All lbab/lbab mice housed at the University of Tennessee Health Science Center died before 7 days of age with remarkable changes in organ weight and body size (Fig. 1, Table 1). No detectable differences in survival rate or body size were noted between the lbab/+ and +/+ mice.

Previous genetic analysis showed that the lbab mutation is located on mouse Chr 1 and is flanked by molecular markers D1Mit9 and D1Mit488 4. According to the Ensembl database, D1Mit488 is located between 91902920–91903043 bps. However, there is no physical position for D1Mit9 in the database, although we know from TJL database that it is positioned at 53.5 cM. From TJL's mouse genome informatics database, we found 13 molecular markers at the 53.5 cM position. The positions of most of these 8 markers are near 84 Mb 9. Accordingly, we decided to start our investigation in the region between 83 and 90 Mb (Fig. 2A). Genomic sequences within this region are complete in the Ensembl database. There are a total of 122 transcripts, 70 of which represent genes and 52 represent expressed sequence tags (ESTs) (Table 2).

Because lbab mice are bred on a C57BL/6J (B6) background, we assumed that the majority of the background genome carrying the lbab mutation was from the B6 strain. Therefore, we isolated genomic DNA from both B6 and lbab/lbab mice. We designed 528 pairs of primers flanking first and last exons of 122 candidate transcripts by using Primer3 software10. We obtained the primers commercially (Illumina, San Diego, CA) and conducted PCR amplification with genomic DNAs from lbab/lbab and B6 mice, which were regarded as normal controls. The PCR products were then analyzed for the presence of sequence differences between lbab/lbab and normal mice by using the RevealTM system (SpectruMedix LLC, PA). We found variations in 25 PCR products between normal B6 and lbab/lbab mice (Table 3).

We speculated that the identified sequence variations were likely to arise from the close linkage between the mutated gene and nearby sequences in the parental PL/J strain, even though the background of lbab mice was mainly on the B6 strain. To determine if this were the case, we isolated DNA from PL/J mice obtained from TJL and amplified the 25 variable fragments by using the same panel of primers. By comparing those DNA fragments with those from lbab/lbab mice, we did not find sequence differences between DNA products from lbab/lbab and PL/J mice (data not shown), suggesting that those 25 variations represent polymorphisms between PL/J and B6.

Because of the recognition of sequence polymorphisms between PL/J and B6 mice in the targeted region, we made two changes in our follow-up screening. First, we switched our controls from B6 to PL/J mice. Using another panel of primers (n = 240 pairs) for PCR amplification of every exon of all candidate genes, we identified only one DNA fragment from lbab/lbab mice that was different from PL/J mice DNA. This fragment was from exon 2 of the gene ENSMUSG00000026241, representing the gene for natriuretic peptide precursor C (Nppc). The same pair of primers for this fragment was used for further genotyping as indicated in material and methods.

Because we used PL/J mice as controls for this cycle of screening, there was another concern that the sequence variation might be a polymorphism derived from the B6 strain. To address this issue, we used PCR amplification of genomic DNA from B6 mice and compared results to the PCR products from PL/J and lbab/lbab mice. The data showed that the amplified DNA fragment from lbab/lbab mice was different from both B6 and PL/J mice, while the fragments from PL/J and B6 were the same (Fig. 2B). To find out which nucleotide(s) was different between lbab/lbab and PL/J controls, we sequenced genomic DNA fragments from PL/J and lbab/lbab mice. The data revealed a C→G change from PL/J to lbab/lbab mice (Fig. 3A, left panel).

To confirm the same difference at the cDNA level, we performed reverse transcriptase PCR (RT-PCR) on total RNAs from lbab/lbab, lbab/+, and +/+ mice by using primers that covered the mRNA sequence from exon 2 to exon 3 of the Nppc. The resultant RT-PCR products were sequenced using the SpectruMedix system, and the same C→G transversion from PL/J to lbab/lbab mice was found (Fig. 3A, right panel)

To evaluate the potential consequence of this point mutation in Nppc, we examined the translated amino acid sequence of Nppc. We found that this transversion predicts the substitution of arginine (R) for glycine (G) in a conserved domain of Nppc protein (Fig. 3B).

We conducted further experiments to confirm the single nucleotide change in the Nppc gene. Based on our initial screening, we think that it is very likely that the C→G change in exon 2 of the Nppc gene is causally related to the phenotypes in lbab/lbab mice. Because the lbab mutation arose from PL/J, theoretically, there should be no difference in the Nppc sequence between lbab and PL/J mice except the mutation. In addition, this single nucleotide replacement is the only change between homozygous lbab/lbab and homozygous normal PL/J mice in 122 transcripts. However, we could not completely rule out the possibility that we may have missed other mutations/polymorphisms. Moreover, one could question whether this is a spontaneous polymorphism in mouse strains or a random mutation that arose after the lbab was separated from the PL/J. Therefore, we carried out two more experiments to further ensure the association between the mutation and the disease. First, we examined sequence polymorphism in exon 2 of Nppc from nine other inbred strains (Fig. 2C). As shown in Fig. 2D, each such mixture showed multiple bands, indicating the difference between lbab/lbab and those strains. Second, we bred 200 mice from heterozygous lbab/+ parents to evaluate allele frequency in relation to the phenotype. We genotyped every offspring by using the original pair of primers that flank exon 2 of the Nppc gene. From those progeny, we found 14 lbab/lbab mice that exhibited a genotype of homozygous G/G nucleotide and a phenotype of lbab mice, while the remaining progeny had 74 homozygous C/C and 112 heterozygous C/G genotypes, all with a normal phenotype. Taken together, our data indicate that the C→G transversion in exon 2 of the Nppc gene is associated with the phenotypes observed in lbab mice.

A heterozygous (lbab/+) breeding pair of mice was purchased from TJL, and a breeding colony was established at the research animal facility of the University of Tennessee Health Science Center (UTHSC). Experimental animal procedures and mouse husbandry were performed in accordance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals and approved by the UTHSC Institutional Animal Care and Use Committee.

Information about microsatellite markers and their locations were obtained from the Mouse Genome Informatics website 8 and the Ensembl mouse genome database 9. The sequence data used in the paper were based on the information as of March 20, 2005.

Genomic DNAs (gDNA) were extracted from the livers of phenotypically normal +/+ and lbab/+ mice, as well as from mutant lbab/lbab mice, by using a Qiagen Genomic-tip20/G (Qiagen, Alameda, CA) following the manufacturer's instructions. After determining the quality and quantity of the DNA in an Eppendorf photometer (Eppendorf Scientific, Westbury, NY), we used DNAs for large-scale mutational screening. Total RNAs were extracted from femurs by using Trizol reagent (Invitrogen, Carlsbad, CA), and the quality of the total RNA was checked by electrophoresis on a Spectronic Genesys spectrophotometer (Spectronic Instruments, Rochester, NY).

The gDNAs from lbab/lbab, lbab/+, and +/+ mice were used for temperature gradient capillary electrophoresis (TGCE) and sequence analysis using Reveal™ system (SpectruMedix; State College, PA). Based on the Ensembl and National Center for Biotechnology Information (NCBI) databases, primer pairs flanking the exons of known and predicted genes (including ESTs) within the lbab locus were designed using Primer3 software 10. Primers were located approximately 100 bp 5' or 3' to each exon and, in general, produced 300–400 bp amplicons. For large exons that required multiple pairs of primers, primers were designed to allow neighboring DNA fragments to overlap each other by at least 50 bps. Primer pairs were synthesized from Illumina (San Diego, CA). PCR amplification of gDNA was performed in a 96-well plate format and consisted of 30–35 cycles at three temperatures: strand denaturation at 96°C for 30 sec, primer annealing at 54–60°C for 60 sec, and primer extension at 72°C for 120 sec. A TGCE device made by SpectruMedix was used to analyze amplicons from +/+, +/lbab, and lbab/lbab mice. The SpectruMedix system includes a high-throughput capillary electrophoresis instrument capable of analyzing 96 samples every 140 min. Heteroduplex analysis was subsequently performed using SpectruMedix software. Amplicons from lbab mice were sequenced if they differed from normal ones.

A pair of primers flanking the position of a single nucleotide mutation of the Nppc gene (forward primer: CTCTTGGGTGCAGAGCTAGG; reverse primer: AGCTGGTGGCAATCAGAAAA) was used to genotype +/+, lbab/+, and lbab/lbab mice. The PCR products from heterozygous and homozygous mice were mixed with those from normal mice. The individual and mixed PCR products were then run on TGCE to detect possible sequence variations. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl₂ concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min.

One-step RT-PCR kit (Invitrogen, Carlsbad, CA) was used to detect the expression of mutated Nppc at the mRNA level. Reactions were performed in a total volume of 50 μl with 8 ng/μl of total RNA, and 0.2 μM forward (AGCTGGTGGCAATCAGAAAA) and reverse (TCAGTGCACAGAGCAGTTCC) primers were used to amplify exons 2 to 3 of Nppc. First, cDNA synthesis and pre-denaturation were performed in single cycles at 50°C for 40 min and 94°C for 2 min. Next, PCR amplification was performed for 35 cycles: 94°C for 30 sec, 54–58°C for 36 sec, and 72°C for 2 min.

DNA sequencing was conducted to verify the mutation in the gDNA and cDNA of Nppc from different species of mice. PCR products from both gDNA and cDNA were purified using an AMPure PCR Purification Kit (Agencourt, Beverly, MA), and the resultant products were sequenced using the BigDye^® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). A total volume of 5 μl sequencing reactions including 2 μl Big Dye (plus Half-BD), 10–23 ng of purified DNA template, and 1–3 ρmoles of either forward or reverse universal sequencing primers was incubated for 37 cycles at 96°C for 180 sec, 50°C for 30 sec, and 60°C for 180 sec. Unreacted primers were removed by ethanol-acetate precipitation (3.75% 3 M NaOAc, 87.5% nondenatured 100% EtOH, and 8.75% dH₂O, pH 4.6). The labeled products were dissolved in 0.02 mM EDTA in HiDi formamide prior to electrophoretically loading onto the SpectruMedix 96 capillary sequencing system. The same primers in the amplification of DNA fragments from either genomic DNA or mRNA were also used in the sequencing. Sequencing was conducted twice to verify the results for both gDNA and cDNA.

The body weight and body length for individual mice were measured at an average age of 5.5 days after birth. The weight and length differences between normal and lbab mice were analyzed for their statistical significance by using two-tail t-test with a cutoff p value of < 0.05.