<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2156-7-29</ui>
   <ji>1471-2156</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Linkage disequilibrium blocks, haplotype structure, and htSNPs of human CYP7A1 gene</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Nakamoto</snm>
               <fnm>Kaori</fnm>
               <insr iid="I1"/>
               <email>knakamoto@kumc.edu</email>
            </au>
            <au id="A2">
               <snm>Wang</snm>
               <fnm>Shuang</fnm>
               <insr iid="I2"/>
               <email>shuang.wang@columbia.edu</email>
            </au>
            <au id="A3">
               <snm>Jenison</snm>
               <mi>D</mi>
               <fnm>Robert</fnm>
               <insr iid="I3"/>
               <email>rob.jenison@gmail.com</email>
            </au>
            <au id="A4">
               <snm>Guo</snm>
               <mi>L</mi>
               <fnm>Grace</fnm>
               <insr iid="I1"/>
               <email>lguo@kumc.edu</email>
            </au>
            <au id="A5">
               <snm>Klaassen</snm>
               <mi>D</mi>
               <fnm>Curtis</fnm>
               <insr iid="I1"/>
               <email>cklaasse@kumc.edu</email>
            </au>
            <au id="A6">
               <snm>Wan</snm>
               <mnm>Yvonne</mnm>
               <fnm>Yu-Jui</fnm>
               <insr iid="I1"/>
               <email>ywan@kumc.edu</email>
            </au>
            <au id="A7" ca="yes">
               <snm>Zhong</snm>
               <fnm>Xiao-bo</fnm>
               <insr iid="I1"/>
               <email>xzhong@kumc.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Biostatistics, Mailman School of Public Health, Columbia University, New York, NY 10032, USA</p>
            </ins>
            <ins id="I3">
               <p>Inverness Medical-Biostar, Louisville, CO 80027, USA</p>
            </ins>
         </insg>
         <source>BMC Genetics</source>
         <issn>1471-2156</issn>
         <pubdate>2006</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>29</fpage>
         <url>http://www.biomedcentral.com/1471-2156/7/29</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16709249</pubid>
               <pubid idtype="doi">10.1186/1471-2156-7-29</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>10</day>
               <month>2</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>18</day>
               <month>5</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>18</day>
               <month>5</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>Nakamoto et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Cholesterol 7-alpha-hydroxylase (CYP7A1) is the rate limiting enzyme for converting cholesterol into bile acids. Genetic variations in the CYP7A1 gene have been associated with metabolic disorders of cholesterol and bile acids, including hypercholesterolemia, hypertriglyceridemia, arteriosclerosis, and gallstone disease. Current genetic studies are focused mainly on analysis of a single nucleotide polymorphism (SNP) at A-278C in the promoter region of the CYP7A1 gene. Here we report a genetic approach for an extensive analysis on linkage disequilibrium (LD) blocks and haplotype structures of the entire CYP7A1 gene and its surrounding sequences in Africans, Caucasians, Asians, Mexican-Americans, and African-Americans.</p>
            </sec>
            <sec>
               <st>
                  <p>Result</p>
               </st>
               <p>The LD patterns and haplotype blocks of CYP7A1 gene were defined in Africans, Caucasians, and Asians using genotyping data downloaded from the HapMap database to select a set of haplotype-tagging SNPs (htSNP). A low cost, microarray-based platform on thin-film biosensor chips was then developed for high-throughput genotyping to study transferability of the HapMap htSNPs to Mexican-American and African-American populations. Comparative LD patterns and haplotype block structure was defined across all test populations.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>A constant genetic structure in CYP7A1 gene and its surrounding sequences was found that may lead to a better design for association studies of genetic variations in CYP7A1 gene with cholesterol and bile acid metabolism.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Cholesterol 7-alpha-hydroxylase (CYP7A1) catalyzes the first reaction in the cholesterol catabolic pathway in liver. This pathway converts cholesterol to bile acids, which is the primary mechanism for the removal of cholesterol from the body. The CYP7A1 catalytic reaction is the rate-limiting step and the major site for regulating homeostasis of cholesterol and bile acids. The gene encoding CYP7A1 was cloned by using a rat homolog probe <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> and mapped to chromosome 8q11 <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The CYP7A1 gene spans about 10 kb and contains 6 exons, 5 introns, one 5'-UTR, and one 3'-UTR. In its 5' flanking region, consensus recognition sequences for a number of transcription factors were identified <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. A TATA box and a modified CAAT box were also identified in the promoter region of the CYP7A1 gene <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. Numerous laboratories have illustrated a multiplex nuclear receptor mediated network that controls CYP7A1 gene expression and maintains cholesterol and bile acid balance <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. Within this network, nuclear receptors of farnesoid X receptor (FXR), liver X receptor (LXR), retinoid X receptor (RXR), small heterodimer partner (SHP), and liver receptor homologue 1 (LRH1) are involved in a positive-versus-negative regulation. Using a FXR-deficient (-/-) mouse model, we have demonstrated feedback suppression on CYP7A1 gene transcription by FXR <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>.</p>
         <p>Genetic variations in the CYP7A1 gene associated to disorders of cholesterol and bile acid metabolism have been studied extensively in different laboratories. Most studies have focused on a single nucleotide polymorphism (SNP) in the promoter region of the CYP7A1 gene. This is an A/C transversion polymorphism at -278 from the translation initiation codon, or -204 from the transcriptional start site. This polymorphism was first reported by Wang et al. <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> to link to high plasma low-density lipoprotein cholesterol concentrations. Association of this polymorphism to plasma lipid levels, hypertriglyceridemia, hypercholesterolemia, and risk to arteriosclerosis, gallstone disease, and colorectal cancer has been studied in adults and children in Caucasian and Asian populations with conflicting results <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. A CYP7A1 enzyme deficiency caused by a homozygous 1302&#8211;1303 delTT deletion mutation in CYP7A1 exon 6, leading to a frameshift (L413fsX414), has been linked to a hypercholesterolaemic phenotype <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The information has indicated that genetic variations in the CYP7A1 gene have high impact on human cholesterol metabolic regulation and human health; however, these studies have mainly focused on a single polymorphism or a mutation. Linkage of genes for a complex disease relies on having <it>a priori </it>knowledge of linkage disequilibrium (LD) blocks and haplotype structure to identify polymorphisms that are associated with the disease. Therefore, it is important to determine whether there are LD blocks existing in the CYP7A1 gene in different populations. This information can be used to identify a set of haplotype-tagging SNP (htSNP) markers that can be used in an association study.</p>
         <p>The LD blocks and haplotype structure of CYP7A1 gene can be firstly defined in three general human populations of Africans, Asians, and Caucasians using a public-available database generated by the International HapMap Project <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. The HapMap LD patterns and haplotype structure can serve as reference to select htSNPs for an association study. LD patterns and htSNPs defined by the HapMap Project are transferable to other populations in some loci, but may vary significantly in other loci <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. To test whether the htSNPs identified in the HapMap populations are useful for association studies in other populations, we analyzed LD patterns and haplotype structures of CYP7A1 gene in both Mexican-American and African-American populations using the selected HapMap htSNPs. Mexican-American is the fastest growing population in USA, but genetic study on this population is extremely limited. Mexican-American genetic background is a mixture of European American (50&#8211;60%) (mainly Spanish), American Indian (30&#8211;40%), and African (&lt;5%) <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. African-American is the major minority population in USA and has an admixture genetic background from African and European Americans <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>. Genotyping of the selected htSNPs on these two populations can provide verification of transferability of the HapMap htSNPs among populations.</p>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <sec>
            <st>
               <p>Linkage disequilibrium blocks and haplotype structures of CYP7A1 gene in Caucasians, Africans, and Asians</p>
            </st>
            <p>A LD block is found in the HapMap Caucasians (CEU) spanning a 14-kb region from the proximal promoter (rs3824260) to the 3'-downstream (rs10504255) of the CYP7A1 gene (Figure <figr fid="F1">1</figr>. CEU-B1). A similar LD block from rs3824260 to the 3'-downstream was also reported in a Swedish population <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. About 4.4 kb upstream from rs3824260, there is another LD block (CEU-B2) crossing a 3-kb region at the distal promoter region. Recombination between the two blocks is 0.84. Only five haplotypes with a frequency > 2% exist in CEU-B1 (Figure <figr fid="F2">2</figr>. CEU-B1H1 to CEU-B1H5). CEU-B1H1 and CEU-B1H2 are two common haplotypes, together representing a total of 68% of the haplotype frequency in CEU-B1. CEU-B1H1 carries common alleles at all markers except rs8192879 in 3'-UTR, whereas CEU-B1H2 is composed of less common alleles at 5 out of 8 loci. In CEU-B2, there are only two types of haplotypes (CEU-B2H1 and CEU-B2H2). CEU-B2H1 carries common alleles at all SNP loci, whereas CEU-B2H2 has less common alleles. A similar LD pattern is found in the HapMap African YRI (Figure <figr fid="F1">1</figr>), but the larger LD block (YRI-B1) is slight shorter (9 kb from rs8192879 to rs3824260) than CEU-B1. The haplotype structure is also similar between YRI and CEU, however, the frequency of each haplotype is different. The most common haplotype (55%) in YRI-B1, YRI-B1H1, has identical haplotype structure with CEU-B1H2, whereas the second common haplotype in YRI-B1, YRI-B1H2 (22.5%), is the same as CEU-B1H1. YRI-B1H1 and YRIB1H2 together add up to 77.5% of the total haplotypes in YRI-B1. In YRI-B2, the dominant haplotype YRI-B2H1 has the same haplotype structure as CEU-B2H2, whereas less common haplotype YRI-B2H2 is identical to the common haplotype CEU-B2H1. A similar recombination (0.81) is also found between YRI-B1 and YRI-B2. In CHB and JPT, only one LD block is found from the distal promoter to a part of the CYP7A1 gene. Although the JPT-B1 (16 kb, from rs8192879 to rs1023649) is larger than CHB-B1 (10 kb, from rs1457043 to rs1023650), LD is weak between rs8192879 in intron 4 and rs1457043 in intron 2 in JPT. CHB and JPT share almost the same haplotype structure within the block. JPT-B1H1, JPT-B1H2 and JPT-B1H3 are the same as CHB-B1H1, CHB-B1H2 and CHB-B1H3, respectively. Only CHB-B1H4 (6%) is unique in CHB.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Linkage disequilibrium of the SNP markers in the CYP7A1 gene in the HapMap populations of CEU, CHB, JPT and YRI</p>
               </caption>
               <text>
                  <p>Linkage disequilibrium of the SNP markers in the CYP7A1 gene in the HapMap populations of CEU, CHB, JPT and YRI. A standard color scheme is used to display LD with bright red color for very strong LD (LOD = 2 D' = 1), white color for no LD (LOD&lt;2, D'&lt;1), pink red (LOD = 2 D'&lt;1), and blue (LOD&lt;2 D' = 1) for intermediate LD.</p>
               </text>
               <graphic file="1471-2156-7-29-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Haplotype frequencies of the HapMap selected SNPs in the CYP7A1 gene in CEU, YRI, JPT, and CHB</p>
               </caption>
               <text>
                  <p>Haplotype frequencies of the HapMap selected SNPs in the CYP7A1 gene in CEU, YRI, JPT, and CHB. In each haplotype, blue bars represent allele 1, whereas red bars represent allele 2 for correlated SNPs. Black bars indicate that the SNPs are not present in this population. Numbers next to each haplotype bar are haplotype frequencies. Up-side-down red triangles indicate htSNPs in the populations. In the crossing areas, a value of multiallelic D' is shown to represent the level of recombination between the two blocks.</p>
               </text>
               <graphic file="1471-2156-7-29-2"/>
            </fig>
            <p>In comparison of LD and haplotype structure among the HapMap populations, strong LD is found from the distal promoter region to intron 2 of the CYP7A1 gene across the HapMap populations. Two common haplotypes with complete opposite alleles at all loci (common-versus-less common alleles) within this region count for more than 85% of total haplotype frequencies in all four HapMap populations. A diverted LD degree exists between intron 2 and the 3'-downstream region from high to low across CEU, YRI, JPT, and CHB.</p>
         </sec>
         <sec>
            <st>
               <p>Genotyping of htSNPs in Mexican-Americans and African-Americans</p>
            </st>
            <p>Because of the strong LD in the CYP7A1 genes, some markers correlate 100% with each other in a population. Only a subset of representative SNPs is necessary for defining a haplotype. These SNPs can tag either neighboring markers or a set of common haplotypes within an LD block. The htSNPs in CYP7A1 were selected using Tagger, implemented in the HaploView 3.12, which combines the simplicity of pairwise methods with the potential efficiency of multimarker approaches <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. The CYP7A1 htSNPs are different in the various populations (see upside-down red triangles in Figure <figr fid="F2">2</figr> for each HapMap population). Some markers tag on all three populations, but others for only one or two. It has been suggested that the populations genotyped in the HapMap project may serve as reference populations for the selection of htSNP markers in association studies <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>.</p>
            <p>Nine SNP markers and one short deletion marker were selected (see detail in Table <tblr tid="T3">3</tblr>), in which, eight are htSNP markers defined by the HapMap populations, including rs3808607, a functional polymorphism at A-278C in the promoter region. Two functional mutations were also included. One is a two-base deletion in exon 6 (1302 delTT) causing a frame shift and CYP7A1 enzyme deficiency <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The other one is a C/T SNP in exon 3, causing an amino acid change at Asn233Ser. This is the only non-synonymous SNP reported in NCBI SNP database in the CYP7A1 gene.</p>
            <p>To perform genotyping of the 10 markers in the Mexican-American and African-American populations, a high-throughput and inexpensive SNP genotyping platform was developed using thin-film biosensor chips. We have reported a microarray platform for genotyping both SNPs and microsattelite repeat on thin-film biosensor chips <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>. The thin-film biosensor chip has excellent sensitivity of detection and extremely low non-specific binding, making it an excellent platform for discrimination of polymorphisms <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. A positive reaction (blue color signal) can be visualized over the unreacted background (gold color) by an unaided human eye, without any instrumentation. Once the chips are printed, they are robust. Several thousands of genotypes can be performed in a 96-well plate in a laboratory with a standard molecular genetics setting within a few hours. Cost for reagents and materials to genotype 10 CYP7A1 htSNPs, including genomic DNA isolation, PCR reaction, and SNP genotyping on the thin-film biosensor chips, is ~US$0.20 per SNP per sample. It is relative less expensive than other high-throughput genotype platforms, such as TaqMan or Real-time PCR.</p>
            <p>To verify genotyping specificity on the thin-film biosensor chips, a pool of the synthetic targets for allele 1 or allele 2 was applied to a chip for hybridization and ligation. After signals were developed, the result images were captured by a black-white camera on a Nucleosite&#8482; Image Analyzer (Biostar, Inc., Louisville, Colorado). High specificity was achieved on these synthetic targets with unambiguous genotypes (see images in Figure <figr fid="F3">3B</figr> and <figr fid="F3">3C</figr>). A negative control showed the signals are target dependent (Figure <figr fid="F3">3D</figr>). As a positive control for genotyping, 12 HapMap DNA samples were purchased from Coriell Cell Repositories (Camden, NJ), which are one family trio from YRI (NA18500, NA18501 and NA18502); one family trio from CEU (NA06985, NA06991, and NA06993); three independent individuals from CHB (NA18524, NA18526, and NA18529); and three independent individuals from JPT (NA18940, NA18942, and NA18943). Genotypes of the 8 HapMap htSNPs in the 12 HapMap samples were determined on thin-film biosensor chips. A 100% concordance was obtained between the 96 genotypes generated by thin-film biosensor chips and the 96 genotypes downloaded from the HapMap database which are generated by Illumina Bead Assay.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Genotyping of the 10 markers of CYP7A1 htSNPs and small deletion on thin-film biosensor chips</p>
               </caption>
               <text>
                  <p>Genotyping of the 10 markers of CYP7A1 htSNPs and small deletion on thin-film biosensor chips. A. A design for arraying the capture probes on a thin-film biosensor chip. A pair of capture probes for each SNP were arrayed in duplicate next to each other with allele 1 left and allele 2 right. M indicates a positive control marker with 20 dATP and 3'-biotin. B. SNP discrimination with a pool of synthetic oligonucleotide targets of allele 1. C. SNP discrimination with a pool of synthetic oligonucleotide targets of allele 2. D. Negative control with no targets. E. A representative image showing genotypes of a Mexican-American individual with homozygous allele 1 for the most markers, but homozygous allele 2 for rs8192879. F. A representative image showing genotypes of a Mexican-American individual with homozygous allele 2 for the most markers, but homozygous allele 1 for rs18192879, rs11786580, rs8192874, 1302 TT. G. A representative image showing genotypes of a Mexican-American individual with heterozygous for the most markers except rs8192874, 1302 TT.</p>
               </text>
               <graphic file="1471-2156-7-29-3"/>
            </fig>
            <p>To define the LD pattern and haplotype structures of CYP7A1 gene in Mexican-American and African-American populations, DNA samples from 90 healthy individuals for each population were randomly selected from our DNA bank. These DNA samples were collected by other research projects on alcoholism in the Mexican-American population <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and pharmacogenomics of CYP enzymes in both Mexican-Americans and African-Americans <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>. Genotypes of the 10 selected markers on the 90 Mexican-American and 90 African-American subjects were determined by using the thin-film biosensor chip platform. Representative images of the different genotypes from different individuals are shown in Figure <figr fid="F3">3E, 3F</figr>, and <figr fid="F3">3G</figr>. Genotypes of each individual on the 10 markers were saved in linkage format and uploaded to HaploView. Observed genotype frequencies, allele frequencies, expected heterozygosity, and Hardy-Weinberg p-value of the 10 markers is summarized in Table <tblr tid="T5">5</tblr>. No significant HW p-values (&lt;0.0010) were found. No TT deletion mutation at 1302 and C mutation at rs8192874 were detected in these two population samples. This indicates that these mutations have very low frequencies in the general populations. The genotyping data of the 8 htSNPs were uploaded to HaploView 3.12 to define LD patterns and haplotypes structures of CYP7A1. In Mexican-Americans, three LD blocks were identified. In comparison to the CEU LD blocks, MA-B3 in the distal promoter region has the same pattern as CEU-B2, but haplotype frequencies are different. MA-B3H1 has a frequency (78%) higher than CEU-B2H1 (55%). Unlike one big block in CEU, the CYP7A1 gene is divided by two LD blocks in the Mexican-American population. MA-B2 covers from proximal promoter to intron 2, whereas MA-B1 extents from 3'-UTR to 3'-downstream. The recombination frequencies between the blocks are 80&#8211;90%. In African-Americans, two LD blocks were recognized. AA-B2 has the identical structure as YRI-B2 and frequencies of the two haplotypes (AA-B2H1 and AA-B2H1) in the African-American population are almost the same as YRI-B2H1 and YRI-B2H2. AA-B1 is shorter than YRI-B1. The HapMap htSNPs are necessary SNP markers to capture all haplotypes in the MA and AA populations.</p>
            <p>In summary, the human CYP7A1 gene and its surrounding sequences have constant genetic structures across all populations. This genetic structure can be divided into three components: (1) the distal promoter region, about 7-kb upstream from the transcriptional start code, there is a 3-kb LD block highly conserved across all populations. Only two haplotypes exist in this region in the most populations, except YRI. The most common haplotype in CEU and Mexican-American becomes the second most common haplotypes in YRI, African-American, CHB, and JPT populations. (2) A relative conserved LD block is present in the proximal part of CYP7A1 gene from the proximal promoter region (about 500 bp from the transcriptional start code) to intron 2 of CYP7A1. The two most conserved haplotypes count for up to 80 to 90% of the haplotype frequencies in all populations in this region. (3) A much diverted LD pattern is observed in the lower part of the CYP7A1 gene (from intron 4 to 3'-downstream). In CEU and YRI, a complete or partial LD block is merged to the block in the proximal part of the CYP7A1 gene. In Mexican-Americans, a LD block in this region is separated from the block in the proximal part of the CYP7A1 gene. In JPT, a weak linkage makes the proximal part block extended into the 3'-UTR. In CHB and African-Americans, there is no LD existing in this area.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Here we demonstrate a genetic approach to analyze LD patterns and haplotype blocks in CYP7A1 gene. Various degree of LD is found across different regions in different populations. A set of htSNPs is identified that can be used in an association study to capture common haplotypes in different populations. An inexpensive genotyping platform on thin-film biosensor chips is established to genotype the htSNPs. This chip technology can be applied in any laboratory with basic molecular genetic setting. The defined haplotype block structure in CYP7A1 gene may lead to a better design for genetic association studies to correlate genetic variations in CYP7A1 gene to cholesterol and bile acid metabolism and human diseases, such as gallstone disease. Because of high polymorphism and strong LD in the promoter region of CYP7A1, it should be considered in future studies to evaluate which CYP7A1 promoter haplotypes are more efficient for transcriptional regulation by its regulatory factors, such as FXR, LXR, RXR, PXR, SHP, and LRH1.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Human subject</p>
            </st>
            <p>The DNA samples for the HapMap come from a total of 270 people: 90 individuals from the Yoruba of Ibadan, Nigeria (YRI), (30 sets of trios, each trio with samples from two parents and an adult child); 90 individuals (30 sets of trios) from U.S. residents with northern and western European ancestry collected by the Centre d'Etude du Polymorphisme Humain (CEU); 45 unrelated individuals from the Tokyo area in Japan (JPT); and 45 unrelated individuals from Beijing, China (CHB). Two American population samples of Mexican-Americans and African-Americans were also used in this study. These DNA samples were collected by other research projects on alcoholism in the Mexican-American population <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and pharmacogenomics of CYP enzymes in African-Americans <abbrgrp><abbr bid="B32">32</abbr></abbrgrp>. Studies on these human subjects were approved by the Human Subjects Committee of the Kansas University Medical Center. Ninety DNA samples of healthy individuals were randomly selected from each population.</p>
         </sec>
         <sec>
            <st>
               <p>Analysis of linkage disequilibrium blocks and haplotype structure</p>
            </st>
            <p>LD patterns and haplotype structures of CYP7A1 gene in the HapMap populations were analyzed by using genotype data from the HapMap database. In the HapMap Phase II database, a total of about 5.9 million SNPs (about 1 SNP every 500 bp across the genome) are typed in the four HapMap populations <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. Genotypes of each selected SNP in the 270 HapMap population samples can be downloaded from its database <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Fourteen SNPs are genotyped by the HapMap project in a total of 25 kb region with 10 kb of 5'-upstream flanking, 5 kb of 3'-downstream flanking, and the CYP7A1 gene sequences. The SNP density is about 1.8 kb per SNP. The CYP7A1 A-278C (or A-204C) promoter polymorphism is included with an ID number of rs3808607. A close promoter polymorphism C-554T, which was identified together with A-278C by Wang et al. <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, is also included as rs3824260. Chromosomal positions and locations in the CYP7A1 gene regions of the 14 SNPs are listed in Table <tblr tid="T1">1</tblr> with polymorphic allele 1 for common allele and allele 2 for less common allele in CEU. Genotypes of each individual samples for the 14 SNP markers were dumped from the HapMap database and saved as a HapMap formatted file that can be opened directly by HaploView 3.12 for defining LD patterns and haplotype structure <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Four HapMap files were separately saved for CEU, CHB, JPT, and YRI, respectively. By uploading the files into HaploView, frequencies of allele 2, frequencies of observed heterozygous genotypes, and Hardy-Weinberg <it>p</it>-value for each marker were summarized for each population (see Table <tblr tid="T2">2</tblr>). No marker has a HW <it>p</it>-value smaller than the cutoff value of 0.0010 in the four populations. The LD between any two markers was defined by HaploView 3.12. A standard color scheme is used to display LD in Figure <figr fid="F1">1</figr>. A LD block was created by confidence intervals <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> if 95% of the informative comparisons are in strong LD using default algorithms of 95% confidence bounds on D prime. Haplotypes structure was defined by using an accelerated EM algorithm, similar to the partition/ligation method <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. This creates highly accurate population frequency estimates of the phased haplotypes, based on the maximum likelihood as determined from the unphased input. Haplotypes with frequency > 2% in a block in CEU, YRI, JPT, and CHB are displayed in Figure <figr fid="F2">2</figr>. Alleles with blue boxes and red boxes represent common alleles and less common alleles in CEU, defined as Allele 1 and Allele 2, respectively. In the crossing areas, a value of multiallelic D' is shown to represent the level of recombination between the two blocks.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Chromosomal positions and gene locations of the 14 CYP7A1 SNPs</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>#</p>
                     </c>
                     <c ca="center">
                        <p>SNP ID</p>
                     </c>
                     <c ca="center">
                        <p>Chromosome position</p>
                     </c>
                     <c ca="center">
                        <p>Location in CYP7A1 gene</p>
                     </c>
                     <c ca="center">
                        <p>Variation* Allele 1/2</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>rs10504255</p>
                     </c>
                     <c ca="center">
                        <p>59448422</p>
                     </c>
                     <c ca="center">
                        <p>3'-downstream</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>rs10957057</p>
                     </c>
                     <c ca="center">
                        <p>59450301</p>
                     </c>
                     <c ca="center">
                        <p>3'-downstream</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>rs8192879</p>
                     </c>
                     <c ca="center">
                        <p>59453537</p>
                     </c>
                     <c ca="center">
                        <p>3'-UTR</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>rs11786580</p>
                     </c>
                     <c ca="center">
                        <p>59455901</p>
                     </c>
                     <c ca="center">
                        <p>Intron 4</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>rs3747809</p>
                     </c>
                     <c ca="center">
                        <p>59456945</p>
                     </c>
                     <c ca="center">
                        <p>Intron 4</p>
                     </c>
                     <c ca="center">
                        <p>T/C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>rs1457043</p>
                     </c>
                     <c ca="center">
                        <p>59460400</p>
                     </c>
                     <c ca="center">
                        <p>Intron 2</p>
                     </c>
                     <c ca="center">
                        <p>T/C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>rs2162459</p>
                     </c>
                     <c ca="center">
                        <p>59461003</p>
                     </c>
                     <c ca="center">
                        <p>Intron 1</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>rs3808607</p>
                     </c>
                     <c ca="center">
                        <p>59462885</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>T/G</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>rs3824260</p>
                     </c>
                     <c ca="center">
                        <p>59463151</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>G/A</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>rs7833904</p>
                     </c>
                     <c ca="center">
                        <p>59467623</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>T/A</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>rs3903445</p>
                     </c>
                     <c ca="center">
                        <p>59468303</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>G/T</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>rs1125226</p>
                     </c>
                     <c ca="center">
                        <p>59469472</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>rs1023649</p>
                     </c>
                     <c ca="center">
                        <p>59470379</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>rs1023652</p>
                     </c>
                     <c ca="center">
                        <p>59470577</p>
                     </c>
                     <c ca="center">
                        <p>5'-upstream</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* Variation allele sequences are based on the plus strand sequence.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Genotype frequencies of the 14 CYP7A1 SNPs in the four HapMap populations.</p>
               </caption>
               <tblbdy cols="15">
                  <r>
                     <c ca="left">
                        <p>#</p>
                     </c>
                     <c ca="left">
                        <p>SNP ID</p>
                     </c>
                     <c ca="left">
                        <p>Variation Allele 1/2</p>
                     </c>
                     <c ca="center">
                        <p>CEU</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CHB</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>JPT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>YRI</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>FA2</p>
                     </c>
                     <c ca="center">
                        <p>ObH</p>
                     </c>
                     <c ca="center">
                        <p>HW-p</p>
                     </c>
                     <c ca="center">
                        <p>FA2</p>
                     </c>
                     <c ca="center">
                        <p>ObH</p>
                     </c>
                     <c ca="center">
                        <p>HW-p</p>
                     </c>
                     <c ca="center">
                        <p>FA2</p>
                     </c>
                     <c ca="center">
                        <p>ObH</p>
                     </c>
                     <c ca="center">
                        <p>HW-p</p>
                     </c>
                     <c ca="center">
                        <p>FA2</p>
                     </c>
                     <c ca="center">
                        <p>ObH</p>
                     </c>
                     <c ca="center">
                        <p>HW-p</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="15">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>rs10504255</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>0.317</p>
                     </c>
                     <c ca="center">
                        <p>0.456</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.200</p>
                     </c>
                     <c ca="center">
                        <p>0.356</p>
                     </c>
                     <c ca="center">
                        <p>0.886</p>
                     </c>
                     <c ca="center">
                        <p>0.170</p>
                     </c>
                     <c ca="center">
                        <p>0.250</p>
                     </c>
                     <c ca="center">
                        <p>0.694</p>
                     </c>
                     <c ca="center">
                        <p>0.017</p>
                     </c>
                     <c ca="center">
                        <p>0.022</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>rs10957057</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                     <c ca="center">
                        <p>0.142</p>
                     </c>
                     <c ca="center">
                        <p>0.222</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.122</p>
                     </c>
                     <c ca="center">
                        <p>0.244</p>
                     </c>
                     <c ca="center">
                        <p>0.999</p>
                     </c>
                     <c ca="center">
                        <p>0.159</p>
                     </c>
                     <c ca="center">
                        <p>0.318</p>
                     </c>
                     <c ca="center">
                        <p>0.586</p>
                     </c>
                     <c ca="center">
                        <p>0.092</p>
                     </c>
                     <c ca="center">
                        <p>0.178</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>rs8192879</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                     <c ca="center">
                        <p>0.367</p>
                     </c>
                     <c ca="center">
                        <p>0.467</p>
                     </c>
                     <c ca="center">
                        <p>0.754</p>
                     </c>
                     <c ca="center">
                        <p>0.267</p>
                     </c>
                     <c ca="center">
                        <p>0.444</p>
                     </c>
                     <c ca="center">
                        <p>0.663</p>
                     </c>
                     <c ca="center">
                        <p>0.261</p>
                     </c>
                     <c ca="center">
                        <p>0.386</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.225</p>
                     </c>
                     <c ca="center">
                        <p>0.333</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>rs11786580</p>
                     </c>
                     <c ca="center">
                        <p>C/T</p>
                     </c>
                     <c ca="center">
                        <p>0.242</p>
                     </c>
                     <c ca="center">
                        <p>0.367</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.056</p>
                     </c>
                     <c ca="center">
                        <p>0.111</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.091</p>
                     </c>
                     <c ca="center">
                        <p>0.182</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.192</p>
                     </c>
                     <c ca="center">
                        <p>0.311</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>rs3747809</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>0.011</p>
                     </c>
                     <c ca="center">
                        <p>0.022</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.058</p>
                     </c>
                     <c ca="center">
                        <p>0.116</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>rs1457043</p>
                     </c>
                     <c ca="center">
                        <p>T/C</p>
                     </c>
                     <c ca="center">
                        <p>0.392</p>
                     </c>
                     <c ca="center">
                        <p>0.522</p>
                     </c>
                     <c ca="center">
                        <p>0.754</p>
                     </c>
                     <c ca="center">
                        <p>0.567</p>
                     </c>
                     <c ca="center">
                        <p>0.556</p>
                     </c>
                     <c ca="center">
                        <p>0.616</p>
                     </c>
                     <c ca="center">
                        <p>0.625</p>
                     </c>
                     <c ca="center">
                        <p>0.523</p>
                     </c>
                     <c ca="center">
                        <p>0.718</p>
                     </c>
                     <c ca="center">
                        <p>0.575</p>
                     </c>
                     <c ca="center">
                        <p>0.467</p>
                     </c>
                     <c ca="center">
                        <p>0.911</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>rs2162459</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>0.392</p>
                     </c>
                     <c ca="center">
                        <p>0.522</p>
                     </c>
                     <c ca="center">
                        <p>0.754</p>
                     </c>
                     <c ca="center">
                        <p>0.567</p>
                     </c>
                     <c ca="center">
                        <p>0.556</p>
                     </c>
                     <c ca="center">
                        <p>0.616</p>
                     </c>
                     <c ca="center">
                        <p>0.625</p>
                     </c>
                     <c ca="center">
                        <p>0.523</p>
                     </c>
                     <c ca="center">
                        <p>0.718</p>
                     </c>
                     <c ca="center">
                        <p>0.583</p>
                     </c>
                     <c ca="center">
                        <p>0.456</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>rs3808607</p>
                     </c>
                     <c ca="center">
                        <p>T/G</p>
                     </c>
                     <c ca="center">
                        <p>0.367</p>
                     </c>
                     <c ca="center">
                        <p>0.489</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.411</p>
                     </c>
                     <c ca="center">
                        <p>0.467</p>
                     </c>
                     <c ca="center">
                        <p>0.989</p>
                     </c>
                     <c ca="center">
                        <p>0.570</p>
                     </c>
                     <c ca="center">
                        <p>0.535</p>
                     </c>
                     <c ca="center">
                        <p>0.836</p>
                     </c>
                     <c ca="center">
                        <p>0.583</p>
                     </c>
                     <c ca="center">
                        <p>0.456</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>9</p>
                     </c>
                     <c ca="center">
                        <p>rs3824260</p>
                     </c>
                     <c ca="center">
                        <p>G/A</p>
                     </c>
                     <c ca="center">
                        <p>0.367</p>
                     </c>
                     <c ca="center">
                        <p>0.489</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.411</p>
                     </c>
                     <c ca="center">
                        <p>0.467</p>
                     </c>
                     <c ca="center">
                        <p>0.989</p>
                     </c>
                     <c ca="center">
                        <p>0.570</p>
                     </c>
                     <c ca="center">
                        <p>0.535</p>
                     </c>
                     <c ca="center">
                        <p>0.836</p>
                     </c>
                     <c ca="center">
                        <p>0.550</p>
                     </c>
                     <c ca="center">
                        <p>0.478</p>
                     </c>
                     <c ca="center">
                        <p>0.784</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>rs7833904</p>
                     </c>
                     <c ca="center">
                        <p>T/A</p>
                     </c>
                     <c ca="center">
                        <p>0.408</p>
                     </c>
                     <c ca="center">
                        <p>0.511</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.622</p>
                     </c>
                     <c ca="center">
                        <p>0.533</p>
                     </c>
                     <c ca="center">
                        <p>0.612</p>
                     </c>
                     <c ca="center">
                        <p>0.663</p>
                     </c>
                     <c ca="center">
                        <p>0.535</p>
                     </c>
                     <c ca="center">
                        <p>0.382</p>
                     </c>
                     <c ca="center">
                        <p>0.558</p>
                     </c>
                     <c ca="center">
                        <p>0.444</p>
                     </c>
                     <c ca="center">
                        <p>0.313</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>rs3903445</p>
                     </c>
                     <c ca="center">
                        <p>G/T</p>
                     </c>
                     <c ca="center">
                        <p>0.408</p>
                     </c>
                     <c ca="center">
                        <p>0.511</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.622</p>
                     </c>
                     <c ca="center">
                        <p>0.533</p>
                     </c>
                     <c ca="center">
                        <p>0.612</p>
                     </c>
                     <c ca="center">
                        <p>0.648</p>
                     </c>
                     <c ca="center">
                        <p>0.523</p>
                     </c>
                     <c ca="center">
                        <p>0.580</p>
                     </c>
                     <c ca="center">
                        <p>0.550</p>
                     </c>
                     <c ca="center">
                        <p>0.467</p>
                     </c>
                     <c ca="center">
                        <p>0.44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>rs1125226</p>
                     </c>
                     <c ca="center">
                        <p>A/C</p>
                     </c>
                     <c ca="center">
                        <p>0.398</p>
                     </c>
                     <c ca="center">
                        <p>0.517</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.622</p>
                     </c>
                     <c ca="center">
                        <p>0.533</p>
                     </c>
                     <c ca="center">
                        <p>0.612</p>
                     </c>
                     <c ca="center">
                        <p>0.663</p>
                     </c>
                     <c ca="center">
                        <p>0.535</p>
                     </c>
                     <c ca="center">
                        <p>0.382</p>
                     </c>
                     <c ca="center">
                        <p>0.575</p>
                     </c>
                     <c ca="center">
                        <p>0.456</p>
                     </c>
                     <c ca="center">
                        <p>0.343</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>rs1023649</p>
                     </c>
                     <c ca="center">
                        <p>A/G</p>
                     </c>
                     <c ca="center">
                        <p>0.415</p>
                     </c>
                     <c ca="center">
                        <p>0.517</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.622</p>
                     </c>
                     <c ca="center">
                        <p>0.533</p>
                     </c>
                     <c ca="center">
                        <p>0.612</p>
                     </c>
                     <c ca="center">
                        <p>0.648</p>
                     </c>
                     <c ca="center">
                        <p>0.523</p>
                     </c>
                     <c ca="center">
                        <p>0.580</p>
                     </c>
                     <c ca="center">
                        <p>0.575</p>
                     </c>
                     <c ca="center">
                        <p>0.456</p>
                     </c>
                     <c ca="center">
                        <p>0.343</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>rs1023652</p>
                     </c>
                     <c ca="center">
                        <p>C/G</p>
                     </c>
                     <c ca="center">
                        <p>0.408</p>
                     </c>
                     <c ca="center">
                        <p>0.511</p>
                     </c>
                     <c ca="center">
                        <p>1.0</p>
                     </c>
                     <c ca="center">
                        <p>0.433</p>
                     </c>
                     <c ca="center">
                        <p>0.556</p>
                     </c>
                     <c ca="center">
                        <p>0.616</p>
                     </c>
                     <c ca="center">
                        <p>0.314</p>
                     </c>
                     <c ca="center">
                        <p>0.488</p>
                     </c>
                     <c ca="center">
                        <p>0.665</p>
                     </c>
                     <c ca="center">
                        <p>0.125</p>
                     </c>
                     <c ca="center">
                        <p>0.189</p>
                     </c>
                     <c ca="center">
                        <p>0.073</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>FA2: frequency of allele 2; ObH: observed frequency of heterozygous genotypes; HW-p: Hardy-Weinberg p value.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Genotyping on thin-film biosensor chip</p>
            </st>
            <p>For each selected SNP, target DNA molecules from each sample were amplified by PCR. PCR primers were designed based on the following criteria to make the PCR reaction uniform: (1) product size should be 120&#8211;200 bp with about 50&#8211;100 base flanking sequences around the SNP site in both directions, and (2) annealing temperature should be about 60&#176;C for a standard PCR reaction condition. The best primer sets were selected by DS Gene Software version 1.5 (accelrys). The primer sequences for each SNP site are listed in Table <tblr tid="T4">4</tblr>. The selected primer sequences were synthesized by Invitrogen (Carlsbad, California). Multiple sets of the PCR products were amplified in a single PCR reaction.</p>
            <p>For each SNP, three oligonucleotide probes were synthesized. A pair of allele specific P-1 oligos, differing only in their 3'-terminal nucleotide sequence, generally has 40 nucleotides complementary to the corresponding target sequences, and an additional 10-dA residue at their 5'-ends that constitutes a "spacer". Their 5'-terminal nucleotide is modified with an aldehyde group, allowing covalent attachment to the chip surface <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. A second oligonucleotide probe (biotin-P2) with 20 nucleotides immediately adjacent to the SNP nucleotide carries a biotin at the 3' end for detection, and a phosphate at its 5' end for ligation. To test genotyping specificity, a pair of oligonucleotide targets was also synthesized. The P1, P2 and target sequences for each SNP are listed in Table <tblr tid="T4">4</tblr>. The synthesized P1 oligos were dissolved to 100 &#956;M in 0.1 M phosphate buffer, pH 7.8. A P1 working solution of 1 &#956;M in 0.1 M phosphate buffer, pH 7.8, and 10% glycerol was prepared for each P-1 probe before spotting. Twenty nano liter of the P1 working solution was spotted on a 7 &#215; 7 mm<sup>2 </sup>chip in an 8 per row &#215; 6 per column format, by a BioDot PC controlled dispense arrayer AD3200. A duplicate set of P1 probes were spotted on a chip with a spotting pattern shown in Figure <figr fid="F3">3A</figr>. After the spotted chips were incubated in a humidity-controlled chamber for at least 2 hrs, the chips were washed with 0.1% SDS, water, and air dried. A standard operating procedure for genotyping SNPs on the printed biosensor chips was described previously <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. An arrayed chip was assembled into a square well of a 96-well microtiter plate for hybridization. A ligation reaction was carried out in a microtiter plate well containing an arrayed chip. A reaction solution (100 &#956;l) contained 100 femtomoles of each relevant PCR amplicon of the 10 CYP7A1 SNPs, 10 nM P-2 probe (one for each SNP) and 5 units of mutant Ampligase in a buffer of 20 mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl<sub>2</sub>, 0.5 mM NAD, 0.01% Triton X-100, and 5 mg/ml alkaline treated casein. The ligation reaction was incubated for 20 min at 60&#176;C. 96 chips in a 96-well plate were processed simultaneously. After a stringent wash (3 times in 0.01 M NaOH at room temperature and 3 times in 0.1 &#215; SSC), the chips were incubated with an antibiotin-horse radish peroxidase (HRP) conjugate (1 &#956;g/ml in hybridization buffer) for 10 min, and the chips were rinsed with 0.1 &#215; SSC. 100 &#956;l of a precipitate-generating HRP substrate TMB (BioFx) was added to each chip and incubated for 5 min, rinsed in ddH<sub>2</sub>0, and air-dried.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>KN carried out the genotyping experiments. SW provided assistance on haplotype analysis. RDJ provide thin-film biosensor chip for genotyping and participated in the experiment design. GLG participated in the design of the study and data analysis. YYW provided Mexican-American and African-American samples for this study. CDK participated in study design and help preparation of manuscript. XBZ coordinated the experimental design and was responsible for quality control, data analysis and manuscript preparation. All authors read and approved the final manuscript.</p>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>LD patterns and haplotype structures of the CYP7A1 gene in Mexican-American and African-American populations</p>
            </caption>
            <text>
               <p>LD patterns and haplotype structures of the CYP7A1 gene in Mexican-American and African-American populations.</p>
            </text>
            <graphic file="1471-2156-7-29-4"/>
         </fig>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Ten selected genetic variations for CYP7A1 genotyping.</p>
            </caption>
            <tblbdy cols="4">
               <r>
                  <c ca="left">
                     <p>SNP</p>
                  </c>
                  <c ca="center">
                     <p>Allele 1/2</p>
                  </c>
                  <c ca="center">
                     <p>Position</p>
                  </c>
                  <c ca="left">
                     <p>Note</p>
                  </c>
               </r>
               <r>
                  <c cspan="4">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="left">
                     <p>3'-downstream</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in CEU</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="left">
                     <p>3'-UTR</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in CEU, JPT, and YRI</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT</p>
                  </c>
                  <c ca="center">
                     <p>TT/--</p>
                  </c>
                  <c ca="left">
                     <p>Exon 6</p>
                  </c>
                  <c ca="left">
                     <p>Frameshift, CYP7A1 deficiency, high hepatic cholesterol content</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="left">
                     <p>Intron 4</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in CEU, JPT, and YRI</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="left">
                     <p>Exon 3</p>
                  </c>
                  <c ca="left">
                     <p>Non-synonymous SNP, Asn33Ser</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs216245953</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="left">
                     <p>Intron 1</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in JPT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607</p>
                  </c>
                  <c ca="center">
                     <p>T/G</p>
                  </c>
                  <c ca="left">
                     <p>Promoter</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in CEU and JPT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904</p>
                  </c>
                  <c ca="center">
                     <p>T/A</p>
                  </c>
                  <c ca="left">
                     <p>5-upstream</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in YRI</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226</p>
                  </c>
                  <c ca="center">
                     <p>A/C</p>
                  </c>
                  <c ca="left">
                     <p>5-upstream</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in JPT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652</p>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="left">
                     <p>5'-upstream</p>
                  </c>
                  <c ca="left">
                     <p>HapMap htSNP in CEU</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <tbl id="T4">
            <title>
               <p>Table 4</p>
            </title>
            <caption>
               <p>Oligonucleotide sequences of capture probe P1, detection probe P2, synthetic targets, and PCR primers.</p>
            </caption>
            <tblbdy cols="2">
               <r>
                  <c ca="left">
                     <p>SNP</p>
                  </c>
                  <c ca="left">
                     <p>Oligonucleotide sequence</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 P1-A</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAAACCTGAGCACTAGCCAGCTGTGTTCTCAATTCTGTGTGTAA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 P1-G</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAAACCTGAGCACTAGCCAGCTGTGTTCTCAATTCTGTGTGTAG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-CTCTTTCCCAATATTTCAAT-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 Target for P1-A</p>
                  </c>
                  <c ca="left">
                     <p>ATTGAAATATTGGGAAAGAGTTACACACAGAATTGAGAACA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 Target for P1-G</p>
                  </c>
                  <c ca="left">
                     <p>ATTGAAATATTGGGAAAGAGCTACACACAGAATTGAGAACA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 Forward</p>
                  </c>
                  <c ca="left">
                     <p>TAAACCTGCCTTGTCACGC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs10504255 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>AGTTGCAAACGCTGGTTG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 P1-C</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAGAAAAAACAATCTGCCAATTAGAATACATATCTTTTCTTC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 P1-T</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAGAAAAAACAATCTGCCAATTAGAATACATATCTTTTCTTT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-GGAGACGGGATCTCACTAAG-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 Target for P1-C</p>
                  </c>
                  <c ca="left">
                     <p>CTTAGTGAGATCCCGTCTCCGAAGAAAAGATATGTATTCTA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 Target for P1-T</p>
                  </c>
                  <c ca="left">
                     <p>CTTAGTGAGATCCCGTCTCCAAAGAAAAGATATGTATTCTA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 Forward</p>
                  </c>
                  <c ca="left">
                     <p>ACCTGTAGTCTTAGCTACTCG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192879 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>CCTTAGGAAAAAACAATCTGCC</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 P1-C</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACATTTACAAGAACCTATTTTTATCCATATACTATCTGATGC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 P1-T</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACATTTACAAGAACCTATTTTTATCCATATACTATCTGATGT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-TGCGTGGCGATCACCGCTGC-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 Target for P1-C</p>
                  </c>
                  <c ca="left">
                     <p>GCAGCGGTGATCGCCACGCAGCATCAGATAGTATATGGATA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 Target for P1-T</p>
                  </c>
                  <c ca="left">
                     <p>GCAGCGGTGATCGCCACGCAACATCAGATAGTATATGGATA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 Forward</p>
                  </c>
                  <c ca="left">
                     <p>TCTAGGTGTTTAATGCAGCTTC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs11786580 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>GTCCCTTTATGCCTTTACCG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 P1-C</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATTCTCGTGCCTCAAGCTCTCTGCCAGTTTCTCCCGGGCAC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 P1-T</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATTCTCGTGCCTCAAGCTCTCTGCCAGTTTCTCCCGGGCAT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-TGTGCGCAGTCCTGAACATG-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 Target for P1-C</p>
                  </c>
                  <c ca="left">
                     <p>CATGTTCAGGACTGCGCACAGTGCCCGGGAGAAACTGGCAG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 Target for P1-T</p>
                  </c>
                  <c ca="left">
                     <p>CATGTTCAGGACTGCGCACAATGCCCGGGAGAAACTGGCAG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 Forward</p>
                  </c>
                  <c ca="left">
                     <p>TCAGTTCTGAGATGCTTTCCC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs8192874 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>AGTCTTTCCAGCCCTGGTAG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 P1-A</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATCTCTAGAGGTGGTTCACCCGTTTGCCTGTCAGACACAAA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 P1-G</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATCTCTAGAGGTGGTTCACCCGTTTGCCTGTCAGACACAAG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-TGTATGATAGACATGGATGA-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 Target for P1-A</p>
                  </c>
                  <c ca="left">
                     <p>TCATCCATGTCTATCATACATTTGTGTCTGACAGGCAAACG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 Target for P1-G</p>
                  </c>
                  <c ca="left">
                     <p>TCATCCATGTCTATCATACACTTGTGTCTGACAGGCAAACG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 Forward</p>
                  </c>
                  <c ca="left">
                     <p>AAATTGCAGAGCACAGCC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs2162459 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>TCAAAGTTTGAAGTCAGTGGG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 P1-G</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAAAGCAATCAGAGACCTGCAATACTTGATAAGTTGAAGG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 P1-T</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAAAGCAATCAGAGACCTGCAATACTTGATAAGTTGAAGT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-TCTCTCAAATATATGTTGAC-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 Target for P1-G</p>
                  </c>
                  <c ca="left">
                     <p>GTCAACATATATTTGAGAGACCTTCAACTTATCAAGTATTG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 Target for P1-T</p>
                  </c>
                  <c ca="left">
                     <p>GTCAACATATATTTGAGAGAACTTCAACTTATCAAGTATTG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 Forward</p>
                  </c>
                  <c ca="left">
                     <p>AGTCCACAGGTATCAGAAGTG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs3808607 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>CCCCAGGTCCGAATGTTAAG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 P1-A</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAGGAGAAAGCGTAAGTGCCCTGACAAAGAAAAGAGGTAA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 P1-T</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAGGAGAAAGCGTAAGTGCCCTGACAAAGAAAAGAGGTAT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-AGTTGCCAGAAAACCTGGCA-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 Target for P1-A</p>
                  </c>
                  <c ca="left">
                     <p>TGCCAGGTTTTCTGGCAACTTTACCTCTTTTCTTTGTCAGG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 Target for P1-T</p>
                  </c>
                  <c ca="left">
                     <p>TGCCAGGTTTTCTGGCAACTATACCTCTTTTCTTTGTCAGG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 Forward</p>
                  </c>
                  <c ca="left">
                     <p>AATGTGAGCAAGAAAGCCC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs7833904 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>GAACTCAGTTTATTTTGCCAGG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 P1-A</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAACTGGTTCATCAGACTTGCTGCGACCAATTAACCTTGA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 P1-C</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAACAACTGGTTCATCAGACTTGCTGCGACCAATTAACCTTGC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-CAGCTCAGGGAGAGAGAGAG-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 Target for P1-A</p>
                  </c>
                  <c ca="left">
                     <p>CTCTCTCTCTCCCTGAGCTGTCAAGGTTAATTGGTCGCAGC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 Target for P1-C</p>
                  </c>
                  <c ca="left">
                     <p>CTCTCTCTCTCCCTGAGCTGGCAAGGTTAATTGGTCGCAGC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 Forward</p>
                  </c>
                  <c ca="left">
                     <p>TTTCTCTCTCTCCCTCTTTCTC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1125226 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>CTGGTTCATCAGACTTGCTG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 P1-C</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAAAAATTCAAGTACCATAATATTCACCCCTTTAAAGAGTAC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 P1-G</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAAAAAATTCAAGTACCATAATATTCACCCCTTTAAAGAGTAG</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-AATTCAAAATTTCTAGCATA-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 Target for P1-C</p>
                  </c>
                  <c ca="left">
                     <p>TATGCTAGAAATTTTGAATTGTACTCTTTAAAGGGGTGAAT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 Target for P1-G</p>
                  </c>
                  <c ca="left">
                     <p>TATGCTAGAAATTTTGAATTCTACTCTTTAAAGGGGTGAAT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 Forward</p>
                  </c>
                  <c ca="left">
                     <p>TGGAATGCCAGTTACCCCAC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rs1023652 Reverse</p>
                  </c>
                  <c ca="left">
                     <p>GGTGATGGTCACACAATCTTTG</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT P1-TT</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATGTATTTTTATTGCAGACTTTTAAATATGATAGGTATCTT</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT P1-DEL</p>
                  </c>
                  <c ca="left">
                     <p>ALD-AAAAAAAAAATTTGTATTTTTATTGCAGACTTTTAAATATGATAGGTATC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT P2</p>
                  </c>
                  <c ca="left">
                     <p>Phosphate-GATGAAAACGGGAAGACAAA-biotin</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT Target for P1-TT</p>
                  </c>
                  <c ca="left">
                     <p>TGTCTTCCCGTTTTCATCAAGATACCTATCATATTTAAAA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT Target for P1-DEL</p>
                  </c>
                  <c ca="left">
                     <p>TGTCTTCCCGTTTTCATCGATACCTATCATATTTAAAA</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT Forward</p>
                  </c>
                  <c ca="left">
                     <p>ACTAGCTTAAAGGCGGTTTTC</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1302 delTT Reverse</p>
                  </c>
                  <c ca="left">
                     <p>CGATCCAAAGGGCATGTAG</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* Shadows indicate SNP nucleotides in P1 probe and target sequences.</p>
            </tblfn>
         </tbl>
         <tbl id="T5">
            <title>
               <p>Table 5</p>
            </title>
            <caption>
               <p>Allele frequencies of the selected CYP7A1 htSNPs and mutation markers A. in the Mexican-American population.</p>
            </caption>
            <tblbdy cols="10">
               <r>
                  <c ca="left">
                     <p>#</p>
                  </c>
                  <c ca="center">
                     <p>SNP ID</p>
                  </c>
                  <c ca="center">
                     <p>Variation Allele 1/2</p>
                  </c>
                  <c cspan="3" ca="center">
                     <p>Observed genotype frequencies</p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>Observed allele frequencies</p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>Hardy-Wenberg</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="7">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>Homo Allele 1</p>
                  </c>
                  <c ca="center">
                     <p>Hetero</p>
                  </c>
                  <c ca="center">
                     <p>Homo Allele 2</p>
                  </c>
                  <c ca="center">
                     <p>Allele 1</p>
                  </c>
                  <c ca="center">
                     <p>Allele 2</p>
                  </c>
                  <c ca="center">
                     <p>Expect heterozygous</p>
                  </c>
                  <c ca="center">
                     <p>P value</p>
                  </c>
               </r>
               <r>
                  <c cspan="10">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>rs10504255</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="center">
                     <p>0.71</p>
                  </c>
                  <c ca="center">
                     <p>0.25</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>0.84</p>
                  </c>
                  <c ca="center">
                     <p>0.16</p>
                  </c>
                  <c ca="center">
                     <p>0.27</p>
                  </c>
                  <c ca="center">
                     <p>0.79</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>rs8192879</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="center">
                     <p>0.41</p>
                  </c>
                  <c ca="center">
                     <p>0.42</p>
                  </c>
                  <c ca="center">
                     <p>0.18</p>
                  </c>
                  <c ca="center">
                     <p>0.61</p>
                  </c>
                  <c ca="center">
                     <p>0.39</p>
                  </c>
                  <c ca="center">
                     <p>0.47</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>rs11786580</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="center">
                     <p>0.75</p>
                  </c>
                  <c ca="center">
                     <p>0.25</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>0.87</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
                  <c ca="center">
                     <p>0.22</p>
                  </c>
                  <c ca="center">
                     <p>0.45</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>rs8192874</p>
                  </c>
                  <c ca="center">
                     <p>T/C</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>rs2162459</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="center">
                     <p>0.59</p>
                  </c>
                  <c ca="center">
                     <p>0.31</p>
                  </c>
                  <c ca="center">
                     <p>0.10</p>
                  </c>
                  <c ca="center">
                     <p>0.75</p>
                  </c>
                  <c ca="center">
                     <p>0.25</p>
                  </c>
                  <c ca="center">
                     <p>0.38</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>rs3808607</p>
                  </c>
                  <c ca="center">
                     <p>T/G</p>
                  </c>
                  <c ca="center">
                     <p>0.62</p>
                  </c>
                  <c ca="center">
                     <p>0.30</p>
                  </c>
                  <c ca="center">
                     <p>0.09</p>
                  </c>
                  <c ca="center">
                     <p>0.76</p>
                  </c>
                  <c ca="center">
                     <p>0.24</p>
                  </c>
                  <c ca="center">
                     <p>0.37</p>
                  </c>
                  <c ca="center">
                     <p>0.09</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>rs7833904</p>
                  </c>
                  <c ca="center">
                     <p>T/A</p>
                  </c>
                  <c ca="center">
                     <p>0.64</p>
                  </c>
                  <c ca="center">
                     <p>0.30</p>
                  </c>
                  <c ca="center">
                     <p>0.07</p>
                  </c>
                  <c ca="center">
                     <p>0.79</p>
                  </c>
                  <c ca="center">
                     <p>0.21</p>
                  </c>
                  <c ca="center">
                     <p>0.33</p>
                  </c>
                  <c ca="center">
                     <p>0.37</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>8</p>
                  </c>
                  <c ca="center">
                     <p>rs1125226</p>
                  </c>
                  <c ca="center">
                     <p>A/C</p>
                  </c>
                  <c ca="center">
                     <p>0.62</p>
                  </c>
                  <c ca="center">
                     <p>0.30</p>
                  </c>
                  <c ca="center">
                     <p>0.08</p>
                  </c>
                  <c ca="center">
                     <p>0.78</p>
                  </c>
                  <c ca="center">
                     <p>0.22</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
                  <c ca="center">
                     <p>0.18</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>9</p>
                  </c>
                  <c ca="center">
                     <p>rs1023652</p>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>0.67</p>
                  </c>
                  <c ca="center">
                     <p>0.26</p>
                  </c>
                  <c ca="center">
                     <p>0.07</p>
                  </c>
                  <c ca="center">
                     <p>0.81</p>
                  </c>
                  <c ca="center">
                     <p>0.19</p>
                  </c>
                  <c ca="center">
                     <p>0.32</p>
                  </c>
                  <c ca="center">
                     <p>0.14</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>10</p>
                  </c>
                  <c ca="center">
                     <p>1302 delTT</p>
                  </c>
                  <c ca="center">
                     <p>TT/&#8211;</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="10">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c cspan="10" ca="center">
                     <p>B. in the African-American population</p>
                  </c>
               </r>
               <r>
                  <c cspan="10">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>rs10504255</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="center">
                     <p>0.81</p>
                  </c>
                  <c ca="center">
                     <p>0.18</p>
                  </c>
                  <c ca="center">
                     <p>0.01</p>
                  </c>
                  <c ca="center">
                     <p>0.84</p>
                  </c>
                  <c ca="center">
                     <p>0.10</p>
                  </c>
                  <c ca="center">
                     <p>0.18</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>2</p>
                  </c>
                  <c ca="center">
                     <p>rs8192879</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="center">
                     <p>0.56</p>
                  </c>
                  <c ca="center">
                     <p>0.36</p>
                  </c>
                  <c ca="center">
                     <p>0.08</p>
                  </c>
                  <c ca="center">
                     <p>0.61</p>
                  </c>
                  <c ca="center">
                     <p>0.26</p>
                  </c>
                  <c ca="center">
                     <p>0.38</p>
                  </c>
                  <c ca="center">
                     <p>0.82</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>3</p>
                  </c>
                  <c ca="center">
                     <p>rs11786580</p>
                  </c>
                  <c ca="center">
                     <p>C/T</p>
                  </c>
                  <c ca="center">
                     <p>0.60</p>
                  </c>
                  <c ca="center">
                     <p>0.36</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
                  <c ca="center">
                     <p>0.87</p>
                  </c>
                  <c ca="center">
                     <p>0.22</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
                  <c ca="center">
                     <p>0.90</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>4</p>
                  </c>
                  <c ca="center">
                     <p>rs8192874</p>
                  </c>
                  <c ca="center">
                     <p>T/C</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>5</p>
                  </c>
                  <c ca="center">
                     <p>rs2162459</p>
                  </c>
                  <c ca="center">
                     <p>A/G</p>
                  </c>
                  <c ca="center">
                     <p>0.25</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
                  <c ca="center">
                     <p>0.41</p>
                  </c>
                  <c ca="center">
                     <p>0.75</p>
                  </c>
                  <c ca="center">
                     <p>0.58</p>
                  </c>
                  <c ca="center">
                     <p>0.49</p>
                  </c>
                  <c ca="center">
                     <p>0.01</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>6</p>
                  </c>
                  <c ca="center">
                     <p>rs3808607</p>
                  </c>
                  <c ca="center">
                     <p>T/G</p>
                  </c>
                  <c ca="center">
                     <p>0.23</p>
                  </c>
                  <c ca="center">
                     <p>0.36</p>
                  </c>
                  <c ca="center">
                     <p>0.40</p>
                  </c>
                  <c ca="center">
                     <p>0.76</p>
                  </c>
                  <c ca="center">
                     <p>0.58</p>
                  </c>
                  <c ca="center">
                     <p>0.49</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>7</p>
                  </c>
                  <c ca="center">
                     <p>rs7833904</p>
                  </c>
                  <c ca="center">
                     <p>T/A</p>
                  </c>
                  <c ca="center">
                     <p>0.20</p>
                  </c>
                  <c ca="center">
                     <p>0.50</p>
                  </c>
                  <c ca="center">
                     <p>0.30</p>
                  </c>
                  <c ca="center">
                     <p>0.79</p>
                  </c>
                  <c ca="center">
                     <p>0.55</p>
                  </c>
                  <c ca="center">
                     <p>0.50</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>8</p>
                  </c>
                  <c ca="center">
                     <p>rs1125226</p>
                  </c>
                  <c ca="center">
                     <p>A/C</p>
                  </c>
                  <c ca="center">
                     <p>0.20</p>
                  </c>
                  <c ca="center">
                     <p>0.49</p>
                  </c>
                  <c ca="center">
                     <p>0.31</p>
                  </c>
                  <c ca="center">
                     <p>0.78</p>
                  </c>
                  <c ca="center">
                     <p>0.56</p>
                  </c>
                  <c ca="center">
                     <p>0.49</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>9</p>
                  </c>
                  <c ca="center">
                     <p>rs1023652</p>
                  </c>
                  <c ca="center">
                     <p>C/G</p>
                  </c>
                  <c ca="center">
                     <p>0.33</p>
                  </c>
                  <c ca="center">
                     <p>0.38</p>
                  </c>
                  <c ca="center">
                     <p>0.29</p>
                  </c>
                  <c ca="center">
                     <p>0.81</p>
                  </c>
                  <c ca="center">
                     <p>0.49</p>
                  </c>
                  <c ca="center">
                     <p>0.50</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>10</p>
                  </c>
                  <c ca="center">
                     <p>1302 delTT</p>
                  </c>
                  <c ca="center">
                     <p>TT/--</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c ca="center">
                     <p>1.00</p>
                  </c>
                  <c ca="center">
                     <p>0</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* Shadows indicate SNP nucleotides in P1 probe and target sequences.</p>
            </tblfn>
         </tbl>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Eifm Glob providing mutant ampligase for SNP genotyping. This research is supported by an endowment grant from University of Kansas Medical Center and a NIH funded grant of AA012081 (Y.Y. Wan).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Molecular cloning and sequence analysis of cDNA encoding human cholesterol 7 alpha-hydroxylase</p>
            </title>
            <aug>
               <au>
                  <snm>Noshiro</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Okuda</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>1990</pubdate>
            <volume>268</volume>
            <fpage>137</fpage>
            <lpage>140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-5793(90)80992-R</pubid>
                  <pubid idtype="pmpid" link="fulltext">2384150</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Cloning of the human cholesterol 7-alpha-hydroxylase gene (CYP7) and localization to chromosome 8q11-q12</p>
            </title>
            <aug>
               <au>
                  <snm>Cohen</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Cali</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Jelinek</snm>
                  <fnm>DF</fnm>
               </au>
               <au>
                  <snm>Mehrabian</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sparkes</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Lusis</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Hobbs</snm>
                  <fnm>HH</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>1992</pubdate>
            <volume>14</volume>
            <fpage>153</fpage>
            <lpage>161</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0888-7543(05)80298-8</pubid>
                  <pubid idtype="pmpid">1358792</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Transcriptional regulation of the human cholesterol 7 alpha-hydroxylase gene</p>
            </title>
            <aug>
               <au>
                  <snm>Molowa</snm>
                  <fnm>DT</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Cimis</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Tan</snm>
                  <fnm>CP</fnm>
               </au>
            </aug>
            <source>Biochemistry</source>
            <pubdate>1992</pubdate>
            <volume>31</volume>
            <fpage>2539</fpage>
            <lpage>2544</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1021/bi00124a014</pubid>
                  <pubid idtype="pmpid">1312351</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms</p>
            </title>
            <aug>
               <au>
                  <snm>Chiang</snm>
                  <fnm>JY</fnm>
               </au>
            </aug>
            <source>J Hepatol</source>
            <pubdate>2004</pubdate>
            <volume>40</volume>
            <issue>3</issue>
            <fpage>539</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jhep.2003.11.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">15123373</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The farnesoid X-receptor is an essential regulator of cholesterol homeostasis</p>
            </title>
            <aug>
               <au>
                  <snm>Lambert</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Amar</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Guo</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Brewer</snm>
                  <fnm>HB</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Sinal</snm>
                  <fnm>CJ</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2003</pubdate>
            <volume>278</volume>
            <issue>4</issue>
            <fpage>2563</fpage>
            <lpage>70</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M209525200</pubid>
                  <pubid idtype="pmpid" link="fulltext">12421815</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Complementary roles of farnesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity</p>
            </title>
            <aug>
               <au>
                  <snm>Guo</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Lambert</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Negishi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Brewer</snm>
                  <fnm>HB</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Kliewer</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Sinal</snm>
                  <fnm>CJ</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2003</pubdate>
            <volume>278</volume>
            <issue>46</issue>
            <fpage>45062</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M307145200</pubid>
                  <pubid idtype="pmpid" link="fulltext">12923173</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Linkage between cholesterol 7-alpha-hydroxylase and high plasma low-density lipoprotein cholesterol concentrations</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Freeman</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Grundy</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Levine</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Guerra</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cohen</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1998</pubdate>
            <volume>101</volume>
            <fpage>1283</fpage>
            <lpage>1291</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">508682</pubid>
                  <pubid idtype="pmpid" link="fulltext">9502769</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Association of the A-204C polymorphism in the cholesterol 7alpha-hydroxylase gene with variations in plasma low density lipoprotein cholesterol levels in the Framingham Offspring Study</p>
            </title>
            <aug>
               <au>
                  <snm>Couture</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Otvos</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Cupples</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Schaefer</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Ordovas</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>J Lipid Res</source>
            <pubdate>1999</pubdate>
            <volume>40</volume>
            <issue>10</issue>
            <fpage>1883</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10508208</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Variable associationbetween genetic variation in the CYP7 gene promoter and plasma lipoproteins in three Canadian populations</p>
            </title>
            <aug>
               <au>
                  <snm>Hegele</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Harris</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Brunt</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>TK</fnm>
               </au>
               <au>
                  <snm>Hanley</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Zinman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Connelly</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Atherosclerosis</source>
            <volume>154</volume>
            <issue>3</issue>
            <fpage>579</fpage>
            <lpage>87</lpage>
            <note>2001, Feb 15</note>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0021-9150(00)00419-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">11257258</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Czech MONICA Study: Polymorphisms in CYP-7A1, not APOE, influence the change in plasma lipids in response to population dietary change in an 8 year follow-up; results from the Czech MONICA study</p>
            </title>
            <aug>
               <au>
                  <snm>Hubacek</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Pitha</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Skodova</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Poledne</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lanska</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Waterworth</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Humphries</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Talmud</snm>
                  <fnm>PJ</fnm>
               </au>
            </aug>
            <source>Clin Biochem</source>
            <pubdate>2003</pubdate>
            <volume>36</volume>
            <issue>4</issue>
            <fpage>263</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0009-9120(03)00025-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12810154</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Polymorphisms at cholesterol 7alpha-hydroxylase, apolipoproteins B and E and low density lipoprotein receptor genes in patients with gallbladder stone disease</p>
            </title>
            <aug>
               <au>
                  <snm>Jiang</snm>
                  <fnm>ZY</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>TQ</fnm>
               </au>
               <au>
                  <snm>Suo</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Feng</snm>
                  <fnm>DX</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cai</snm>
                  <fnm>XX</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>ZH</fnm>
               </au>
               <au>
                  <snm>Shang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>World J Gastroenterol</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <issue>10</issue>
            <fpage>1508</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15133863</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Association of 7alpha-hydroxylase gene polymorphism with levels of plasma lipids</p>
            </title>
            <aug>
               <au>
                  <snm>Zhou</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>SZ</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>GX</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>HK</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>KQ</fnm>
               </au>
            </aug>
            <source>Yi Chuan</source>
            <pubdate>2004</pubdate>
            <volume>26</volume>
            <issue>3</issue>
            <fpage>283</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15640003</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>CYP7A1 A-278C polymorphism affects the response of plasma lipids after dietary cholesterol or cafestol interventions in humans</p>
            </title>
            <aug>
               <au>
                  <snm>Hofman</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Weggemans</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Zock</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Schouten</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Katan</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Princen</snm>
                  <fnm>HM</fnm>
               </au>
            </aug>
            <source>J Nutr</source>
            <pubdate>2004</pubdate>
            <volume>134</volume>
            <issue>9</issue>
            <fpage>2200</fpage>
            <lpage>4</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15333704</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Genetic variation in the rate-limiting enzyme in cholesterol catabolism (cholesterol 7alpha-hydroxylase) influences the progression of atherosclerosis and risk of new clinical events</p>
            </title>
            <aug>
               <au>
                  <snm>Hofman</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Princen</snm>
                  <fnm>HM</fnm>
               </au>
               <au>
                  <snm>Zwinderman</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Jukema</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Clin Sci (Lond)</source>
            <pubdate>2005</pubdate>
            <volume>108</volume>
            <issue>6</issue>
            <fpage>539</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15707388</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>The A-204C polymorphism in the cholesterol 7alpha-hydroxylase (CYP7A1) gene determines the cholesterolemia responsiveness to a high-fat diet</p>
            </title>
            <aug>
               <au>
                  <snm>Kovar</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Suchanek</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hubacek</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Poledne</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Physiol Res</source>
            <pubdate>2004</pubdate>
            <volume>53</volume>
            <issue>5</issue>
            <fpage>565</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15479137</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Genetic polymorphism in cytochrome P450 7A1 and risk of colorectal cancer: the Fukuoka Colorectal Cancer Study</p>
            </title>
            <aug>
               <au>
                  <snm>Hagiwara</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kono</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Toyomura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nagano</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Mizoue</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Mibu</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kakeji</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Maehara</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Okamura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ikejiri</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Futami</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yasunami</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Maekawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Takenaka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ichimiya</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Imaizumi</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2005</pubdate>
            <volume>65</volume>
            <issue>7</issue>
            <fpage>2979</fpage>
            <lpage>82</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-04-3872</pubid>
                  <pubid idtype="pmpid" link="fulltext">15805302</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>A promoter polymorphism in cholesterol 7alpha-hydroxylase interacts with apolipoprotein E genotype in the LDL-lowering response to atorvastatin</p>
            </title>
            <aug>
               <au>
                  <snm>Kajinami</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Brousseau</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Ordovas</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Schaefer</snm>
                  <fnm>EJ</fnm>
               </au>
            </aug>
            <source>Atherosclerosis</source>
            <pubdate>2005</pubdate>
            <volume>180</volume>
            <issue>2</issue>
            <fpage>407</fpage>
            <lpage>15</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.atherosclerosis.2004.12.019</pubid>
                  <pubid idtype="pmpid" link="fulltext">15910869</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Common polymorphisms in the CYP7A1 gene do not contribute to variation in rates of bile acid synthesis and plasma LDL cholesterol concentration</p>
            </title>
            <aug>
               <au>
                  <snm>Abrahamsson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Krapivner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gustafsson</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Muhrbeck</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Eggertsen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Johansson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Persson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Angelin</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Ingelman-Sundberg</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bjorkhem</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Einarsson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hooft</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Atherosclerosis</source>
            <pubdate>2005</pubdate>
            <volume>182</volume>
            <issue>1</issue>
            <fpage>37</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16115473</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Linkage of the cholesterol 7alpha-hydroxylase gene and low-density lipoprotein cholesterol conditional on apolipoprotein E association: the National Heart, Lung, and Blood Institute Family Heart Study</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Myers</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Almasy</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Coon</snm>
                  <fnm>HH</fnm>
               </au>
               <au>
                  <snm>Arnett</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hunt</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Chin Med J (Engl)</source>
            <pubdate>2005</pubdate>
            <volume>118</volume>
            <issue>5</issue>
            <fpage>362</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15780204</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Human cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Pullinger</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Eng</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Salen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Shefer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Batta</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Erickson</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Verhagen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rivera</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Mulvihill</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Malloy</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kane</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>2002</pubdate>
            <volume>110</volume>
            <issue>1</issue>
            <fpage>109</fpage>
            <lpage>17</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">151029</pubid>
                  <pubid idtype="pmpid" link="fulltext">12093894</pubid>
                  <pubid idtype="doi">10.1172/JCI200215387</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>A haplotype map of the human genome</p>
            </title>
            <aug>
               <au>
                  <snm>Altshuler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brooks</snm>
                  <fnm>LD</fnm>
               </au>
               <au>
                  <snm>Chakravarti</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Donnelly</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <cnm>International HapMap Consortium</cnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>437</volume>
            <issue>7063</issue>
            <fpage>1299</fpage>
            <lpage>320</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature04226</pubid>
                  <pubid idtype="pmpid" link="fulltext">16255080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Linkage disequilibrium patterns and htSNP transferability among European populations</p>
            </title>
            <aug>
               <au>
                  <snm>Mueller</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Lohmussaar</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Magi</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Remm</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bettecken</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lichtner</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Biskup</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Illig</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Pfeufer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Luedemann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schreiber</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Pramstaller</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pichler</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Romeo</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Gaddi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Testa</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wichmann</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Metspalu</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meitinger</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <issue>3</issue>
            <fpage>387</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1196391</pubid>
                  <pubid idtype="pmpid" link="fulltext">15637659</pubid>
                  <pubid idtype="doi">10.1086/427925</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Mexican American ancestry-informative markers: examination of population structure and marker characteristics in European Americans, Mexican Americans, Amerindians and Asians</p>
            </title>
            <aug>
               <au>
                  <snm>Collins-Schramm</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Chima</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Morii</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Wah</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Figueroa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Criswell</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Hanson</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Knowler</snm>
                  <fnm>WC</fnm>
               </au>
               <au>
                  <snm>Silva</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Belmont</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2004</pubdate>
            <volume>114</volume>
            <issue>3</issue>
            <fpage>263</fpage>
            <lpage>71</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00439-003-1058-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">14628215</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Markers that discriminate between European and African ancestry show limited variation within Africa</p>
            </title>
            <aug>
               <au>
                  <snm>Collins-Schramm</snm>
                  <fnm>HE</fnm>
               </au>
               <au>
                  <snm>Kittles</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Operario</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Weber</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Criswell</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>MF</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2002</pubdate>
            <volume>111</volume>
            <issue>6</issue>
            <fpage>566</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00439-002-0818-z</pubid>
                  <pubid idtype="pmpid" link="fulltext">12436248</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Haploview: analysis and visualization of LD and haplotype maps</p>
            </title>
            <aug>
               <au>
                  <snm>Barrett</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Fry</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Maller</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <issue>2</issue>
            <fpage>263</fpage>
            <lpage>265</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/bth457</pubid>
                  <pubid idtype="pmpid" link="fulltext">15297300</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The HapMap project and its application to genetic studies of drug response</p>
            </title>
            <aug>
               <au>
                  <snm>Deloukas</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bentley</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Pharmacogenomics J</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <issue>2</issue>
            <fpage>88</fpage>
            <lpage>90</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.tpj.6500226</pubid>
                  <pubid idtype="pmpid" link="fulltext">14676823</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips</p>
            </title>
            <aug>
               <au>
                  <snm>Zhong</snm>
                  <fnm>XB</fnm>
               </au>
               <au>
                  <snm>Reynolds</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kidd</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Kidd</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Jenison</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Marlar</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2003</pubdate>
            <volume>100</volume>
            <issue>20</issue>
            <fpage>11559</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">208797</pubid>
                  <pubid idtype="pmpid" link="fulltext">12975525</pubid>
                  <pubid idtype="doi">10.1073/pnas.1934783100</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Simultaneous detection of microsatellite repeats and SNPs in the macrophage migration inhibitory factor (MIF) gene by thin-film biosensor chips and application to rural field studies</p>
            </title>
            <aug>
               <au>
                  <snm>Zhong</snm>
                  <fnm>XB</fnm>
               </au>
               <au>
                  <snm>Leng</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Beitin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>McDonald</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hsiao</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Jenison</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Kang</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Thuma</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bray-Ward</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Bucala</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nuclear Acid Research</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <issue>13</issue>
            <fpage>e121</fpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/nar/gni123</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Interference-based detection of nucleic acid targets on optically coated silicon</p>
            </title>
            <aug>
               <au>
                  <snm>Jenison</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Haeberli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Polisky</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Nature Biotech</source>
            <pubdate>2001</pubdate>
            <volume>19</volume>
            <issue>1</issue>
            <fpage>62</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/83530</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Genetic polymorphism of CYP2E1, ADH2, and ALDH2 in Mexican-Americans</p>
            </title>
            <aug>
               <au>
                  <snm>Wan</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Poland</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>KM</fnm>
               </au>
            </aug>
            <source>Genet Test</source>
            <pubdate>1998</pubdate>
            <volume>2</volume>
            <issue>1</issue>
            <fpage>79</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10464602</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>CYP2D6 polymorphism in a Mexican American population</p>
            </title>
            <aug>
               <au>
                  <snm>Mendoza</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wan</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Poland</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Berman</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>KM</fnm>
               </au>
            </aug>
            <source>Clin Pharmacol Ther</source>
            <pubdate>2001</pubdate>
            <volume>70</volume>
            <issue>6</issue>
            <fpage>552</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mcp.2001.120675</pubid>
                  <pubid idtype="pmpid" link="fulltext">11753272</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Analysis of the CYP2D6 gene polymorphism and enzyme activity in African-Americans in southern California</p>
            </title>
            <aug>
               <au>
                  <snm>Wan</snm>
                  <fnm>YJ</fnm>
               </au>
               <au>
                  <snm>Poland</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Konishi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Berman</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>KM</fnm>
               </au>
            </aug>
            <source>Pharmacogenetics</source>
            <pubdate>2001</pubdate>
            <volume>11</volume>
            <issue>6</issue>
            <fpage>489</fpage>
            <lpage>99</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/00008571-200108000-00004</pubid>
                  <pubid idtype="pmpid" link="fulltext">11505219</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Partition-ligation-expectation-maximization algorithm for haplotype inference with single-nucleotide polymorphisms</p>
            </title>
            <aug>
               <au>
                  <snm>Qin</snm>
                  <fnm>ZS</fnm>
               </au>
               <au>
                  <snm>Niu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2002</pubdate>
            <volume>71</volume>
            <issue>5</issue>
            <fpage>1242</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">385113</pubid>
                  <pubid idtype="pmpid">12452179</pubid>
                  <pubid idtype="doi">10.1086/344207</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>HapMap website</p>
            </title>
            <url>http://www.hapmap.org/cgi-perl/gbrowse/gbrowse/hapmap/</url>
         </bibl>
      </refgrp>
   </bm>
</art>
