAGCAACTCCCACAC3'). Direct sequencing of the PCR product identified two polymorphisms: 1) Nucleotides 1220-1224 (referring to Genbank Acc. No. U10406), C57BL/6J: CCCCC; M. spretus: CCCC, 2) Nucleotides 1336 1349: C57BL/6J: GGTGTGTGA-GAGAA and M. spretus: GGTGTGTGAAAGAGAA. Genomic DNA from the panel of 94 backcross animals was PCR-amplified using the aforementioned primers and then hybridized via dotblot analysis with four oligonucleotides: 5'AAGGAAGGGGGACAGG3', 5'AAGGAAGGGGACAGG3', 5'CTCTCACACA3', 5'CCACACACTTTCTCTT3', which specifically bound to each of the four polymorphic sequences, respectively. The resulting allele patterns were compared to those of other loci previously mapped in this cross to detect linkage.</p>
         <p>The CP&#946; gene (<it>Cappb1</it>) mapped to Chromosome 4 between <it>D4Mitl6</it> and <it>D4Mit13</it>. Additional linkage information is available at http://www.jax.org./resources/documents/cmdata. Mouse Genome Database accession numbers for the mapping data are J:55295 (<it>Cappb1</it>). The order of loci (with recombination distances in centimorgans, cM and standard error) and intergenic distances for the CP&#946; gene (Figure <figr fid="F1">1</figr> and <figr fid="F2">2</figr>) is as follows: <it>Cappb1</it>: Nearby genes include <it>Cdc42 and Afar. D4Mit339-</it> (1.06 &#177; 1.06 cM) <it>-D4Bwg0593e-</it> (1.06 &#177; 1.06 cM) <it>-Cdc42-</it> (1.06 &#177; 1.06 cM) <it>-Afar, Cappb1-</it> (4.25 &#177; 2.08 cM)- <it>D4Mit312</it>.</p>
         <p>To determine if the <it>Cappb1</it> gene was equivalent to a locus that had previously been mapped thereby identifying a possible association with an existing mutant, the Jackson Laboratory Mouse Genome Database (MGD) and the Mouse Chromosome Committee Report (1999) were scanned for loci that lie within 10 cM of the map positions of <it>Cappb1</it>. snubnose (<it>sn</it>), curly tail (<it>ct</it>), and cribriform  degeneration (<it>cri</it>) are candidate mutants for <it>Cappb1</it>.</p>
         <p>The likelihood that <it>Cappb1</it> and <it>sno, ct</it> and <it>cri</it> map to the same position was evaluated by determining the confidence intervals associated with their map positions (Figure <figr fid="F3">3</figr>). <it>Cappb1</it> (66.8 cM, MGD) was mapped relative to the well-established anchoring locus <it>D4Mitl3</it> (71 cM, MGD), with 5 recombinants in 94 backcross samples. At 95% confidence, the upper and lower limits are 2.5 and 12.5, respectively [<abbr bid="B10">10</abbr>]. <it>sno</it> (58.3 cM, MGD) was mapped relative to tyrosinase related protein, <it>Tyrp1</it>, (39 cM, MGD) with 92 recombinants in 535 backcross animals providing confidence limits of 14 and 20.5 [<abbr bid="B11">11</abbr>]. <it>cri</it> (69 cM, MGD) was mapped relative to <it>Tyrp1</it>, but raw mapping data were not reported, which precludes determination of the confidence limits [<abbr bid="B12">12</abbr>]. <it>ct</it> (69 cM) was mapped relative to <it>D4Mitl3</it> with 26 recombinants in 272 backcross animals providing confidence limits of 6.6 and 13.7. The confidence intervals of <it>ct</it> and <it>Cappb1</it> overlap, indicating that equivalency of these loci are not ruled out by the mapping data. Because the confidence interval of the mapping of <it>cri</it> could not be determined, the equivalency of <it>cri</it> and <it>Cappb1</it> cannot be ruled out. The confidence intervals of <it>sno</it> and <it>Cappb1</it> do not overlap, indicating that these loci are not equivalent.</p>
         <p>Analysis of the mutant phenotype for <it>cri</it> and <it>ct</it> is a way to evaluate their potential roles. Mutations in <it>cri</it> have a severe neurological defect that can be traced to vacuolar degeneration in white and gray matter of the spinal cord and brainstem [<abbr bid="B13">13</abbr>]. Mutations in <it>ct</it> have some degree of spina bifida which results in a curly tail and occasionally, exencephaly [<abbr bid="B14">14</abbr>]. Mutations in <it>sno</it> are recognized by their short noses and have spina bifida occulta in their lumbar, posterior thoracic and sacral vertebrae [<abbr bid="B15">15</abbr>]. Additional studies will be necessary to determine whether these loci encode or map to <it>Cappb1</it>.</p>
         <p>Comparative gene mapping between mouse and human has revealed numerous regions of homologous genome organization [<abbr bid="B16">16</abbr>]. The mapping of <it>Cappb1</it> supports the evolutionary conservation between the two species. The chromosomal assignment of the mouse CP&#946; gene to Chromosome 4 is consistent with the localization of the human CP&#946; gene to chromosome 1 position p36.1. These regions of the mouse and human chromosomes have conserved synteny.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Haplotype data for the mapping of the mouse CP&#946; gene showing a portion of Chromosome 4 with loci linked to <it>Cappb1</it>.</p>
            </caption>
            <text>
               <p>Haplotype data for the mapping of the mouse CP&#946; gene showing a portion of Chromosome 4 with loci linked to <it>Cappb1.</it> Loci are listed in order with the most proximal at the top. The black boxes represent the C57BL6/J allele and the white boxes the SPRET/Ei allele. The number of animals with each haplotype is given at the bottom of each column of boxes. The percent recombination (R) between adjacent loci is listed to the right, with the standard error (SE) for each R. Missing typings were inferred from surrounding data where assignment was unambiguous.</p>
            </text>
            <graphic file="1471-2164-1-1-1"/>
         </fig>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Map from the Jackson BSS backcross showing part of Chromosome 4.</p>
            </caption>
            <text>
               <p>Map from the Jackson BSS backcross showing part of Chromosome 4. The centromere is toward the top. Loci mapping to the same position are listed in alphabetical order. Missing typings were inferred from surrounding data where assignment was unambiguous. Raw data from Jackson Laboratory were obtained from <url>http://www.jax.org./resources/documents/cmdata</url>.</p>
            </text>
            <graphic file="1471-2164-1-1-2"/>
         </fig>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>The confidence limits of the mapping <it>of Cappb1 and</it> its candidate genes: snubnose (<it>sno</it>), curly tail (<it>ct</it>), and cribriform degeneration (<it>cri</it>).</p>
            </caption>
            <text>
               <p>The confidence limits of the mapping <it>of Cappb1 and</it> its candidate genes: snubnose (<it>sno</it>), curly tail (<it>ct</it>), and cribriform degeneration (<it>cri</it>). The chromosomal region where <it>Cappb1</it> and the candidate genes reside is depicted. The MGD map positions are indicated above. 95% confidence intervals based on specific mapping experiments, discussed in the text, are indicated below.</p>
            </text>
            <graphic file="1471-2164-1-1-3"/>
         </fig>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>The CP&#946; gene (<it>Cappb1</it>) mapped to Chromosome 4 between <it>Cdc42</it> and <it>D4Mit312</it>. Three mouse mutations, snubnose, curly tail, and cribriform degeneration, map in the vicinity of the &#946; gene.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgments</p>
            </st>
            <p>We thank Lucy Rowe and Mary Barter of the Jackson Laboratory for their advice and assistance with the backcross panels and the interpretation of the genetic mapping data. This work was supported by a grant from NIH (GM38542). M.H. was supported by an American Heart Association Post-Doctoral Fellowship and was a member of the Lucille P. Markey Pathway for Human Pathobiology. J.A.C. was an Established Investigator of the American Heart Association.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p> The &#945; and &#946; subunits of nematode actin capping protein function in yeast</p>
            </title>
            <aug>
               <au>
                  <snm>Waddle</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Waterston</snm>
                  <fnm>RH</fnm>
               </au>
            </aug>
            <source>Molecular Biology of the Cell</source>
            <pubdate>1993</pubdate>
            <volume>4</volume>
            <fpage>907</fpage>
            <lpage>917</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8257793</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p> Actin organization, bristle morphology, and viability are affected by actin capping protein mutations in <it>Drosophila.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hopmann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>KG</fnm>
               </au>
            </aug>
            <source> Journal of Cell Biology</source>
            <pubdate>1996</pubdate>
            <volume>133</volume>
            <fpage>1293</fpage>
            <lpage>1305</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.133.6.1293</pubid>
                  <pubid idtype="pmpid" link="fulltext">8682865</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Disruption of the actin cytoskeleton in yeast capping protein mutants</p>
            </title>
            <aug>
               <au>
                  <snm>Amatruda</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Tatchell</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hug</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1990</pubdate>
            <volume>344</volume>
            <fpage>352</fpage>
            <lpage>354</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/344352a0</pubid>
                  <pubid idtype="pmpid">2179733</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Differential localization and sequence analysis of capping protein &#946;-subunit isoforms of vertebrates.</p>
            </title>
            <aug>
               <au>
                  <snm>Schafer</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Korshunova</snm>
                  <fnm>YO</fnm>
               </au>
               <au>
                  <snm>Schroer</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Journal of Cell Biology</source>
            <pubdate>1994</pubdate>
            <volume>127</volume>
            <fpage>453</fpage>
            <lpage>465</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.127.2.453</pubid>
                  <pubid idtype="pmpid" link="fulltext">7929588</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Vertebrates have conserved capping protein alpha isoforms with specific expression patterns</p>
            </title>
            <aug>
               <au>
                  <snm>Hart</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Korshunova</snm>
                  <fnm>YO</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Cell Motil Cytoskeleton</source>
            <pubdate>1997</pubdate>
            <volume>38</volume>
            <fpage>120</fpage>
            <lpage>132</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1097-0169(1997)38:2&lt;120::AID-CM2>3.3.CO;2-L</pubid>
                  <pubid idtype="pmpid" link="fulltext">9331217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>CP&#946;-3, a Novel Isoform of an Actin- Binding Protein, is a Component of the CytoskeletalCalyx of the Mammalian Sperm Head.</p>
            </title>
            <aug>
               <au>
                  <snm>von Bulow</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rackwitz</snm>
                  <fnm>HR</fnm>
               </au>
               <au>
                  <snm>Zimbelmann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Franke</snm>
                  <fnm>WW</fnm>
               </au>
            </aug>
            <source>Experimental Cell Research</source>
            <pubdate>1997</pubdate>
            <volume>233</volume>
            <fpage>216</fpage>
            <lpage>224</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/excr.1997.3564</pubid>
                  <pubid idtype="pmpid" link="fulltext">9184090</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p/>
            </title>
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Molecular Cloning. A Laboratory Manual., Second edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press;</source>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B8">
            <title>
               <p> A lambda DNA protocol based on purification of phage on DEAE-cellulose.</p>
            </title>
            <aug>
               <au>
                  <snm>Helms</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Dutchik</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>MV</fnm>
               </au>
            </aug>
            <source>Methods Enzymol</source>
            <pubdate>1987</pubdate>
            <volume>153</volume>
            <fpage>69</fpage>
            <lpage>82</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0076-6879(87)53048-8</pubid>
                  <pubid idtype="pmpid">2963200</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p> Maps from two interspecific backcross DNA panels available as a community genetic mapping resource</p>
            </title>
            <aug>
               <au>
                  <snm>Rowe</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Nadeau</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Turner</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Frankel</snm>
                  <fnm>WN</fnm>
               </au>
               <au>
                  <snm>Letts</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Eppig</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Ko</snm>
                  <fnm>MSH</fnm>
               </au>
               <au>
                  <snm>Thurston</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Birkenmeier</snm>
                  <fnm>EH</fnm>
               </au>
            </aug>
            <source>Mammalian Genome</source>
            <pubdate>1994</pubdate>
            <volume>5</volume>
            <fpage>253</fpage>
            <lpage>274</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8075499</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p/>
            </title>
            <aug>
               <au>
                  <snm>Silver</snm>
                  <fnm>LM</fnm>
               </au>
            </aug>
            <source>Mouse genetics: concepts and applications. New York: Oxford University Press;</source>
            <pubdate>1995</pubdate>
         </bibl>
         <bibl id="B11">
            <title>
               <p> Research notes: testcross linkage data for snubnose and brown</p>
            </title>
            <aug>
               <au>
                  <snm>Hollander</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>Mouse News Letter</source>
            <pubdate>1966</pubdate>
            <volume>34</volume>
         </bibl>
         <bibl id="B12">
            <title>
               <p> Cribriform degeneration (cri).</p>
            </title>
            <aug>
               <au>
                  <snm>Green</snm>
                  <fnm>MN</fnm>
               </au>
            </aug>
            <source>Mouse News Letter</source>
            <pubdate>1972</pubdate>
            <volume>47</volume>
            <fpage>37</fpage>
         </bibl>
         <bibl id="B13">
            <title>
               <p> Cribriform degeneration (cri): a new recessive neurological mutation in the mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Green</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Sidman</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Pivetta</snm>
                  <fnm>OH</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1972</pubdate>
            <volume>176</volume>
            <fpage>800</fpage>
            <lpage>803</lpage>
            <xrefbib>
               <pubid idtype="pmpid">5031475</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p> Genetical studies on the skeleton of the mouse. VIII. Curlytail.</p>
            </title>
            <aug>
               <au>
                  <snm>Gruneberg</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Genet</source>
            <pubdate>1954</pubdate>
            <volume>52</volume>
            <fpage>52</fpage>
            <lpage>67</lpage>
         </bibl>
         <bibl id="B15">
            <title>
               <p> Genetic spina bifida occulta in the mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Hollander</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>Am J Anat</source>
            <pubdate>1976</pubdate>
            <volume>146</volume>
            <fpage>173</fpage>
            <lpage>179</lpage>
            <xrefbib>
               <pubid idtype="pmpid">782223</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Anchored reference loci for comparative mapping in mammals</p>
            </title>
            <aug>
               <au>
                  <snm>O'Brien</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Womack</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Lyons</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Copeland</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>Nature Genetics</source>
            <pubdate>1993</pubdate>
            <volume>3</volume>
            <fpage>103</fpage>
            <lpage>112</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8499943</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
