<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2156-5-16</ui>
   <ji>1471-2156</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Genetic characterization of the Indian cattle breeds, Ongole and Deoni (<it>Bos indicus</it>), using microsatellite markers &#8211; a preliminary study</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Metta</snm>
               <fnm>Muralidhar</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>muralidhar_metta@yahoo.com</email>
            </au>
            <au id="A2">
               <snm>Kanginakudru</snm>
               <fnm>Sriramana</fnm>
               <insr iid="I1"/>
               <email>sriramana@cdfd.org.in</email>
            </au>
            <au id="A3">
               <snm>Gudiseva</snm>
               <fnm>Narasimharao</fnm>
               <insr iid="I2"/>
               <email>g_narasimharao@hotmail.com</email>
            </au>
            <au id="A4" ca="yes">
               <snm>Nagaraju</snm>
               <fnm>Javaregowda</fnm>
               <insr iid="I1"/>
               <email>jnagaraju@cdfd.org.in</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Laboratory of Molecular Genetics, Centre for DNA Fingerprinting and Diagnostics, ECIL Road, Nacharam, Hyderabad 500 076, India</p>
            </ins>
            <ins id="I2">
               <p>Department of Animal Genetics and Breeding, College of Veterinary Science, A N G R Agricultural University, Hyderabad 500 030, India</p>
            </ins>
         </insg>
         <source>BMC Genetics</source>
         <issn>1471-2156</issn>
         <pubdate>2004</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>16</fpage>
         <url>http://www.biomedcentral.com/1471-2156/5/16</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">15202952</pubid>
               <pubid idtype="doi">10.1186/1471-2156-5-16</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>07</day>
               <month>3</month>
               <year>2004</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>18</day>
               <month>6</month>
               <year>2004</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>18</day>
               <month>6</month>
               <year>2004</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2004</year>
         <collab>Metta et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Molecular characterization of cattle breeds is important for the prevention of germplasm erosion by cross breeding. The Indian <it>zebu </it>cattle have their significant role in evolution of present day cattle breeds and development of some of the exotic breeds. Microsatellites are the best available molecular tools for characterization of cattle breeds. The present study was carried out to characterize two Indian cattle breeds, Ongole and Deoni, using microsatellite markers.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Using 5 di- and 5 tri-nucleotide repeat loci, 17 Ongole and 13 Deoni unrelated individuals were studied. Of the ten loci, eight revealed polymorphism in both the breeds. The di-nucleotide repeat loci were found to be more polymorphic (100%) than tri-nucleotide repeat loci (60%). A total of 39 polymorphic alleles were obtained at 4.5 alleles per locus in Ongole and 4.1 in Deoni. The average expected heterozygosity was 0.46 (&#177;0.1) and 0.50 (&#177;0.1) in Ongole and Deoni breeds, respectively. The PIC values of the polymorphic loci ranged from 0.15 to 0.79 in Ongole and 0.13 to 0.80 in Deoni breeds. Six Ongole specific and three Deoni specific alleles were identified. The two breeds showed a moderate genetic relationship between themselves with a <it>F</it><sub>ST </sub>value of 0.117 (<it>P </it>= 0.01).</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>This preliminary study shows that microsatellite markers are useful in distinguishing the two <it>zebu </it>breeds namely, Ongole and Deoni. Further studies of other <it>zebu </it>breeds using many microsatellite loci with larger sample sizes can reveal the genetic relationships of Indian breeds.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The Indian cattle breeds, also known as <it>zebu </it>cattle (<it>Bos indicus</it>) are broadly categorized into dairy, draft and dual purpose breeds depending upon their utility either in dairying or in agricultural work. The dual-purpose breeds have specific qualities like disease resistance, heat tolerance, ability to survive and reproduce under stress and low feed input. Ongole and Deoni are the dual-purpose breeds from the Southern part of India. Ongole breed contributed to the development of some of the exotic breeds like 'American Brahman', 'Santa Getrudis' etc. <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> and is used extensively for beef production in Latin American countries <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Deoni is yet another breed serving the needs of the people in semi-arid hilly areas. Short calving interval, massive body and fairly well developed udder in cows of this breed indicate its dual-purpose nature.</p>
         <p><it>Zebu </it>cattle are used in cross breeding programs as they can adapt to hot and humid climates <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. However, a number of these breeds are now being bred out because of intensive cross breeding with high milk producing exotic breeds and reduction of emphasis on draft ability due to mechanization of agriculture and transport. As a result, some of the native draft breeds are on the verge of extinction. Hence, there is an urgent need to conserve these breeds. Breed characterization is the primary step in any conservation programme. The accuracy of phenotypic characterization of domestic cattle is often affected by the influence of the environment and the underlying genetic complexity. A number of studies have been initiated to characterize the European cattle breeds using the molecular tools like microsatellite markers <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Microsatellite markers, by virtue of their codominant and multiallelic nature prove to be efficient in genetic diversity studies, pedigree evaluation and genetic mapping as compared to other molecular markers like RAPD, RFLP and ISSRs <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Microsatellites have become markers of choice in characterization of cattle breeds <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp>. Many studies have indicated that the deepest roots of cattle phylogeny occur between Indian cattle and those of Europe <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. In spite of the evolutionary significance of the Indian cattle breeds, the available literature on characterization of these breeds using reliable molecular markers is scanty. Recently, Kumar <it>et al</it>. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> carried out admixture analysis of South Asian cattle breeds revealing the influence of <it>Bos taurus </it>in the Indian sub-continent. In the present study, we undertook the characterization of Ongole (n = 17) and Deoni (n = 13) cattle breeds using 5 di- and 5 tri-nucleotide repeat microsatellite markers. The two breeds showed a moderate genetic relationship (<it>F</it><sub><it>ST </it></sub>= 0.117). A few breed-distinguishing alleles were identified, which can be used to differentiate the two breeds.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <p>In the present study, genetic polymorphism in the two cattle breeds, Ongole and Deoni were analyzed by using 10 microsatellite markers, which were known to be polymorphic in taurine populations <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Eight microsatellite markers showed polymorphism while the remaining two markers ARO23 and PZE46 were monomorphic in both the breeds. The polymorphic loci gave a total of 39 alleles in both the breeds, with an average of 4.5 and 4.1 alleles per locus in Ongole and Deoni breeds, respectively. The Food and Agriculture Organization (FAO) suggests that five different alleles per locus are required for estimation of genetic differences between breeds. The mean number of alleles in the present study is almost in accordance with the FAO recommendations. The monomorphic locus ARO23 showed allele size deviation in both the breeds when compared to the published data from the other exotic breeds <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Four alleles were reported for this locus with sizes ranging from 96 bp to 105 bp in International Bovine Reference Panel (IBRP) full-sib families. However, in the present study, the same locus revealed a monomorphic allele of 78 bp in both the breeds. If this could turn out to be a <it>zebu </it>specific allele, it would be very useful. However, this could be only confirmed by studies involving other 24 recognized Indian <it>zebu </it>breeds.</p>
         <p>There appears to be no correlation between the number of alleles detected and the number of SSR repeats in the SSR loci used in the study. For example, the microsatellite loci containing the 'GT' repeat motifs varying from (GT)<sub>17 </sub>to (GT)<sub>22 </sub>did not show any correlation with the number of alleles they revealed. However, the di-nucleotide repeat loci were more polymorphic (100%) than the tri-nucleotide repeat loci (60%). The two monomorphic loci used in the present study (ARO23 and PZE46) are tri-nucleotide repeat loci. Three alleles specific to Deoni and six alleles specific to Ongole were observed with frequencies ranging from 3 to 24% (Table <tblr tid="T1">1</tblr>). Further, some alleles were more frequent in one breed than the other (Fig. <figr fid="F1">1</figr>). However, the breed specificity should be confirmed by analysing a large set of individuals from these breeds and also other <it>zebu </it>breeds.</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Breed specific alleles in Ongole (n = 17) and Deoni (n = 13) breeds</p>
            </caption>
            <tblbdy cols="4">
               <r>
                  <c ca="center">
                     <p>
                        <b>Locus</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Allele Size (bp)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Frequency</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Breed</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="4">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS1716</p>
                  </c>
                  <c ca="center">
                     <p>185</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
                  <c ca="center">
                     <p>Deoni</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2057</p>
                  </c>
                  <c ca="center">
                     <p>72</p>
                  </c>
                  <c ca="center">
                     <p>0.15</p>
                  </c>
                  <c ca="center">
                     <p>Deoni</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>110</p>
                  </c>
                  <c ca="center">
                     <p>0.06</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2270</p>
                  </c>
                  <c ca="center">
                     <p>70</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>110</p>
                  </c>
                  <c ca="center">
                     <p>0.04</p>
                  </c>
                  <c ca="center">
                     <p>Deoni</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2840</p>
                  </c>
                  <c ca="center">
                     <p>211</p>
                  </c>
                  <c ca="center">
                     <p>0.03</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>241</p>
                  </c>
                  <c ca="center">
                     <p>0.09</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2847</p>
                  </c>
                  <c ca="center">
                     <p>217</p>
                  </c>
                  <c ca="center">
                     <p>0.24</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BtDIAS1</p>
                  </c>
                  <c ca="center">
                     <p>342</p>
                  </c>
                  <c ca="center">
                     <p>0.21</p>
                  </c>
                  <c ca="center">
                     <p>Ongole</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Allele frequency distribution of the polymorphic microsatellite loci in Ongole and Deoni breeds</p>
            </caption>
            <text>
               <p>Allele frequency distribution of the polymorphic microsatellite loci in Ongole and Deoni breeds</p>
            </text>
            <graphic file="1471-2156-5-16-1"/>
         </fig>
         <p>The genetic diversity in the breeds was expressed in terms of average heterozygosity. The average expected heterozygosity was 0.46 (&#177;0.1) in Ongole breed and 0.50 (&#177;0.1) in Deoni breed. Informativeness of the marker was expressed as Polymorphism Information Content (PIC) <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. The PIC of the polymorphic loci ranged from 0.15 to 0.79 in Ongole breed and 0.13 to 0.80 in Deoni breed (Table <tblr tid="T2">2</tblr>). The <it>F</it><sub><it>IS </it></sub>value, which indicates within breed genetic variation, for Ongole and Deoni breeds was 0.36 and 0.18, respectively. This suggests that our sample represented individuals of inbred population of Ongole compared to Deoni. This could also be due to the small sample size and some of the individuals considered as unrelated during collection may indeed share common parentage in the history beyond known pedigree. This is exactly the advantage of using molecular markers in revealing the actual genetic relationships. The overall genetic divergence between Ongole and Deoni, <it>F</it><sub><it>ST </it></sub>was 0.117, which was significant (<it>P </it>= 0.01). This falls in the range of moderate genetic differentiation on a scale defined by Wright <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>PCR conditions and informativeness of microsatellite loci in two Indian cattle breeds, Ongole and Deoni</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c ca="center">
                     <p>
                        <b>Locus name</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Repeat type</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Tm (&#176;C)</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>MgCl<sub>2 </sub>(mM)</b>
                     </p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>
                        <b>PIC</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Ongole</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>Deoni</b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARO23</p>
                  </c>
                  <c ca="center">
                     <p>(AGC)<sub>8</sub></p>
                  </c>
                  <c ca="center">
                     <p>49</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.00</p>
                  </c>
                  <c ca="center">
                     <p>0.00</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARO62</p>
                  </c>
                  <c ca="center">
                     <p>(AGC)<sub>7</sub></p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.15</p>
                  </c>
                  <c ca="center">
                     <p>0.37</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARO85</p>
                  </c>
                  <c ca="center">
                     <p>(AGC)<sub>8</sub></p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>1.0</p>
                  </c>
                  <c ca="center">
                     <p>0.62</p>
                  </c>
                  <c ca="center">
                     <p>0.68</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS1716</p>
                  </c>
                  <c ca="center">
                     <p>(GT)<sub>20</sub></p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.34</p>
                  </c>
                  <c ca="center">
                     <p>0.65</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2057</p>
                  </c>
                  <c ca="center">
                     <p>(GT)<sub>17</sub></p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.79</p>
                  </c>
                  <c ca="center">
                     <p>0.80</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2270</p>
                  </c>
                  <c ca="center">
                     <p>(CA)<sub>23</sub></p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.45</p>
                  </c>
                  <c ca="center">
                     <p>0.62</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2840</p>
                  </c>
                  <c ca="center">
                     <p>(GT)<sub>19</sub></p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.76</p>
                  </c>
                  <c ca="center">
                     <p>0.70</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BMS2847</p>
                  </c>
                  <c ca="center">
                     <p>(GT)<sub>22</sub></p>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.56</p>
                  </c>
                  <c ca="center">
                     <p>0.35</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>BtDIAS1</p>
                  </c>
                  <c ca="center">
                     <p>(TGC)<sub>11</sub></p>
                  </c>
                  <c ca="center">
                     <p>56</p>
                  </c>
                  <c ca="center">
                     <p>1.0</p>
                  </c>
                  <c ca="center">
                     <p>0.46</p>
                  </c>
                  <c ca="center">
                     <p>0.13</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>PZE46</p>
                  </c>
                  <c ca="center">
                     <p>(CCT)<sub>8</sub></p>
                  </c>
                  <c ca="center">
                     <p>52</p>
                  </c>
                  <c ca="center">
                     <p>1.5</p>
                  </c>
                  <c ca="center">
                     <p>0.00</p>
                  </c>
                  <c ca="center">
                     <p>0.00</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>The present study is a preliminary investigation on the application of SSR markers for the analysis of diversity and genetic relationships between <it>zebu </it>breeds. It also evaluates the polymorphism using di- and tri-nucleotide repeats in two <it>zebu </it>breeds. We observed a difference in inbreeding in the two breeds, with Deoni breed having less inbreeding than Ongole breed. It was also observed that the dinucleotide repeat SSRs are more polymorphic than tri-nucleotide repeats. Further studies involving large samples including samples from other <it>zebu </it>breeds with FAO recommended microsatellite loci are required to understand the genetic relationships among the Indian breeds.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Blood samples and DNA isolation</p>
            </st>
            <p>Blood samples were collected from 17 Ongole and 13 Deoni breed individuals maintained at two different livestock research stations managed by the A N G R Agricultural University, Hyderabad, India, in 3 ml Sodium-EDTA vacutainers. The Ongole breed individuals were tracked for 5 generations and Deoni breed for 2 generations to obtain the pedigree and select the individuals that are unrelated. These animals were produced by artificial insemination.</p>
            <p>The genomic DNA was isolated and assessed for purity following standard molecular biology protocols <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Microsatellite analysis</p>
            </st>
            <p>Five di-nucleotide markers, BMS1716, BMS2057, BMS2270, BMS2840 and BMS2847 <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> and five tri-nucleotide markers, ARO23, ARO62 and ARO85 <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>; BtDIAS1 <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> and PZE46 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp> were employed in the present study. For the loci ARO62, BtDIAS1 and PZE46, primers were designed using the Amplify 1.2 program <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> as,</p>
            <p>ARO62</p>
            <p>F: CAGACACAACTGAAGCAACTC</p>
            <p>R: GTAGATTCCATAACAGC</p>
            <p>BtDIAS1</p>
            <p>F: GTAGCATCTTAATAATGCCCTC</p>
            <p>R: ACCCCACTCCAGCACTTTTG</p>
            <p>PZE46</p>
            <p>F: TTATGGCGGCTCCATATTAAC</p>
            <p>R: GTAACTCGGGCCCTTTCTCC</p>
            <p>For the rest, primer sequence information was obtained from GenBank <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
            <p>PCR conditions were empirically determined (Table <tblr tid="T2">2</tblr>). Twenty nanograms of genomic DNA was used as template in a 10 &#956;l PCR reaction consisting of 5 picomoles of each primers, 1 to 1.5 mM MgCl<sub>2 </sub>(MBI Fermentas), 1 &#956;l of 10 &#215; PCR buffer (750 mM Tris-HCl (pH 8.8 at 25&#176;C), 200 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.1% Tween-20), 100 &#956;M dNTPs, 0.5 U Taq polymerase (MBI Fermentas), in Genamp 9600&#8482; thermalcycler (Perkin Elmer). The PCR cycling conditions used were: 96&#176;C for 1 min. (Initial Denaturation), 94&#176;C for 30 sec. (Denaturation), 49&#176;C&#8211;58&#176;C for 30 sec. (Annealing), 72&#176;C for 1 min 30 sec. (Extension) and 72&#176;C for 10 min. (Final extension). The PCR samples were electrophoresed on 3.5% Metaphor&#8482; agarose (BMN) gel with 1 kb plus (<aff id="AFF1">Invitrogen</aff>) and pUC19 DNA/<it>Msp</it>I marker (MBI Fermentas) DNA size markers. To confirm the number of alleles and to determine the allele size, Fluorescence based SSR analysis <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> was carried out. Denatured amplified samples were separated on a 5% denaturing polyacrylamide gel containing 7 M Urea after adding 2 &#956;l of formamide gel loading buffer and 0.3 &#956;l of ROX-500&#8482; Genescan ruler (Perkin Elmer).</p>
         </sec>
         <sec>
            <st>
               <p>Data analysis</p>
            </st>
            <p>The allele size variation on the Metaphor Agarose gels was studied using Quantity One software (Bio Rad). The Genescan gels were analyzed using GeneScan 3.1 and Genotyper 2.1 software. The individuals are genotyped based on allele size data. Allele frequency and heterozygosity were calculated using MS Tools v3 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. <it>F</it>-statistics were used as a measure of diversity within and between breeds respectively and were estimated using the <it>F-STAT </it>program <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>.</p>
            <p>The PIC was calculated by using the formula <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>:</p>
            <p>
               <graphic file="1471-2156-5-16-i1.gif"/>
            </p>
            <p>where P<sub>i </sub>and P<sub>j </sub>are frequencies of i<sup>th </sup>and j<sup>th </sup>alleles.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>List of Abbreviations</p>
         </st>
         <p>PIC: Polymorphism Information Content; <it>F</it><sub><it>IS </it></sub>and <it>F</it><sub><it>ST</it></sub>: F-Statistics indices; FAO: Food and Agriculture Organization; IBRP: International Bovine Reference Panel; SSRs: Simple Sequence Repeats; n = number of individuals;</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>MM carried out DNA extraction, PCR assays, electrophoretic analysis, data collection and preparation of the primary manuscript. SK did the data analysis, GN carried out breed collection and JN conceived the study, participated in its design and coordination and revision of the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Dr B R Gupta and Dr K Babu Rao for providing the blood samples of Ongole and Deoni breeds. This work was supported by CDFD core grant and ICAR developmental grants.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Dairy breeds and Selection</p>
            </title>
            <aug>
               <au>
                  <snm>Taneja</snm>
                  <fnm>VK</fnm>
               </au>
            </aug>
            <source>In Smallholder dairying in the tropics</source>
            <publisher>International Livestock Research Institute, Nairobi, Kenya</publisher>
            <editor>Falvey L, Chantalakhana C</editor>
            <pubdate>1999</pubdate>
            <fpage>74</fpage>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Genetic characterization of south-western European bovine breeds: a historical and biogeographical reassessment with a set of 16 microsatellites</p>
            </title>
            <aug>
               <au>
                  <snm>Beja-Pereira</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Alexandrino</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bessa</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Carretero</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Dunner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ferrand</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Jordana</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Laloe</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Moazami-Goudarzi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Canon</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Hered</source>
            <pubdate>2003</pubdate>
            <volume>94</volume>
            <fpage>243</fpage>
            <lpage>250</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jhered/esg055</pubid>
                  <pubid idtype="pmpid" link="fulltext">12816965</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Effective crossbreeding systems utilizing <it>zebu </it>cattle</p>
            </title>
            <aug>
               <au>
                  <snm>Koger</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Anim Sci</source>
            <pubdate>1980</pubdate>
            <volume>50</volume>
            <fpage>1215</fpage>
            <lpage>1220</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7400063</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Genetic and biological aspects of <it>zebu </it>adaptability</p>
            </title>
            <aug>
               <au>
                  <snm>Turner</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>J Anim Sci</source>
            <pubdate>1980</pubdate>
            <volume>50</volume>
            <fpage>1201</fpage>
            <lpage>1205</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7400061</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Genetic diversity and population structure of 20 North European cattle breeds</p>
            </title>
            <aug>
               <au>
                  <snm>Kantanen</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Olsaker</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Holm</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Lien</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Vilkki</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Brusgaard</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Eythorsdottir</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Danell</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Adalsteinsson</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Hered</source>
            <pubdate>2000</pubdate>
            <volume>91</volume>
            <fpage>446</fpage>
            <lpage>457</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jhered/91.6.446</pubid>
                  <pubid idtype="pmpid" link="fulltext">11218082</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Individual multilocus genotypes using microsatellite polymorphisms to permit the analysis of the genetic variability within and between Italian beef cattle breeds</p>
            </title>
            <aug>
               <au>
                  <snm>Ciampolini</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Moazami-Goudarzi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Vaiman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dillmann</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mazzanti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Foulley</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Leveziel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Cianci</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>J Anim Sci</source>
            <pubdate>1995</pubdate>
            <volume>73</volume>
            <fpage>3259</fpage>
            <lpage>3268</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8586582</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Evaluation of the genetic variability of 23 bovine microsatellite markers in four Belgian cattle breeds</p>
            </title>
            <aug>
               <au>
                  <snm>Peelman</snm>
                  <fnm>LJ</fnm>
               </au>
               <au>
                  <snm>Mortiaux</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Van Zeveren</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dansercoer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mommens</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Coopman</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Bouquet</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Burny</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Renaville</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Portetelle</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>1998</pubdate>
            <volume>29</volume>
            <fpage>161</fpage>
            <lpage>167</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2052.1998.00280.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9720173</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Genetic diversity measures of local European beef cattle breeds for conservation purposes</p>
            </title>
            <aug>
               <au>
                  <snm>Canon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Alexandrino</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bessa</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Carleos</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Carretero</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Dunner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ferran</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Garcia</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Jordana</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Laloe</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Moazami-Goudarzi</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Genet Sel Evol</source>
            <pubdate>2001</pubdate>
            <volume>33</volume>
            <fpage>311</fpage>
            <lpage>332</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1051/gse:2001121</pubid>
                  <pubid idtype="pmpid" link="fulltext">11403750</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Genetic structure of seven European cattle breeds assessed using 20 microsatellite markers</p>
            </title>
            <aug>
               <au>
                  <snm>MacHugh</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Loftus</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>1998</pubdate>
            <volume>29</volume>
            <fpage>333</fpage>
            <lpage>340</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2052.1998.295330.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9800321</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Comparison of multilocus RFLPs and PCR-based marker systems for genetic analysis of the silkworm <it>Bombyx mori</it></p>
            </title>
            <aug>
               <au>
                  <snm>Nagaraju</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reddy</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Nagaraja</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Sethuraman</snm>
                  <fnm>BN</fnm>
               </au>
            </aug>
            <source>Heredity</source>
            <pubdate>2001</pubdate>
            <volume>86</volume>
            <fpage>588</fpage>
            <lpage>597</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2540.2001.00861.x</pubid>
                  <pubid idtype="pmpid">11554975</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>A panel of Y-specific microsatellite markers suitable for studies of genetic differentiation in cattle and related species</p>
            </title>
            <aug>
               <au>
                  <snm>Edwards</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>MacHugh</snm>
                  <fnm>DE</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>2000</pubdate>
            <volume>31</volume>
            <fpage>127</fpage>
            <lpage>130</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2052.2000.00602.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10782212</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>A microsatellite survey of cattle from a centre of origin: the Near East</p>
            </title>
            <aug>
               <au>
                  <snm>Loftus</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Ertugrul</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Harba</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>El-Barody</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>MacHugh</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>SD</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>1999</pubdate>
            <volume>8</volume>
            <fpage>2015</fpage>
            <lpage>2022</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294x.1999.00805.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10632853</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Microsatellite DNA variation and the evolution domestication and phylogeography of taurine and <it>zebu </it>cattle (<it>Bos taurus </it>and <it>Bos indicus</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>MacHugh</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Shriver</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Loftus</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1997</pubdate>
            <volume>146</volume>
            <fpage>1071</fpage>
            <lpage>1086</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9215909</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Genetics and domestic cattle origins</p>
            </title>
            <aug>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Loftus</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>MacHugh</snm>
                  <fnm>DE</fnm>
               </au>
            </aug>
            <source>Evolutionary Anthropology</source>
            <pubdate>1998</pubdate>
            <volume>6</volume>
            <fpage>79</fpage>
            <lpage>86</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1002/(SICI)1520-6505(1998)6:3&lt;79::AID-EVAN2>3.3.CO;2-2</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Admixture analysis of South Asian cattle</p>
            </title>
            <aug>
               <au>
                  <snm>Kumar</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Freeman</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Loftus</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Gaillard</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fuller</snm>
                  <fnm>DQ</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Heridity</source>
            <pubdate>2003</pubdate>
            <volume>91</volume>
            <fpage>43</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/sj.hdy.6800277</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Creation of a SINE enriched library for the isolation of polymorphic (AGC)<sub>n </sub>microsatellite markers in the bovine genome</p>
            </title>
            <aug>
               <au>
                  <snm>Band</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ron</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>1996</pubdate>
            <volume>27</volume>
            <fpage>243</fpage>
            <lpage>248</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8856921</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Characterization of 109 bovine microsatellites</p>
            </title>
            <aug>
               <au>
                  <snm>Stone</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Kappes</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Keele</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Beattie</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>1997</pubdate>
            <volume>28</volume>
            <fpage>63</fpage>
            <lpage>65</lpage>
         </bibl>
         <bibl id="B18">
            <title>
               <p>A polymorphic trinucleotide microsatellite in cattle: BtDIAS1</p>
            </title>
            <aug>
               <au>
                  <snm>Shukri</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Holm</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Brusgaard</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>1996</pubdate>
            <volume>27</volume>
            <fpage>373</fpage>
            <xrefbib>
               <pubid idtype="pmpid">8930086</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p><it>PZE46 and PZE114</it>: two bovine polymorphic microsatellite loci isolated from a placenta cDNA library</p>
            </title>
            <aug>
               <au>
                  <snm>Motavalian</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rando</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Urciuoli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Senese</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Di Gregorio</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Masina</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Anim Genet</source>
            <pubdate>2002</pubdate>
            <volume>33</volume>
            <fpage>159</fpage>
            <lpage>160</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2052.2002.0831b.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12047232</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Construction of a genetic linkage map in man using restriction fragment length polymorphism</p>
            </title>
            <aug>
               <au>
                  <snm>Botstein</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Skolnick</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>RW</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>1980</pubdate>
            <volume>32</volume>
            <fpage>314</fpage>
            <lpage>331</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6247908</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Evaluation and the genetics of Populations. Variability within and among Natural Populations</source>
            <publisher>University of Chicago Press, Chicago</publisher>
            <pubdate>1978</pubdate>
            <volume>4</volume>
         </bibl>
         <bibl id="B22">
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Russell</snm>
                  <fnm>DW</fnm>
               </au>
            </aug>
            <source>Molecular Cloning: A Laboratory Manual</source>
            <publisher>Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York</publisher>
            <pubdate>2001</pubdate>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Contributing software to the Internet: the <it>Amplify </it>program</p>
            </title>
            <aug>
               <au>
                  <snm>Engels</snm>
                  <fnm>WR</fnm>
               </au>
            </aug>
            <source>Trends Biochem Sci</source>
            <pubdate>1993</pubdate>
            <volume>18</volume>
            <fpage>448</fpage>
            <lpage>450</lpage>
            <url>http://engels.genetics.wisc.edu/amplify/</url>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0968-0004(93)90148-G</pubid>
                  <pubid idtype="pmpid">8291093</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>GenBank database</p>
            </title>
            <url>http://www.ncbi.nlm.nih.gov/</url>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Genetic analysis of traditional and evolved Basmati and non-Basmati rice varieties by using fluorescence-based ISSR-PCR and SSR markers</p>
            </title>
            <aug>
               <au>
                  <snm>Nagaraju</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kathirvel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ramesh Kumar</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Siddiq</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Hasnain</snm>
                  <fnm>SE</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>5836</fpage>
            <lpage>5841</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.042099099</pubid>
                  <pubid idtype="pmpid" link="fulltext">11959900</pubid>
                  <pubid idtype="pmcid">122863</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Trypanotolerance in West African Cattle and the Population Genetic Effects of Selection [Ph.D. thesis] University of Dublin for "The Excel Microsatellite Tool Kit"</p>
            </title>
            <aug>
               <au>
                  <snm>Park</snm>
                  <fnm>SDE</fnm>
               </au>
            </aug>
            <pubdate>2001</pubdate>
            <url>http://oscar.gen.tcd.ie/~sdepark/ms-toolkit/</url>
         </bibl>
         <bibl id="B27">
            <title>
               <p>FSTAT (Version 1.2): A computer program to calculate F-statistics</p>
            </title>
            <aug>
               <au>
                  <snm>Goudet</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Hered</source>
            <pubdate>1995</pubdate>
            <volume>86</volume>
            <fpage>485</fpage>
            <lpage>486</lpage>
            <url>http://www2.unil.ch/izea/softwares/fstat.html</url>
         </bibl>
      </refgrp>
   </bm>
</art>

