<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2156-2-13</ui>
   <ji>1471-2156</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Major genomic mitochondrial lineages delineate early human expansions</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Maca-Meyer</snm>
               <fnm>Nicole</fnm>
               <insr iid="I1"/>
               <email>nmacame@ull.es</email>
            </au>
            <au id="A2">
               <snm>Gonz&#225;lez</snm>
               <mi>M</mi>
               <fnm>Ana</fnm>
               <insr iid="I1"/>
               <email>amglez@ull.es</email>
            </au>
            <au id="A3">
               <snm>Larruga</snm>
               <mi>M</mi>
               <fnm>Jos&#233;</fnm>
               <insr iid="I1"/>
               <email>jlarruga@ull.es</email>
            </au>
            <au id="A4">
               <snm>Flores</snm>
               <fnm>Carlos</fnm>
               <insr iid="I1"/>
               <email>cflores@ull.es</email>
            </au>
            <au id="A5" ca="yes">
               <snm>Cabrera</snm>
               <mi>M</mi>
               <fnm>Vicente</fnm>
               <insr iid="I1"/>
               <email>vcabrera@ull.es</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Genetics, Faculty of Biology, University of La Laguna, Tenerife, 38271, Spain</p>
            </ins>
         </insg>
         <source>BMC Genetics</source>
         <issn>1471-2156</issn>
         <pubdate>2001</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>13</fpage>
         <url>http://www.biomedcentral.com/1471-2156/2/13</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/1471-2156-2-13</pubid>
               <pubid idtype="pmpid">11553319</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>9</day>
               <month>7</month>
               <year>2001</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>13</day>
               <month>8</month>
               <year>2001</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>13</day>
               <month>8</month>
               <year>2001</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2001</year>
         <collab>Maca-Meyer et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The phylogeographic distribution of human mitochondrial DNA variations allows a genetic approach to the study of modern <it>Homo sapiens</it> dispersals throughout the world from a female perspective. As a new contribution to this study we have phylogenetically analysed complete mitochondrial DNA(mtDNA) sequences from 42 human lineages, representing major clades with known geographic assignation.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We show the relative relationships among the 42 lineages and present more accurate temporal calibrations than have been previously possible to give new perspectives as how modern humans spread in the Old World.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>The first detectable expansion occurred around 59,000&#8211;69,000 years ago from Africa, independently colonizing western Asia and India and, following this southern route, swiftly reaching east Asia. Within Africa, this expansion did not replace but mixed with older lineages detectable today only in Africa. Around 39,000&#8211;52,000 years ago, the western Asian branch spread radially, bringing Caucasians to North Africa and Europe, also reaching India, and expanding to north and east Asia. More recent migrations have entangled but not completely erased these primitive footprints of modern human expansions.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Human mtDNA is a non-recombining molecule with maternal inheritance and practically haploid genetics. Differences between mtDNA sequences are only due to mutation. As time passes, mutations accumulate sequentially along less and less related molecules that constitute independent lineages known as haplotypes. Relationships among lineages can be estimated by phylogenetic networks <abbrgrp><abbr bid="B1">1</abbr></abbrgrp> where mutations are classified in hierarchical levels. Basal mutations are shared for clusters of lineages, defined as haplogroups, whereas those at the tips characterize individuals. Major haplogroups <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> are continental or ethnically specific. Three of them (L1, L2, and L3) group sub-Saharan African lineages, nine (H, I, J, K, T, U, V, W and X) encompass almost all mtDNAs from European, North African and Western Asian Caucasians. Finally, haplogroups A, B, C, D, E, F, G and M embrace the majority of the lineages described for Asia, Oceania and native Americans. The geographic distribution of derived branches of these haplogroups has shed light on crucial aspects of human history, such as the probable origin and approximate dating of migrations into the New World <abbrgrp><abbr bid="B3">3</abbr></abbrgrp> and Polynesia <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>, and quantitative estimations of the relative Paleolithic and Neolithic contributions to the extant European mtDNA diversity <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. At the other end of the phylogenetic tree, the ultimate coalescence of all worldwide mtDNA lineages into Africa has favored, since the beginning, the recent African origin hypothesis for all modern humans <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The analyses of the complete mtDNA sequence of 53 humans of diverse origins <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> have added statistical support to this hypothesis. However, as the current definition of the major haplogroups is not based on total genomic sequences, there is not yet a clear resolution of their basal relationships. This genomic phylogenetic reconstruction is necessary to infer the early human dispersal routes after the African exodus. We present the phylogenetic network of 42 complete mtDNA sequences including representatives of the major haplogroups. Based on their relative clustering and coalescence ages we propose a tentative model of the way the Old World could have been colonized by modern humans.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <p>The phylogenetic network of the 42 mtDNA sequences (Fig. <figr fid="F1">1</figr>) was free of reticulations when mutations <abbrgrp><abbr bid="B8">8</abbr></abbrgrp> 150, 152, 303i and 16519 were omitted in its construction. The tree topology was the same as the bootstrap supporting neighbor joining tree. We detected 35 parallel substitutions from 124 variable positions (28%) in the non-coding region (1,122 bp in length), and 45 from 409 (11%) in the coding region (15,447 bp in length). Shared mutations in basal branches of the tree relate haplogroups, however, parallel mutations should be avoided in their global affiliations. As can be expected from haplotypes of well-differentiated haplogroups the majority of mutations are in the external branches of the tree, including those that specifically define them <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Nevertheless, it is well known that in population studies these main lineages sprout into several sub-clusters sometimes with interesting geographic localization. In the cases where representatives of these sub-clusters have also been analyzed, it is evident that the African ones are at the same level of divergence as non-African clusters. More information of cluster structure in Africa is necessary. In non African groups, two haplotypes belonging to sub-haplogroup U2 have a divergence similar to that found between other sub-clusters of the Caucasian U haplogroup. One of them, lacking mutations 16129C and 15907, that are present in all western Eurasian representatives, resembles haplotypes found in India <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. The proposed inclusion of haplogroup K into the U cluster <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> is confirmed, being U7 its most probable related sub-clade. Main Asian haplogroups belong to two different major clusters, whereas A and B rooted with Caucasoid haplogroups, C, D, G and M constitute a monophyletic cluster. Likewise, African haplogroup L3 is more related to Eurasian haplogroups than to the most divergent African clusters L1 and L2. Chimpanzee rooting shows that the oldest lineage of extant modern humans is the African L1a cluster. In addition, the significant bootstrap values on the deep African branches reinforce the statistical support that the out of Africa hypothesis has obtained through a parallel genomic mtDNA study <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. We have estimated a minimum total coalescence for modern human lineages from 156,000 to 169,000 years before present (yr BP). The two subsequent ancient splits also happened inside Africa, originating the L1b/c and L2 haplogroups with ages of 122,000&#8211;132,000 yr BP and 85,000&#8211;95,000 yr BP respectively. These three clades still have an overwhelming sub-Saharan African implantation. The next branching (Fig. <figr fid="F2">2</figr>), dated between 59,000&#8211;69,000 yr BP, also occurred in Africa but comprising clades currently found only in this continent (L3), and others with a first expansion out of Africa. Today, L3 derivatives are present in nearly all the African populations. This ancient spread inside Africa has been directly detected by the ages of several sub-clade expansions <abbrgrp><abbr bid="B11">11</abbr></abbrgrp> and indirectly confirmed by genetic admixture, involving archaic and modern autosomal gene alleles, detected only in Africa <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. The coexistence in African populations of very divergent non-recombining lineages may erroneously bias demographic estimations based on pair-wise nucleotide differences <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Two hypothetical routes for the Asian colonization have been proposed <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, one through Central Asia and one through South Asia. Coincidentally, we detect at least two independent lineages spreading out of Africa. One comprises all M derivatives that radiated 30,000&#8211;57,600 yr BP. Subsequent expansions of this clade have been found in India <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> and Eastern Asia where it possibly originated and expanded as haplogroups C, D, G and others <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. The star-like radiation of these clades suggests that this wide geographic colonization could have happened in a relatively short time. Genetic support for this southern spread of M through Ethiopia and the Arabian Peninsula along South Asia has been recently proposed due to the presence of subclade M1 in Eastern Africa <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. However, a posterior return from Asia to Africa of these lineages is a more plausible explanation because the genetic diversity of M is much greater in India <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> than in Ethiopia <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. In fact, M1 could be a branch of the Indian cluster M as ancestral motifs of the African M1 are found in M*, M3 and M4 Indian subclusters <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. Furthermore, one of the most derived M3 haplotypes in India (10398, 10400, 16086, 16129, 16223, 16249, 16259, 16311) has all the basic substitutions that defined the Ethiopian clade, excepting the highly variable 16189 <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. This supposed Indian expansion to the west also reached northern areas since evolved representatives of M4 have been also detected in Central Asia <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. We may consider the upper bound for this return to Africa 25,000&#8211;47,000 yr BP, the age calculated for M1 in Eastern Africa based on HVSI sequences or 33,000&#8211;63,000 obtained using RFLPs <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Phylogenetic network based on complete mtDNA genome sequences.</p>
            </caption>
            <text>
               <p>Phylogenetic network based on complete mtDNA genome sequences. Nomenclature of individuals is as in Table <tblr tid="T1">1</tblr>. Numbers along the links refer to nucleotide positions; suffixes are transversions; underlining indicates recurrent mutations; the order of the mutations on a path not interrupted by any branching or distinguished nodes is arbitrary. The same topology was supported by bootstraps, using NJ and 1000 replicates; the bootstrap values higher than 50% are shown over the branches. The star shows the position where the chimpanzee sequence roots in the network.</p>
            </text>
            <graphic file="1471-2156-2-13-1"/>
         </fig>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Geographic dispersal routes</p>
            </caption>
            <text>
               <p>Geographic dispersal routes and minimal estimated ages of major human expansions in the Old World, deduced from the age and geographic localisation of main mtDNA haplogroups.</p>
            </text>
            <graphic file="1471-2156-2-13-2"/>
         </fig>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>HVS I motifs</p>
            </caption>
            <tblbdy cols="5">
               <r>
                  <c ca="left">
                     <p>Sample</p>
                  </c>
                  <c ca="left">
                     <p>HVS I motif</p>
                  </c>
                  <c ca="left">
                     <p>Haplogroup</p>
                  </c>
                  <c ca="left">
                     <p>Origin</p>
                  </c>
                  <c ca="right">
                     <p>Ref.<sup>a</sup></p>
                  </c>
               </r>
               <r>
                  <c cspan="5">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>K</p>
                  </c>
                  <c ca="left">
                     <p>145 224 311</p>
                  </c>
                  <c ca="left">
                     <p>K</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U7</p>
                  </c>
                  <c ca="left">
                     <p>248 318T</p>
                  </c>
                  <c ca="left">
                     <p>U7</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U3<sub>1</sub></p>
                  </c>
                  <c ca="left">
                     <p>343 356 390</p>
                  </c>
                  <c ca="left">
                     <p>U3</p>
                  </c>
                  <c ca="left">
                     <p>Canarian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U3<sub>2</sub></p>
                  </c>
                  <c ca="left">
                     <p>343 390</p>
                  </c>
                  <c ca="left">
                     <p>U3</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U2<sub>1</sub></p>
                  </c>
                  <c ca="left">
                     <p>051 092 129C 189 362 368</p>
                  </c>
                  <c ca="left">
                     <p>U2</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U2<sub>2</sub></p>
                  </c>
                  <c ca="left">
                     <p>051 129C 189 319 362</p>
                  </c>
                  <c ca="left">
                     <p>U2</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U2</p>
                  </c>
                  <c ca="left">
                     <p>051 189 234 294</p>
                  </c>
                  <c ca="left">
                     <p>U2</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U5b</p>
                  </c>
                  <c ca="left">
                     <p>189 192 270</p>
                  </c>
                  <c ca="left">
                     <p>U5b</p>
                  </c>
                  <c ca="left">
                     <p>Berber</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U5a</p>
                  </c>
                  <c ca="left">
                     <p>093 153 256 270 311 399</p>
                  </c>
                  <c ca="left">
                     <p>U5a1a</p>
                  </c>
                  <c ca="left">
                     <p>Swede</p>
                  </c>
                  <c ca="right">
                     <p>2</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>U6</p>
                  </c>
                  <c ca="left">
                     <p>172 219</p>
                  </c>
                  <c ca="left">
                     <p>U6</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>H<sub>1</sub></p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>H</p>
                  </c>
                  <c ca="left">
                     <p>Mauritanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>H<sub>F</sub></p>
                  </c>
                  <c ca="left">
                     <p>093 183d 189</p>
                  </c>
                  <c ca="left">
                     <p>H</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="right">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RCRS</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>H</p>
                  </c>
                  <c ca="left">
                     <p>European</p>
                  </c>
                  <c ca="right">
                     <p>4</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>H<sub>2</sub></p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>H</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>V</p>
                  </c>
                  <c ca="left">
                     <p>298</p>
                  </c>
                  <c ca="left">
                     <p>V</p>
                  </c>
                  <c ca="left">
                     <p>Berber</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>HV</p>
                  </c>
                  <c ca="left">
                     <p>278 311</p>
                  </c>
                  <c ca="left">
                     <p>HV</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T5</p>
                  </c>
                  <c ca="left">
                     <p>126 153 189 294</p>
                  </c>
                  <c ca="left">
                     <p>T5</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T1</p>
                  </c>
                  <c ca="left">
                     <p>126 163 186 189 294</p>
                  </c>
                  <c ca="left">
                     <p>T1</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>J1b</p>
                  </c>
                  <c ca="left">
                     <p>069 126 145 222 261</p>
                  </c>
                  <c ca="left">
                     <p>J1b</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>J2</p>
                  </c>
                  <c ca="left">
                     <p>069 126 193 300</p>
                  </c>
                  <c ca="left">
                     <p>J2</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>B</p>
                  </c>
                  <c ca="left">
                     <p>136 183C 189 217 284</p>
                  </c>
                  <c ca="left">
                     <p>B</p>
                  </c>
                  <c ca="left">
                     <p>Japanese</p>
                  </c>
                  <c ca="right">
                     <p>5</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>I</p>
                  </c>
                  <c ca="left">
                     <p>129 148 223 391</p>
                  </c>
                  <c ca="left">
                     <p>I</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>I<sub>F</sub></p>
                  </c>
                  <c ca="left">
                     <p>129 184A 223 391</p>
                  </c>
                  <c ca="left">
                     <p>I</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="right">
                     <p>3</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>N1b</p>
                  </c>
                  <c ca="left">
                     <p>145 176G 180 223 390</p>
                  </c>
                  <c ca="left">
                     <p>N1b</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>W</p>
                  </c>
                  <c ca="left">
                     <p>223 292</p>
                  </c>
                  <c ca="left">
                     <p>W</p>
                  </c>
                  <c ca="left">
                     <p>Iberian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>X</p>
                  </c>
                  <c ca="left">
                     <p>129 189 223 278</p>
                  </c>
                  <c ca="left">
                     <p>X</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>A</p>
                  </c>
                  <c ca="left">
                     <p>111 209 223 290 319 362</p>
                  </c>
                  <c ca="left">
                     <p>A</p>
                  </c>
                  <c ca="left">
                     <p>Canarian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>M1<sub>1</sub></p>
                  </c>
                  <c ca="left">
                     <p>129 182C 183C 189 223 249 311</p>
                  </c>
                  <c ca="left">
                     <p>M1</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>M12</p>
                  </c>
                  <c ca="left">
                     <p>185 189 223 249 311</p>
                  </c>
                  <c ca="left">
                     <p>M1</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>G</p>
                  </c>
                  <c ca="left">
                     <p>189 194 195G 197G 223 256 278 362</p>
                  </c>
                  <c ca="left">
                     <p>G</p>
                  </c>
                  <c ca="left">
                     <p>Japanese</p>
                  </c>
                  <c ca="right">
                     <p>6</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>M<sub>3</sub></p>
                  </c>
                  <c ca="left">
                     <p>140 209 223 262 274 320 399</p>
                  </c>
                  <c ca="left">
                     <p>M</p>
                  </c>
                  <c ca="left">
                     <p>Japanese</p>
                  </c>
                  <c ca="right">
                     <p>7</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>D</p>
                  </c>
                  <c ca="left">
                     <p>184iC 190iC 223 311 316 362</p>
                  </c>
                  <c ca="left">
                     <p>D</p>
                  </c>
                  <c ca="left">
                     <p>Japanese</p>
                  </c>
                  <c ca="right">
                     <p>6</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>M<sub>1</sub></p>
                  </c>
                  <c ca="left">
                     <p>223 295 362</p>
                  </c>
                  <c ca="left">
                     <p>M</p>
                  </c>
                  <c ca="left">
                     <p>Filipino</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>M<sub>2</sub></p>
                  </c>
                  <c ca="left">
                     <p>223</p>
                  </c>
                  <c ca="left">
                     <p>M</p>
                  </c>
                  <c ca="left">
                     <p>Indian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>C</p>
                  </c>
                  <c ca="left">
                     <p>223 298 325 327</p>
                  </c>
                  <c ca="left">
                     <p>C</p>
                  </c>
                  <c ca="left">
                     <p>Canarian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L3b</p>
                  </c>
                  <c ca="left">
                     <p>124 223 278 362</p>
                  </c>
                  <c ca="left">
                     <p>L3b</p>
                  </c>
                  <c ca="left">
                     <p>Mauritanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L3d</p>
                  </c>
                  <c ca="left">
                     <p>124 223 256</p>
                  </c>
                  <c ca="left">
                     <p>L3d</p>
                  </c>
                  <c ca="left">
                     <p>Jordanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L2</p>
                  </c>
                  <c ca="left">
                     <p>223 278 390</p>
                  </c>
                  <c ca="left">
                     <p>L2</p>
                  </c>
                  <c ca="left">
                     <p>Mauritanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L1c</p>
                  </c>
                  <c ca="left">
                     <p>129 189 223 278 294 311 360</p>
                  </c>
                  <c ca="left">
                     <p>L1c</p>
                  </c>
                  <c ca="left">
                     <p>Mauritanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L1b</p>
                  </c>
                  <c ca="left">
                     <p>126 187 189 223 264 270 278 293 311</p>
                  </c>
                  <c ca="left">
                     <p>L1b</p>
                  </c>
                  <c ca="left">
                     <p>Mauritanian</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L1a</p>
                  </c>
                  <c ca="left">
                     <p>129 148 168 172 187 188G 189</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>223 230 278 293 311 320</p>
                  </c>
                  <c ca="left">
                     <p>L1a</p>
                  </c>
                  <c ca="left">
                     <p>Moroccan</p>
                  </c>
                  <c ca="right">
                     <p>1</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>L1aA</p>
                  </c>
                  <c ca="left">
                     <p>148 172 184 187 188A 189 223</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>230 311 320</p>
                  </c>
                  <c ca="left">
                     <p>L1a</p>
                  </c>
                  <c ca="left">
                     <p>African</p>
                  </c>
                  <c ca="right">
                     <p>8</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>a</sup> 1, This work; 2, GenBank accession number X93334; 3, H and I references <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>, we have added for the comparisons the 263, 311i and 16519 mutations in both sequences and 00073 in the I sequence; 4, revised Cambridge reference, GenBank accession number NC 001807; 5, Positive control <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, for comparisons we added 1438; 6, MELAS, P-1 (G) and FICM (D) <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>; 7, (ref <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>); 8, GenBank accession number D38112, for comparisons we added 311i.</p>
            </tblfn>
         </tbl>
         <p>The other major branch that left Africa gave rise mainly to Caucasoid lineages which is congruent with a northern route through the Levant. With a lower bound of 43,000&#8211;53,000 yr BP this branch spread into at least three main clusters. One comprises haplogroups X and A with only a shared mutation between them and different geographic distributions. Whereas A is widespread in Asia, X is mainly restricted to Europe. Curiously, representatives of both clusters have been detected in native Americans raising the possibility that some American Indian could have European ancestry <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>. Nevertheless, X haplotypes have recently been detected in Central Asia. These Asian X haplotypes lack the 225A mutation, as the majority of the American X, pointing to this area as the most probable source for the dispersal of the New World founders <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. The second cluster groups minor haplogroups W, I and N1b, the three are present although in low frequencies in Europe, Near East and Caucasus but only I and N1b have been also detected in Egypt and Arabia <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. The last group radiated around 39,000&#8211;52,000 yr BP, giving at least four ancestral clusters. One of them originated haplogroup B that expanded to Eastern Asia, reaching Japan and southeastern Pacific Archipelagos <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. In early studies, this clade was defined by the 9-bp COII-tRNA<sup>Lys</sup> deletion but after that it has been found with independent origins on other haplogroup backgrounds <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. In this study we have detected this deletion on an Iberian haplotype belonging to haplogroup I. Curiously, it was also found in an Italian haplotype I <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. However, the 9-bp deletion was absent in a wide screen that we carried out on Iberian and Northwest African I haplotypes. The detection in two Mediterranean populations of I haplotypes harboring the 9-bp deletion points to the existence in this area of a subset of I haplotypes that share a recent common ancestor. As happens with A, haplogroup B has not been found in northern India  <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> but is present in Mongolia <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, favoring a Central Asian route for the expansion of these prominent Asian haplogroups. Two additional clades join haplogroups J and T and haplogroups H, V and HV respectively. Derivatives of at least some of them are found in Europe, North Africa, Central Asia and even India, but the most probable origin for all these expansions is the Near East-Caucasus area <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B17">17</abbr><abbr bid="B27">27</abbr></abbrgrp>. Finally, cluster U seems to have suffered a radial spread (Fig. <figr fid="F2">2</figr>), giving subsequent diversification in different geographic areas. Three sub-haplogroups, U2, U5 and U6 had their major expansions in India, Europe and North Africa respectively. U2 split in two branches, one, characterized by mutations 16129C and 15907, is geographically scattered from Western Europe to Mongolia <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B26">26</abbr></abbrgrp> but has not been detected in North Africa. The other reached India where it gave origin to several sub-clusters with global frequencies around 10% being, after its predecessor haplogroup M (53%), the second most abundant haplogroup in India <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. U7 with a minor implantation in Europe but third in frequency in India <abbrgrp><abbr bid="B9">9</abbr></abbrgrp> and also not detected in North Africa might have had a similar expansion as U2. The main radiation of haplogroup U5 occurred in Europe. It has been stated that this lineage entered Europe during the Upper Paleolithic <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, most probably from the Middle East-Caucasus area. The great divergence found here for the two U5 representatives is in agreement with the old age proposed for this haplogroup. Finally, U6 traces the first detectable Paleolithic return to Africa of ancient Caucasoid lineages. It has been mostly found in Northwest Africa, with a global estimated age of 47,000 years <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> reflecting an old human continuity in that rather isolated area. The fact that in Europe it has only been detected in the Iberian Peninsula <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> rules out a possible European route, unless a total lineage extinction in all the path is invoked. On the other hand, its presence in Northeast Africa <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>, albeit in low frequencies, reinforces its way through North Africa. A third possibility could be that this lineage never went out of Africa but its coalescence with clades which all had prominent expansions in Eurasia weakens this option. U3 has also been found with a comparatively higher frequency in Northwest Africa <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> and might have followed the same route as U6, however, as its star-like expansion in the Caucasus has been dated around 30,000 yr BP <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>, it most probably reached Africa in a posterior expansion. This out of Africa and back again hypothesis has also been suggested for Y-chromosome lineages <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. Subsequent Neolithic and historic expansions have doubtlessly reshaped the human genetic pool in wide geographic areas but mainly as limited gene flow, not admixture, between populations. Consequently, the continental origin of the major haplogroups can still be detected and the earliest human routes inferred through them.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>After coming out of Africa, modern humans first spread to Asia following two main routes. The southern one is represented by haplogroup M and related clades that are overwhelmingly present in India and eastern Asia. The northern one gave a posterior radiation that, through Central Asia, again reached North and East Asia carrying, among others, the prominent lineages A and B. Later expansions, can be detected by the presence of subclades of haplogroup U in India and Europe. There were also returns to Africa, most probably from the same two routes. The return from India could be detected by the presence of derivatives of M in Northeast Africa, and the arrival of Caucasoids by the existence of a subclade of haplogroup U that, today, is mainly confined to Northwest Africa.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and Methods</p>
         </st>
         <sec>
            <st>
               <p>Lineages</p>
            </st>
            <p>We have manually sequenced 33 complete mtDNA genomes from available samples previously assigned to major haplogroups. To include lacking haplogroups we added 9 published sequences to the analyses (Table <tblr tid="T1">1</tblr>).</p>
         </sec>
         <sec>
            <st>
               <p>Complete mtDNA sequences</p>
            </st>
            <p>Complete mtDNA were amplified in 32 overlapping fragments with primers and PCR conditions described in Table <tblr tid="T2">2</tblr>. The same primers were utilized to directly sequence both strands of the fragments using the Promega fmol<sup>&#174;</sup> DNA Cycle Sequencing System and the Usb Thermo Sequenase Radiolabelled Terminator Cycle Sequencing Kits.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Oligonucleotide pairs used in the amplification and sequencing</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Fragment</p>
                     </c>
                     <c ca="center">
                        <p>Annealing</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>CRS reference</p>
                     </c>
                     <c ca="left">
                        <p>Sequence (5'&#8211;3')</p>
                     </c>
                     <c ca="center">
                        <p>size (pb)</p>
                     </c>
                     <c ca="center">
                        <p>temp.(&#176;C)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L16340</p>
                     </c>
                     <c ca="left">
                        <p>(16318&#8211;16340)</p>
                     </c>
                     <c ca="left">
                        <p>AGCCATTTACCGTACATAGCACA</p>
                     </c>
                     <c ca="center">
                        <p>681</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H408</p>
                     </c>
                     <c ca="left">
                        <p>(429&#8211;408)</p>
                     </c>
                     <c ca="left">
                        <p>TGTTAAAAGTGCATACCGCCA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L382</p>
                     </c>
                     <c ca="left">
                        <p>(362&#8211;382)</p>
                     </c>
                     <c ca="left">
                        <p>CAAAGAACCCTAACACCAGCC</p>
                     </c>
                     <c ca="center">
                        <p>603</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H945</p>
                     </c>
                     <c ca="left">
                        <p>(964&#8211;945)</p>
                     </c>
                     <c ca="left">
                        <p>GGGAGGGGGTGATCTAAAAC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L923</p>
                     </c>
                     <c ca="left">
                        <p>(902&#8211;923)</p>
                     </c>
                     <c ca="left">
                        <p>GTCACACGATTAACCCAAGTCA</p>
                     </c>
                     <c ca="center">
                        <p>607</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H1487</p>
                     </c>
                     <c ca="left">
                        <p>(1508&#8211;1487)</p>
                     </c>
                     <c ca="left">
                        <p>GTATACTTGAGGAGGGTGACGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L1466</p>
                     </c>
                     <c ca="left">
                        <p>(1445&#8211;1466)</p>
                     </c>
                     <c ca="left">
                        <p>GAGTGCTTAGTTGAACAGGGCC</p>
                     </c>
                     <c ca="center">
                        <p>629</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H2053</p>
                     </c>
                     <c ca="left">
                        <p>(2073&#8211;2053)</p>
                     </c>
                     <c ca="left">
                        <p>TTAGAGGGTTCTGTGGGCAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L2025</p>
                     </c>
                     <c ca="left">
                        <p>(2004&#8211;2025)</p>
                     </c>
                     <c ca="left">
                        <p>GCCTGGTGATAGCTGGTTGTCC</p>
                     </c>
                     <c ca="center">
                        <p>609</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H2591</p>
                     </c>
                     <c ca="left">
                        <p>(2612&#8211;2591)</p>
                     </c>
                     <c ca="left">
                        <p>GGAACAAGTGATTATGCTACCT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L2559</p>
                     </c>
                     <c ca="left">
                        <p>(2538&#8211;2559)</p>
                     </c>
                     <c ca="left">
                        <p>CACCGCCTGCCCAGTGACACAT</p>
                     </c>
                     <c ca="center">
                        <p>591</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H3108</p>
                     </c>
                     <c ca="left">
                        <p>(3128&#8211;3108)</p>
                     </c>
                     <c ca="left">
                        <p>TCGTACAGGGAGGAATTTGAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L3073</p>
                     </c>
                     <c ca="left">
                        <p>(3051&#8211;3073)</p>
                     </c>
                     <c ca="left">
                        <p>AAAGTCCTACGTGATCTGAGTTC</p>
                     </c>
                     <c ca="center">
                        <p>640</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H3670</p>
                     </c>
                     <c ca="left">
                        <p>(3690&#8211;3670)</p>
                     </c>
                     <c ca="left">
                        <p>GGCGTAGTTTGAGTTTGATGC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L3644</p>
                     </c>
                     <c ca="left">
                        <p>(3625&#8211;3644)</p>
                     </c>
                     <c ca="left">
                        <p>GCCACCTCTAGCCTAGCCGT</p>
                     </c>
                     <c ca="center">
                        <p>623</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H4227</p>
                     </c>
                     <c ca="left">
                        <p>(4247&#8211;4227)</p>
                     </c>
                     <c ca="left">
                        <p>ATGCTGGAGATTGTAATGGGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L4210</p>
                     </c>
                     <c ca="left">
                        <p>(4189&#8211;4210)</p>
                     </c>
                     <c ca="left">
                        <p>CCACTCACCCTAGCATTACTTA</p>
                     </c>
                     <c ca="center">
                        <p>625</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H4792</p>
                     </c>
                     <c ca="left">
                        <p>(4813&#8211;4792)</p>
                     </c>
                     <c ca="left">
                        <p>ACTCAGAAGTGAAAGGGGGCTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L4750</p>
                     </c>
                     <c ca="left">
                        <p>(4729&#8211;4750)</p>
                     </c>
                     <c ca="left">
                        <p>CCAATACTACCAATCAATACTC</p>
                     </c>
                     <c ca="center">
                        <p>599</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H5306</p>
                     </c>
                     <c ca="left">
                        <p>(5327&#8211;5306)</p>
                     </c>
                     <c ca="left">
                        <p>GGTGATGGTGGCTATGATGGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L5278</p>
                     </c>
                     <c ca="left">
                        <p>(5259&#8211;5278)</p>
                     </c>
                     <c ca="left">
                        <p>TGGGCCATTATCGAAGAATT</p>
                     </c>
                     <c ca="center">
                        <p>593</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H5832</p>
                     </c>
                     <c ca="left">
                        <p>(5851&#8211;5832)</p>
                     </c>
                     <c ca="left">
                        <p>GACAGGGGTTAGGCCTCTTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L5781</p>
                     </c>
                     <c ca="left">
                        <p>(5762&#8211;5781)</p>
                     </c>
                     <c ca="left">
                        <p>AGCCCCGGCAGGTTTGAAGC</p>
                     </c>
                     <c ca="center">
                        <p>626</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H6367</p>
                     </c>
                     <c ca="left">
                        <p>(6387&#8211;6367)</p>
                     </c>
                     <c ca="left">
                        <p>TGGCCCCTAAGATAGAGGAGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L6337</p>
                     </c>
                     <c ca="left">
                        <p>(6318&#8211;6337)</p>
                     </c>
                     <c ca="left">
                        <p>CCTGGAGCCTCCGTAGACCT</p>
                     </c>
                     <c ca="center">
                        <p>601</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H6899</p>
                     </c>
                     <c ca="left">
                        <p>(6918&#8211;6899)</p>
                     </c>
                     <c ca="left">
                        <p>GCACTGCAGCAGATCATTTC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L6869</p>
                     </c>
                     <c ca="left">
                        <p>(6850&#8211;6869)</p>
                     </c>
                     <c ca="left">
                        <p>CCGGCGTCAAAGTATTTAGC</p>
                     </c>
                     <c ca="center">
                        <p>578</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H7406</p>
                     </c>
                     <c ca="left">
                        <p>(7427&#8211;7406)</p>
                     </c>
                     <c ca="left">
                        <p>GGGTTCTTCGAATGTGTGGTAG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L7379</p>
                     </c>
                     <c ca="left">
                        <p>(7358&#8211;7379)</p>
                     </c>
                     <c ca="left">
                        <p>AGAAGAACCCTCCATAAACCTG</p>
                     </c>
                     <c ca="center">
                        <p>580</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H7918</p>
                     </c>
                     <c ca="left">
                        <p>(7937&#8211;7918)</p>
                     </c>
                     <c ca="left">
                        <p>AGATTAGTCCGCCGTAGTCG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L7882</p>
                     </c>
                     <c ca="left">
                        <p>(7861&#8211;7882)</p>
                     </c>
                     <c ca="left">
                        <p>TCCCTCCCTTACCATCAAATCA</p>
                     </c>
                     <c ca="center">
                        <p>506</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H8345</p>
                     </c>
                     <c ca="left">
                        <p>(8366&#8211;8345)</p>
                     </c>
                     <c ca="left">
                        <p>TTTCACTGTAAAGAGGTGTTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L8299</p>
                     </c>
                     <c ca="left">
                        <p>(8280&#8211;8299)</p>
                     </c>
                     <c ca="left">
                        <p>ACCCCCTCTAGAGCCCACTG</p>
                     </c>
                     <c ca="center">
                        <p>603</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H8861</p>
                     </c>
                     <c ca="left">
                        <p>(8882&#8211;8861)</p>
                     </c>
                     <c ca="left">
                        <p>GAGCGAAAGCCTATAATCACTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L8799</p>
                     </c>
                     <c ca="left">
                        <p>(8779&#8211;8799)</p>
                     </c>
                     <c ca="left">
                        <p>CTCGGACTCCTGCCTCACTCA</p>
                     </c>
                     <c ca="center">
                        <p>638</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H9397</p>
                     </c>
                     <c ca="left">
                        <p>(9416&#8211;9397)</p>
                     </c>
                     <c ca="left">
                        <p>GTGGCCTTGGTATGTGCTTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L9362</p>
                     </c>
                     <c ca="left">
                        <p>(9342&#8211;9362)</p>
                     </c>
                     <c ca="left">
                        <p>GGCCTACTAACCAACACACTA</p>
                     </c>
                     <c ca="center">
                        <p>609</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H9928</p>
                     </c>
                     <c ca="left">
                        <p>(9950&#8211;9928)</p>
                     </c>
                     <c ca="left">
                        <p>AACCACATCTACAAAATGCCAGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L9886</p>
                     </c>
                     <c ca="left">
                        <p>(9865&#8211;9886)</p>
                     </c>
                     <c ca="left">
                        <p>TCCGCCAACTAATATTTCACTT</p>
                     </c>
                     <c ca="center">
                        <p>617</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H10462</p>
                     </c>
                     <c ca="left">
                        <p>(10481&#8211;10462)</p>
                     </c>
                     <c ca="left">
                        <p>AATGAGGGGCATTTGGTAAA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L10403</p>
                     </c>
                     <c ca="left">
                        <p>(10383&#8211;10403)</p>
                     </c>
                     <c ca="left">
                        <p>AAAGGATTAGACTGAACCGAA</p>
                     </c>
                     <c ca="center">
                        <p>612</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H10975</p>
                     </c>
                     <c ca="left">
                        <p>(10994&#8211;10975)</p>
                     </c>
                     <c ca="left">
                        <p>CCATGATTGTGAGGGGTAGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L10949</p>
                     </c>
                     <c ca="left">
                        <p>(10930&#8211;10949)</p>
                     </c>
                     <c ca="left">
                        <p>CTCCGACCCCCTAACAACCC</p>
                     </c>
                     <c ca="center">
                        <p>617</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H11527</p>
                     </c>
                     <c ca="left">
                        <p>(11546&#8211;11527</p>
                     </c>
                     <c ca="left">
                        <p>CAAGGAAGGGGTAGGCTATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L11486</p>
                     </c>
                     <c ca="left">
                        <p>(11467&#8211;11486</p>
                     </c>
                     <c ca="left">
                        <p>AAAACTAGGCGGCTATGGTA</p>
                     </c>
                     <c ca="center">
                        <p>629</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H12076</p>
                     </c>
                     <c ca="left">
                        <p>(12095&#8211;12076</p>
                     </c>
                     <c ca="left">
                        <p>GGAGAATGGGGGATAGGTGT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L12028</p>
                     </c>
                     <c ca="left">
                        <p>(12008&#8211;12028</p>
                     </c>
                     <c ca="left">
                        <p>GGCTCACTCACCCACCACATT</p>
                     </c>
                     <c ca="center">
                        <p>615</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H12603</p>
                     </c>
                     <c ca="left">
                        <p>(12623&#8211;12603</p>
                     </c>
                     <c ca="left">
                        <p>ACGAACAATGCTACAGGGATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L12572</p>
                     </c>
                     <c ca="left">
                        <p>(12553&#8211;12572</p>
                     </c>
                     <c ca="left">
                        <p>ACAACCCAGCTCTCCCTAAG</p>
                     </c>
                     <c ca="center">
                        <p>591</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H13124</p>
                     </c>
                     <c ca="left">
                        <p>(13143&#8211;13124</p>
                     </c>
                     <c ca="left">
                        <p>ATTTTCTGCTAGGGGGTGGA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L13088</p>
                     </c>
                     <c ca="left">
                        <p>(13068&#8211;13088</p>
                     </c>
                     <c ca="left">
                        <p>AGCCCTACTCCACTCAAGCAC</p>
                     </c>
                     <c ca="center">
                        <p>618</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H13666</p>
                     </c>
                     <c ca="left">
                        <p>(13685&#8211;13666</p>
                     </c>
                     <c ca="left">
                        <p>AGGGTGGGGTTATTTTCGTT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L13612</p>
                     </c>
                     <c ca="left">
                        <p>(13593&#8211;13612</p>
                     </c>
                     <c ca="left">
                        <p>AAGCGCCTATAGCACTCGAA</p>
                     </c>
                     <c ca="center">
                        <p>614</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H14186</p>
                     </c>
                     <c ca="left">
                        <p>(14206&#8211;14186</p>
                     </c>
                     <c ca="left">
                        <p>TGGTTGAACATTGTTTGTTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L13612</p>
                     </c>
                     <c ca="left">
                        <p>(13593&#8211;13612</p>
                     </c>
                     <c ca="left">
                        <p>AAGCGCCTATAGCACTCGAA</p>
                     </c>
                     <c ca="center">
                        <p>614</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H14186</p>
                     </c>
                     <c ca="left">
                        <p>(14206&#8211;14186</p>
                     </c>
                     <c ca="left">
                        <p>TGGTTGAACATTGTTTGTTGG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L14125</p>
                     </c>
                     <c ca="left">
                        <p>(14104&#8211;14125</p>
                     </c>
                     <c ca="left">
                        <p>TCTTTCTTCTTCCCACTCATCC</p>
                     </c>
                     <c ca="center">
                        <p>602</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H14685</p>
                     </c>
                     <c ca="left">
                        <p>(14705&#8211;14685</p>
                     </c>
                     <c ca="left">
                        <p>CATTGGTCGTGGTTGTAGTCC</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L14650</p>
                     </c>
                     <c ca="left">
                        <p>(14629&#8211;14650</p>
                     </c>
                     <c ca="left">
                        <p>CCCCATTACTAAACCCACACTC</p>
                     </c>
                     <c ca="center">
                        <p>604</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H15211</p>
                     </c>
                     <c ca="left">
                        <p>(15232&#8211;15211</p>
                     </c>
                     <c ca="left">
                        <p>TTGAACTAGGTCTGTCCCAATG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15162</p>
                     </c>
                     <c ca="left">
                        <p>(15143&#8211;15162</p>
                     </c>
                     <c ca="left">
                        <p>CTCCCGTGAGGCCAAATATC</p>
                     </c>
                     <c ca="center">
                        <p>597</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H15720</p>
                     </c>
                     <c ca="left">
                        <p>(15739&#8211;15720</p>
                     </c>
                     <c ca="left">
                        <p>GTCTGCGGCTAGGAGTCAAT</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15676</p>
                     </c>
                     <c ca="left">
                        <p>(15657&#8211;15676</p>
                     </c>
                     <c ca="left">
                        <p>TCCCCATCCTCCATATATCC</p>
                     </c>
                     <c ca="center">
                        <p>524</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H16157</p>
                     </c>
                     <c ca="left">
                        <p>(16180&#8211;16157</p>
                     </c>
                     <c ca="left">
                        <p>TGATGTGGATTGGGTTTTTATGTA</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15996</p>
                     </c>
                     <c ca="left">
                        <p>(15975&#8211;15996</p>
                     </c>
                     <c ca="left">
                        <p>CTCCACCATTAGCACCCAAAGC</p>
                     </c>
                     <c ca="center">
                        <p>446</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H16401</p>
                     </c>
                     <c ca="left">
                        <p>(16420&#8211;16401</p>
                     </c>
                     <c ca="left">
                        <p>TGATTTCACGGAGGATGGTG</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Statistic analyses</p>
            </st>
            <p>Sequences were aligned manually. Phylogenetic relationships were estimated using median-joining networks <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> as implemented in Network 2.0d <url>http://www.fluxus-engineering.com</url> and refined by hand. The same topology was obtained using the neighbor-joining method <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. A chimpanzee sequence (GenBank accession n&#176; D38113) was added to root the networks. Statistical significance of the branches were accomplished by bootstrap resampling with 1000 replications (PHYLIP Package 3.5c, <url>http://evolution.genetics.washington.edu/phylip.html</url>). Minimum estimates of coalescence ages, and 95% confidence intervals, were based on mean divergence among lineages for the coding region and a constant evolutionary rate of 1.7 &#215; 10<sup>-8</sup> per site per year that has been inferred for this region on the basis of 53 complete mtDNA sequences <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Accesion numbers</p>
            </st>
            <p>Sequences are available in GenBank (accession nos. AF381981-AF382013)</p>
         </sec>
      </sec>
   </bdy>
   <bm>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Mitochondrial portraits of human populations using median networks.</p>
            </title>
            <aug>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
               <au>
                  <snm>Forster</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sykes</snm>
                  <fnm>BC</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>MB</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1995</pubdate>
            <volume>141</volume>
            <fpage>743</fpage>
            <lpage>753</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8647407</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Tracing European founder lineages in the Near Eastern mtDNA pool.</p>
            </title>
            <aug>
               <au>
                  <snm>Richards</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Macaulay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Vega</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Sykes</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Guida</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Rengo</snm>
                  <fnm>Ch</fnm>
               </au>
               <au>
                  <snm>Sellito</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cruciani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kivisild</snm>
                  <fnm>T</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>2000</pubdate>
            <volume>67</volume>
            <fpage>1251</fpage>
            <lpage>1276</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11032788</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Mitochondrial DNA "clock" for the Amerinds and its implications for timing their entry into North America.</p>
            </title>
            <aug>
               <au>
                  <snm>Torroni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Neel</snm>
                  <fnm>JV</fnm>
               </au>
               <au>
                  <snm>Barrantes</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schurr</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U.S.A.</source>
            <pubdate>1994</pubdate>
            <volume>91</volume>
            <fpage>1158</fpage>
            <lpage>1162</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">43113</pubid>
                  <pubid idtype="pmpid" link="fulltext">8302846</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>The origins of the Polynesians: An interpretation from mitochondrial lineage analysis.</p>
            </title>
            <aug>
               <au>
                  <snm>Sykes</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Leiboff</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Low-Beer</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tetzner</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1995</pubdate>
            <volume>57</volume>
            <fpage>1463</fpage>
            <lpage>1475</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8533777</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Mitochondrial and nuclear genetic relationships among Pacific Island and Asian populations</p>
            </title>
            <aug>
               <au>
                  <snm>Lum</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Cann</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Martinson</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Jorde</snm>
                  <fnm>LB</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1998</pubdate>
            <volume>63</volume>
            <fpage>613</fpage>
            <lpage>624</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/301949</pubid>
                  <pubid idtype="pmpid" link="fulltext">9683581</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Mitochondrial DNA and human evolution.</p>
            </title>
            <aug>
               <au>
                  <snm>Cann</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Stoneking</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1987</pubdate>
            <volume>325</volume>
            <fpage>31</fpage>
            <lpage>36</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/325031a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">3025745</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Mitochondrial genome variation and the origin of modern humans</p>
            </title>
            <aug>
               <au>
                  <snm>Ingman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kaessmann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>P&#228;&#228;bo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gyllensten</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>408</volume>
            <fpage>708</fpage>
            <lpage>713</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35047064</pubid>
                  <pubid idtype="pmpid" link="fulltext">11130070</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Sequence and organization of the human mitochondrial genome</p>
            </title>
            <aug>
               <au>
                  <snm>Anderson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bankier</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Barrell</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>de Bruijn</snm>
                  <fnm>MHL</fnm>
               </au>
               <au>
                  <snm>Coulson</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Drouin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Eperon</snm>
                  <fnm>IC</fnm>
               </au>
               <au>
                  <snm>Nierlich</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Roe</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Sanger</snm>
                  <fnm>F</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>1981</pubdate>
            <volume>290</volume>
            <fpage>457</fpage>
            <lpage>465</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7219534</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Deep common ancestry of Indian and western-Eurasian mitochondrial DNA lineages.</p>
            </title>
            <aug>
               <au>
                  <snm>Kivisild</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bamshad</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kaldma</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Metspalu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Metspalu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Reidla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Laos</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Parik</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Watkins</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Dixon</snm>
                  <fnm>ME</fnm>
               </au>
               <etal/>
            </aug>
            <source>Curr. Biol.</source>
            <pubdate>1999</pubdate>
            <volume>9</volume>
            <fpage>1331</fpage>
            <lpage>1334</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0960-9822(00)80057-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10574762</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>The emerging tree of West Eurasian mtDNAs: A synthesis of control-region sequences and RFLPs</p>
            </title>
            <aug>
               <au>
                  <snm>Macaulay</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Vega</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Cruciani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Guida</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Scozzari</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Bonn&#233;-Tamir</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Sykes</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Torroni</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1999</pubdate>
            <volume>64</volume>
            <fpage>232</fpage>
            <lpage>249</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/302204</pubid>
                  <pubid idtype="pmpid" link="fulltext">9915963</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Mitochondrial footprints of human expansions in Africa.</p>
            </title>
            <aug>
               <au>
                  <snm>Watson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Forster</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Richards</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1997</pubdate>
            <volume>61</volume>
            <fpage>691</fpage>
            <lpage>704</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9326335</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Archaic lineages in the history of modern humans.</p>
            </title>
            <aug>
               <au>
                  <snm>Labuda</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zietkiewicz</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Yotova</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2000</pubdate>
            <volume>156</volume>
            <fpage>799</fpage>
            <lpage>808</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11014825</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>The History and Geography of Human Genes.</p>
            </title>
            <aug>
               <au>
                  <snm>Cavalli-Sforza</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Menozzi</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Piazza</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Princeton University Press, New Jersey</source>
            <pubdate>1996</pubdate>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Southeast Asian mitochondrial DNA analysis reveals genetic continuity of ancient Mongoloid migrations</p>
            </title>
            <aug>
               <au>
                  <snm>Ballinger</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Schurr</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Torroni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gan</snm>
                  <fnm>YY</fnm>
               </au>
               <au>
                  <snm>Hodge</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Hassan</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>K-H</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1992</pubdate>
            <volume>130</volume>
            <fpage>139</fpage>
            <lpage>152</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1346259</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Genetic evidence of an early exit of <it>Homo sapiens sapiens</it> from Africa through Eastern Africa.</p>
            </title>
            <aug>
               <au>
                  <snm>Quintana-Murci</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Semino</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
               <au>
                  <snm>Passarino</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>McElreavey</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Santachiara-Benerecetti</snm>
                  <fnm>AS</fnm>
               </au>
            </aug>
            <source>Nature Genetics</source>
            <pubdate>1999</pubdate>
            <volume>23</volume>
            <fpage>437</fpage>
            <lpage>441</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/70550</pubid>
                  <pubid idtype="pmpid" link="fulltext">10581031</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>The place of the Indian mitochondrial DNA variants in the global network of the maternal lineages and the peopling of the old world.</p>
            </title>
            <aug>
               <au>
                  <snm>Kivisild</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kaldma</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Metspalu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Parik</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Papiha</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Villems</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>In: Genomic Diversity: Applications in Human Population Genetics (Edited by Papiha S, Deka R, Chakraborty R) New York, Kluwer Academic / Plenum Publishers</source>
            <pubdate>1999</pubdate>
            <fpage>135</fpage>
            <lpage>152</lpage>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Trading genes along the silk road: mtDNA sequences and the origin of Central Asian populations</p>
            </title>
            <aug>
               <au>
                  <snm>Comas</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Calafell</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Mateu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>P&#233;rez-Lezaun</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bosch</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Mart&#237;nez-Arias</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Clarimon</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Facchini</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Fiori</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Luiselli</snm>
                  <fnm>D</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1998</pubdate>
            <volume>63</volume>
            <fpage>1824</fpage>
            <lpage>1838</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/302133</pubid>
                  <pubid idtype="pmpid" link="fulltext">9837835</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>mtDNA haplogroup X: An ancient link between Europe/Western Asia and North America?</p>
            </title>
            <aug>
               <au>
                  <snm>Brown</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Hosseini</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Torroni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
               <au>
                  <snm>Allen</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Schurr</snm>
                  <fnm>TG</fnm>
               </au>
               <au>
                  <snm>Scozzari</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cruciani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>DC</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1998</pubdate>
            <volume>63</volume>
            <fpage>1852</fpage>
            <lpage>1861</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/302155</pubid>
                  <pubid idtype="pmpid" link="fulltext">9837837</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>The presence of mitochondrial haplogroup X in Altaians from South Siberia.</p>
            </title>
            <aug>
               <au>
                  <snm>Derenko</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Grzybowski</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Malyarchuk</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Czarny</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Miscicka-Sliwka</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Zakharov</snm>
                  <fnm>IA</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>2001</pubdate>
            <volume>69</volume>
            <fpage>237</fpage>
            <lpage>241</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/321266</pubid>
                  <pubid idtype="pmpid" link="fulltext">11410843</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.</p>
            </title>
            <aug>
               <au>
                  <snm>Horai</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hayasaka</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1990</pubdate>
            <volume>46</volume>
            <fpage>828</fpage>
            <lpage>842</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2316527</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis.</p>
            </title>
            <aug>
               <au>
                  <snm>Melton</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Redd</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Saha</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sofro</snm>
                  <fnm>ASM</fnm>
               </au>
               <au>
                  <snm>Martison</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Stoneking</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1995</pubdate>
            <volume>57</volume>
            <fpage>403</fpage>
            <lpage>414</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7668267</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>MtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in Sub-Saharan Africans</p>
            </title>
            <aug>
               <au>
                  <snm>Soodyall</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Vigilant</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hill</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Stoneking</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1996</pubdate>
            <volume>58</volume>
            <fpage>595</fpage>
            <lpage>608</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8644719</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Multiple origins of the mtDNA 9-bp deletion in populations of South India.</p>
            </title>
            <aug>
               <au>
                  <snm>Watkins</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Bamshad</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dixon</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Bhaskara Rao</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Naidu</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Reddy</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Prasad</snm>
                  <fnm>BVR</fnm>
               </au>
               <au>
                  <snm>Das</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Reddy</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Gai</snm>
                  <fnm>PB</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am. J. Phys. Anthropol.</source>
            <pubdate>1999</pubdate>
            <volume>109</volume>
            <fpage>147</fpage>
            <lpage>158</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-8644(199906)109:2&lt;147::AID-AJPA1>3.3.CO;2-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">10378454</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Evolutionary history of the mtDNA 9-bp deletion in Chinese populations and its relevance to the peopling of East and Southeast Asia.</p>
            </title>
            <aug>
               <au>
                  <snm>Yao</snm>
                  <fnm>Y-G</fnm>
               </au>
               <au>
                  <snm>Watkins</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y-P</fnm>
               </au>
            </aug>
            <source>Hum. Genet.</source>
            <pubdate>2000</pubdate>
            <volume>107</volume>
            <fpage>504</fpage>
            <lpage>512</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s004390000403</pubid>
                  <pubid idtype="pmpid" link="fulltext">11140950</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>About the "Asian"-specific 9-bp deletion of mtDNA...</p>
            </title>
            <aug>
               <au>
                  <snm>Torroni</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Petrozzi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Santolamazza</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Stellitto</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cruciani</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Scozzari</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1995</pubdate>
            <volume>57</volume>
            <fpage>507</fpage>
            <lpage>508</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7668278</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Mitochondrial DNA analysis of Mongolian populations and implications for the origin of New World founders</p>
            </title>
            <aug>
               <au>
                  <snm>Kolman</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Sambuughin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bermingham</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1996</pubdate>
            <volume>142</volume>
            <fpage>1321</fpage>
            <lpage>1334</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8846908</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>The trans-Caucasus and the expansion of the Caucasoid-specific human mitochondrial DNA.</p>
            </title>
            <aug>
               <au>
                  <snm>Metspalu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kivisild</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kaldma</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Parik</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Reidla</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tambets</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Villems</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>In: Genomic Diversity: Applications in Human Population Genetics (Edited by Papiha S, Deka R, Chakraborty R) New York, Kluwer Academic / Plenum Publishers</source>
            <pubdate>1999</pubdate>
            <fpage>121</fpage>
            <lpage>133</lpage>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Mitochondrial DNA analysis of Northwest African populations reveals genetic exchanges with European, Near-Eastern, and sub-Saharan populations</p>
            </title>
            <aug>
               <au>
                  <snm>Rando</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Pinto</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Gonz&#225;lez</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Hern&#225;ndez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Larruga</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Cabrera</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
            </aug>
            <source>Ann. Hum. Genet.</source>
            <pubdate>1998</pubdate>
            <volume>62</volume>
            <fpage>531</fpage>
            <lpage>550</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1017/S0003480098007234</pubid>
                  <pubid idtype="pmpid" link="fulltext">10363131</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Genetic affinities among human populations inhabiting the Subsaharan area, Northwest Africa, and the Iberian Peninsula.</p>
            </title>
            <aug>
               <au>
                  <snm>Flores</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hern&#225;ndez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gonz&#225;lez</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Cabrera</snm>
                  <fnm>VM</fnm>
               </au>
            </aug>
            <source>In Prehistoric Iberia: Genetics, Anthropology, and Linguistics (Edited by Arnaiz-Villena A) New York, Kluwer Academic/Plenum Publishers</source>
            <pubdate>2000</pubdate>
            <fpage>33</fpage>
            <lpage>50</lpage>
         </bibl>
         <bibl id="B30">
            <title>
               <p>mtDNA analysis of Nile River valley populations: A genetic corridor or a barrier to migration?</p>
            </title>
            <aug>
               <au>
                  <snm>Krings</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Salem</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Bauer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Geisert</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Malek</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chaix</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Welsby</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Di Rienzo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Utermann</snm>
                  <fnm>G</fnm>
               </au>
               <etal/>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>1999</pubdate>
            <volume>64</volume>
            <fpage>1166</fpage>
            <lpage>1176</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/302314</pubid>
                  <pubid idtype="pmpid" link="fulltext">10090902</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Out of Africa and back again: Nested cladistic analysis of human Y chromosome variation.</p>
            </title>
            <aug>
               <au>
                  <snm>Hammer</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Karafet</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Rasanayagam</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wood</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Altheide</snm>
                  <fnm>TK</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Griffiths</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Templeton</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Zegura</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Mol. Biol. Evol.</source>
            <pubdate>1998</pubdate>
            <volume>15</volume>
            <fpage>427</fpage>
            <lpage>441</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9549093</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Median-joining networks for inferring intraspecific phylogenies.</p>
            </title>
            <aug>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>H-J</fnm>
               </au>
               <au>
                  <snm>Forster</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>R&#246;hl</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol. Biol. Evol.</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>37</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10331250</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>The neighbor-joining method: A new method for reconstructing phylogenetic trees.</p>
            </title>
            <aug>
               <au>
                  <snm>Saitou</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol. Biol. Evol.</source>
            <pubdate>1987</pubdate>
            <volume>4</volume>
            <fpage>406</fpage>
            <lpage>425</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3447015</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Phylogenetic network of the mtDNA haplogroup U in Northern Finland based on sequence analysis of the complete coding region by conformation-sensitive gel electrophoresis.</p>
            </title>
            <aug>
               <au>
                  <snm>Finnil&#228;</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hassinen</snm>
                  <fnm>IE</fnm>
               </au>
               <au>
                  <snm>Ala-Kokko</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Majamaa</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Am. J. Hum. Genet.</source>
            <pubdate>2000</pubdate>
            <volume>66</volume>
            <fpage>1017</fpage>
            <lpage>1026</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/302802</pubid>
                  <pubid idtype="pmpid" link="fulltext">10712215</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Genotype and phenotype of severe mitochondrial cardiomyopathy: A recipient of heart transplantation and the genetic control.</p>
            </title>
            <aug>
               <au>
                  <snm>Ozawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Katsumata</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hayakawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sugiyama</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Itoyama</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nunoda</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sekiguchi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biochem. Biophys. Res. Commun.</source>
            <pubdate>1995</pubdate>
            <volume>207</volume>
            <fpage>613</fpage>
            <lpage>620</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.1995.1232</pubid>
                  <pubid idtype="pmpid" link="fulltext">7864851</pubid>
  