<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2156-2-10</ui>
   <ji>1471-2156</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p><it>RHD</it> positive haplotypes in D negative Europeans</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Wagner</snm>
               <mi>F</mi>
               <fnm>Franz</fnm>
               <insr iid="I1"/>
               <email>franz.wagner@medizin.uni-ulm.de</email>
            </au>
            <au id="A2">
               <snm>Frohmajer</snm>
               <fnm>Alexander</fnm>
               <insr iid="I1"/>
               <email>a.frohmajer@12move.de</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Flegel</snm>
               <mi>A</mi>
               <fnm>Willy</fnm>
               <insr iid="I1"/>
               <email>willy.flegel@medizin.uni-ulm.de</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Abteilung Transfusionsmedizin, Universitatsklinikum Ulm and DRK-Blutspendedienst Baden-W&#252;rttemberg, Institut Ulm, Ulm, Germany</p>
            </ins>
         </insg>
         <source>BMC Genetics</source>
         <issn>1471-2156</issn>
         <pubdate>2001</pubdate>
         <volume>2</volume>
         <issue>1</issue>
         <fpage>10</fpage>
         <url>http://www.biomedcentral.com/1471-2156/2/10</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/1471-2156-2-10</pubid>
               <pubid idtype="pmpid">11495631</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>24</day>
               <month>4</month>
               <year>2001</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>16</day>
               <month>7</month>
               <year>2001</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>16</day>
               <month>7</month>
               <year>2001</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2001</year>
         <collab>Wagner et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Blood group genotyping is increasingly utilized for prenatal diagnosis and after recent transfusions, but still lacks the specificity of serology. In whites, the presence of antigen D is predicted, if two or more properly selected <it>RHD-specific</it> polymorphism are detected. This prediction must fail, if an antigen D negative <it>RHD</it> positive allele is encountered. Excluding <it>RHD&#968;</it> and <it>Cde<sup>S</sup></it> frequent only in individuals of African descent, most of these alleles are unknown and the population frequency of any such allele has not been determined.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>We screened 8,442 antigen D negative blood donations by <it>RHD</it> PCR-SSP. <it>RHD</it> PCR positive samples were further characterized by <it>RHD</it> exon specific PCR-SSP or sequencing. The phenotype of the identified alleles was checked and their frequencies in Germans were determined.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We detected 50 <it>RHD</it> positive samples. Fifteen samples harbored one of three new <it>D<sub>el</sub></it> alleles. Thirty samples were due to 14 different D negative alleles, only 5 of which were previously known. Nine of the 14 alleles may have been generated by gene conversion <it>in cis,</it> for which we proposed a mechanism triggered by hairpin formation of chromosomal DNA. The cumulative population frequency of the 14 D negative alleles was 1:1,500. Five samples represented a D<sup>+/-</sup> chimera, a weak D and three partial D, which had been missed by routine serology; two recipients transfused with blood of the D<sup>+/-</sup> chimera donor became anti-D immunized.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The results of this study allowed to devise an improved <it>RHD</it> genotyping strategy, the false-positive rate of which was lower than 1:10,000. The number of characterized <it>RHD</it> positive antigen D negative and D<sub>el</sub> alleles was more than doubled and their population frequencies in Europe were defined.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>The antigen D encoded by the <it>RHD</it> gene is the most important blood group antigen determined by a protein. About 15% of whites are antigen D negative. Antigen D prediction by PCR was initially applied to fetus at risk for hemolytic disease of the newbom [<abbr bid="B1">1</abbr>,<abbr bid="B2">2</abbr>]. If serologic blood group typing cannot be performed with its usual ease, an <it>RHD</it> genotyping with a specificity and sensitivity comparable to serologic methods is of practical importance. For example, the utility of blood group genotyping in patients with recent transfusions was demonstrated by several studies [<abbr bid="B3">3</abbr>,<abbr bid="B4">4</abbr>,<abbr bid="B5">5</abbr>,<abbr bid="B6">6</abbr>].</p>
         <p>The two <it>RH</it> genes, <it>RHD</it> and <it>RHCE</it> are about 30,000 bp apart [<abbr bid="B7">7</abbr>], have opposite orientation [<abbr bid="B7">7</abbr>,<abbr bid="B8">8</abbr>] and are homologous retaining more than 90% identity [<abbr bid="B9">9</abbr>]. The most frequent cause for the absence of the antigen D in whites is the lack of the whole <it>RHD</it> gene [<abbr bid="B10">10</abbr>] due to a deletion occurring in the <it>Rhesus box</it> [<abbr bid="B7">7</abbr>]. Therefore, most methods for antigen D prediction in whites probed the presence of <it>RHD</it> specific polymorphism [<abbr bid="B1">1</abbr>,<abbr bid="B2">2</abbr>,<abbr bid="B11">11</abbr>,<abbr bid="B12">12</abbr>,<abbr bid="B13">13</abbr>]. Two <it>RHD</it> positive antigen D negative alleles are frequent in Africans: <it>RHD&#968;</it> carries a 37 bp insertion at the intron 3/exon 4 boundary and also harbors a stop codon [<abbr bid="B14">14</abbr>]; <it>Cde</it><sup>s</sup> is a <it>RHD-CE-D</it> hybrid gene [<abbr bid="B15">15</abbr>,<abbr bid="B16">16</abbr>,<abbr bid="B17">17</abbr>]. In Asians, a major allele may be associated with a G314V missense mutation [<abbr bid="B18">18</abbr>], and several other alleles may represent <it>RHD-CE-D</it> hybrid alleles [<abbr bid="B18">18</abbr>,<abbr bid="B19">19</abbr>,<abbr bid="B20">20</abbr>].</p>
         <p>In whites, <it>RHD</it> positive antigen D negative alleles were considered rare. However, the single systematic study [<abbr bid="B21">21</abbr>] indicated a frequency of up to 22% among the rare haplotype <it>Cde,</it> which would render them the major cause of false-positive antigen D prediction by PCR in whites. The majority of <it>RHD</it> positive alleles in D negatives were reported as scattered case reports [<abbr bid="B22">22</abbr>,<abbr bid="B23">23</abbr>,<abbr bid="B24">24</abbr>,<abbr bid="B25">25</abbr>,<abbr bid="B26">26</abbr>,<abbr bid="B27">27</abbr>] with an often incomplete molecular work-up. The relative frequencies of these alleles and their cumulative population frequency remained unknown.</p>
         <p>The specificity of <it>RHD</it> genotyping can be improved by a systematic characterization of <it>RHD</it> positive antigen D negative alleles. This rationale prompted us to determine the molecular causes of such alleles and their population frequencies in a random survey among European blood bank donors. We screened more than 8,000 antigen D negative blood donations by <it>RHD</it> PCR, including more than 700 rare Ccddee or ccddEe samples. Nine <it>RHD-CE-D</it> hybrid alleles, 5 other D negative and 3 <it>D<sub>el</sub></it> alleles were identified. Five D positive donors missed by routine serology were uncovered. Two anti-D immunizations were traced. We established frequency estimates for <it>RHD</it> positive antigen D negative haplotypes in whites, which allowed us to devise an optimized <it>RHD</it> PCR strategy with an enhanced and defined specificity.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Population surveys</p>
            </st>
            <p>In a first survey, we investigated 1,068 samples of blood donors that were documented as antigen D negative according to routine serologic methods. To cover the whole length of the <it>RHD</it> gene, we tested the <it>RHD</it> promoter, intron 4, exon 7, and the 3' untranslated region of exon 10 by PCR-SSP (Table <tblr tid="T1">1</tblr>). As antigen D negative <it>RHD</it> gene positive alleles are known to preferentially occur in the <it>Cde</it> and <it>cdE</it> haplotypes [<abbr bid="B21">21</abbr>,<abbr bid="B22">22</abbr>,<abbr bid="B25">25</abbr>], we tested 754 samples with antigen C or antigen E or both along with 314 ccddee samples. We detected 48 donors who carried the <it>RHD</it> gene. All were positive for antigen C or antigen E or both (Table <tblr tid="T1">1</tblr>).</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Population surveys of D negative blood donors documented D negative and screened by <it>RHD</it> PCR-SSP</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Samples (n)</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Documented phenotype</p>
                     </c>
                     <c ca="center">
                        <p>screened</p>
                     </c>
                     <c ca="center">
                        <p>PCR-SSP positive</p>
                     </c>
                     <c ca="center">
                        <p>D positive<sup>*</sup></p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <it>Testing as single samples</it>
                           <sup>&#8224;</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>Ccddee</p>
                     </c>
                     <c ca="right">
                        <p>433</p>
                     </c>
                     <c ca="right">
                        <p>34</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ccddEe</p>
                     </c>
                     <c ca="right">
                        <p>271</p>
                     </c>
                     <c ca="right">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>CCddee</p>
                     </c>
                     <c ca="right">
                        <p>24</p>
                     </c>
                     <c ca="right">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>CcddEe</p>
                     </c>
                     <c ca="right">
                        <p>19</p>
                     </c>
                     <c ca="right">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ccddEE</p>
                     </c>
                     <c ca="right">
                        <p>6</p>
                     </c>
                     <c ca="right">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>CcddEE</p>
                     </c>
                     <c ca="right">
                        <p>1</p>
                     </c>
                     <c ca="right">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ccddee</p>
                     </c>
                     <c ca="right">
                        <p>314</p>
                     </c>
                     <c ca="right">
                        <p>0</p>
                     </c>
                     <c ca="center">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4" ca="left">
                        <p>
                           <it>Testing as pools of 20 samples</it>
                           <sup>&#8225;</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>ccddee</p>
                     </c>
                     <c ca="right">
                        <p>7,374</p>
                     </c>
                     <c ca="right">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Total</it>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>*</sup>Samples uncovered on further analysis as weak D, partial D or D<sup>+/-</sup> chimera. <sup>&#8224;</sup> Positive for at least one of four <it>RHD</it> specific polymorphism tested (promoter, intron 4, exon 7 and 3' UTR). <sup>&#8225;</sup>Positive for at least one of three <it>RHD</it> specific polymorphism tested (promoter, intron 4, and 3' UTR).</p>
               </tblfn>
            </tbl>
            <p>In a subsequent survey, we checked 7,374 ccddee samples, which were tested in pools of twenty samples for <it>RHD</it> promoter, intron 4 and exon 10. This survey aimed to increase the power of our study for ccddee donors, which represent 92% of all antigen D negative [<abbr bid="B28">28</abbr>]. Two <it>RHD</it> positive donors were detected (Table <tblr tid="T1">1</tblr>). In summary, 50 <it>RHD</it> positive donors were found in the two population surveys. They were further characterized by a detailed molecular work-up including <it>RHD</it> exon specific PCR-SSP, PCR of intron polymorphism or nucleotide sequencing.</p>
         </sec>
         <sec>
            <st>
               <p>Exclusion of five antigen D positive donors</p>
            </st>
            <p>The molecular and serologic work-up revealed that 5 donors, previously documented as antigen D negative, were weakly antigen D positive (Table <tblr tid="T1">1</tblr>). Two donors of phenotype CcDEe carried <it>D category VI type I</it> and <it>weak D type 2,</it> respectively. Two donors of phenotype ccDEe carried <it>D category VI type</it> I and the new partial D <it>DIM</it> [<abbr bid="B29">29</abbr>], respectively. One donor of phenotype ccDee was a D<sup>+/-</sup> chimera.</p>
         </sec>
         <sec>
            <st>
               <p>Molecular analysis of 45 antigen D negative <it>RHD</it> gene positive samples</p>
            </st>
            <p>The remaining 45 samples were investigated by <it>RHD</it> exon specific PCR for exons 3, 4, 5, 6, 7, and 9. Samples with discrepant results for <it>RHD</it> promoter and exon 3 were investigated for intron 1 and intron 2, those with discrepant results for exon 7 and 9 were investigated for intron 7 and intron 8, and those with discrepant results for exon 9 and exon 10 were investigated for intron 9. 24 samples could be assigned to one of nine distinct <it>RHD</it> PCR patterns and 21 samples were positive for all <it>RHD</it> specific polymorphism investigated (Fig. <figr fid="F1">1</figr>). <b>(i) Hybrid alleles.</b> The <it>RHD</it> PCR patterns could be explained by nine <it>RHD-CE-D</it> hybrid alleles (Fig. <figr fid="F1">1A</figr>). Only two of these alleles could be definitively related to prior descriptions of <it>RHD</it> positive antigen D negative alleles: One of the three carriers of the <it>RHD-CE(8-9)-D</it> allele was a donor previously communicated by us as "CCD<sup>nex</sup> ee", who was negative in an <it>RHD</it> exon 9 PCR [<abbr bid="B27">27</abbr>]. Another pattern was identified as <it>Cde</it><sup>s</sup> (Fig. <figr fid="F2">2</figr> to Fig. <figr fid="F4">4</figr>). We cannot exclude the possibility that some of the seven remaining alleles have been observed previously [<abbr bid="B18">18</abbr>,<abbr bid="B19">19</abbr>,<abbr bid="B20">20</abbr>,<abbr bid="B21">21</abbr>,<abbr bid="B22">22</abbr>,<abbr bid="B24">24</abbr>,<abbr bid="B25">25</abbr>,<abbr bid="B26">26</abbr>]. Because of the limited published data for those observations, we found more than one "compatible" allele in our study for each previous observation. It should be noted that the hybrid structure was predicted from the PCR pattern and alternative explanations like combinations of two hybrid genes or partial deletions of the <it>RHD</it> gene were not formally excluded, <b>(ii) Other alleles.</b> The twenty-one samples positive for the nine <it>RHD</it> specific polymorphism tested were assigned to one of eight different <it>RHD</it> alleles (Fig. <figr fid="F1">1B</figr>). One allele was identical with <it>RHD&#968;</it> [<abbr bid="B14">14</abbr>], the other seven alleles were novel. Each allele was characterized by nucleotide sequencing of the ten <it>RHD</it> exons in at least one sample. Once a new allele was characterized, the remaining samples were assigned by nucleotide sequencing of the informative exons (Fig. <figr fid="F1">1B</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Predicted molecular structure of the 17 <it>RHD</it> positive, D negative or D<sub>el</sub> alleles detected.</p>
               </caption>
               <text>
                  <p>Predicted molecular structure of the 17 <it>RHD</it> positive, D negative or <it>D<sub>el</sub></it> alleles detected. For each haplotype, a schematic representation of the molecular structure is shown along with a designation, haplotype association, phenotype, and numbers of samples observed. Each <it>RHD</it> exon is indicated by a box, intron and promoter polymorphism investigated are shown as circles. White symbols indicate the presence of <it>RHD</it> specific sequences, black symbols their lack as predicted form the <it>RHD</it> exon-specific PCR-SSP results. Exons 1, 2, and 8 are shown in gray, because they are identical in <it>RHD</it> and some <it>RHCE</it> alleles. Panel A: Hybrid alleles. The molecular structures are represented as single hybrid alleles; it should be noted that the PCR patterns could also be caused by combinations of hybrid alleles or by partial <it>RHD</it> deletions. Panel B: Other alleles. The nature of the aberration is indicated, and its position visualized by a vertical bar. The <it>RHD(M295I)</it> allele is similar to weak D type 11 [<abbr bid="B32">32</abbr>] but represents a different haplotype and phenotype.</p>
               </text>
               <graphic file="1471-2156-2-10-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p><it>RHD</it> exon specific PCR-SSP of <it>Cde<sup>s</sup></it>.</p>
               </caption>
               <text>
                  <p><it>RHD</it> exon specific PCR-SSP of <it>Cde<sup>s</sup></it>. In an <it>RHD</it> positive control, <it>RHD</it> specific PCR products are obtained for the <it>RHD</it> promoter (lane marked P, 255 bp), exon 3 (154 bp), exon 4 (123 bp), exon 5 (228 bp), exon 6 (133 bp), exon 7 (123 bp), exon 9 (119 bp) and exon 10 (232 bp). The 434 bp control product derives from the <it>HGH</it> gene. In the <it>Cde<sup>s</sup></it>sample, <it>RHD</it> specific amplicons are obtained for exon 3, exon 9, and exon 10, only.</p>
               </text>
               <graphic file="1471-2156-2-10-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Demonstration of the <it>RHCE</it>(L245V) and <it>RHD</it>(N152T) substitutions characteristic of <it>Cde<sup>s</sup></it>.</p>
               </caption>
               <text>
                  <p>Demonstration of the <it>RHCE</it>(L245V) and <it>RHD</it>(N152T) substitutions characteristic of <it>Cde<sup>s</sup></it>. PCR-SSP were performed to detect single nucleotide polymorphism characteristic for <it>Cde<sup>s</sup></it> [<abbr bid="B16">16</abbr>] and indicative of <it>RHCE</it>(L245V) (lanes 1 to 4, 110 bp specific product) and <it>RHD</it>(N152T) (lanes 5 to 8, 120 bp specific product). Both polymorphism were present in the <it>Cde<sup>s</sup></it> sample as expected (lanes 1 and 5). The <it>RHD-CE(4-7)-D</it><sub>2</sub> sample was compatible with <it>Cde<sup>s</sup></it> according to the <it>RHD</it> exon specific PCR (Fig. <figr fid="F1">1</figr>) but lacked both polymorphism (lanes 2 and 6). Negative controls were standard <it>RHD</it> (lanes 3 and 7), positive controls weak D type 4 (lane 4) and D<sup>III</sup> type IV (lane 8), respectively.</p>
               </text>
               <graphic file="1471-2156-2-10-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Molecular cause of the negative <it>RHD</it> promoter PCR in <it>Cde<sup>s</sup></it>.</p>
               </caption>
               <text>
                  <p>Molecular cause of the negative <it>RHD</it> promoter PCR in <it>Cde<sup>s</sup></it>. The nucleotide sequence of the <it>Cde<sup>s</sup></it><it>, RHD</it> and <it>RHCE</it> promoter reaching from about 1550 to 901 bp 5' of the A of the start codon is shown. The positions of the <it>RHD</it> specific primers re011d and re012 used for the <it>RHD</it> promoter PCR are given. Nucleotides indicating <it>RHD</it> or <it>RHCE</it> origin of the <it>Cde<sup>s</sup></it> sequence are highlighted. The <it>Cde<sup>s</sup></it> promoter sequence represents <it>RHD.</it> A small DNA stretch of at least 13 bp in the region of re012 is replaced by the corresponding sequence of <it>RHCE.</it> This gene conversion caused the negative result obtained in the <it>RHD</it> promoter PCR-SSP (Fig. <figr fid="F2">2</figr>). <it>RHCE</it> nucleotide sequence is according to GenBank accession number AL031284.</p>
               </text>
               <graphic file="1471-2156-2-10-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>D<sub>el</sub> phenotype</p>
            </st>
            <p>D<sub>el</sub> is defined by expressing trace amounts of antigen D that can be detected by an adsorption/elution study only [<abbr bid="B30">30</abbr>]. Because current routine serology cannot discriminate D negative from the D<sub>el</sub> phenotype, at least one RBC sample of each allele (Fig. <figr fid="F1">1</figr>) was tested by adsorption and elution. Three alleles represented the D<sub>el</sub> phenotype (Fig. <figr fid="F1">1B</figr>) and were characterized by one missense and two splice site mutations, respectively. For each allele, only a single sample was sequenced, and the influence of the mutations on mRNA splicing was not verified by cDNA analysis. Because lack of material, we could not formally exclude the D<sub>el</sub> phenotype for the two <it>RHD-CE(2-7)-D</it><sub>1</sub> samples (Fig. <figr fid="F1">1A</figr>). However, a D<sub>el</sub> expressed by this allele was very unlikely, as several other hybrid alleles carrying smaller gene conversions, like <it>RHD-CE(2-7)-D</it><sub>2</sub>, were unequivocally D negative.</p>
         </sec>
         <sec>
            <st>
               <p>Population frequencies</p>
            </st>
            <p>The population frequencies of the alleles were calculated (Table <tblr tid="T2">2</tblr>). The cumulative frequency of all antigen D negative <it>RHD</it> gene positive haplotypes was estimated to be 1:1,537. The most frequent allele was <it>RHD-CE(2-9)-D</it><sub>2</sub> with a frequency of 1:5,682, representing about 27% of antigen D negative <it>RHD</it> gene positive alleles. Hybrid alleles lacking <it>RHD</it> exon 4 to exon 7 accounted for 68% of antigen D negative <it>RHD</it> gene positive alleles. 84% of antigen D negative <it>RHD</it> positive haplotypes carried the antigen C, compared to less than 3% of all D negative haplotypes [<abbr bid="B28">28</abbr>]. The cumulative allele frequency of D<sub>el</sub> was 1:3,030.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Estimated population frequencies for antigen D negative <it>RHD</it> positive and D<sub>el</sub> haplotypes in Europeans</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4" ca="center">
                        <p>Frequencies</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2" ca="center">
                        <p>In population</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Within haplotype</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Allele</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Estimate</p>
                     </c>
                     <c ca="center">
                        <p>95% confidence interval</p>
                     </c>
                     <c ca="left">
                        <p>Estimate</p>
                     </c>
                     <c ca="left">
                        <p>Haplotype</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5" ca="left">
                        <p>
                           <it>D negative alleles</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(2-9)-D</it>
                           <sub>2</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:5,682</p>
                     </c>
                     <c ca="center">
                        <p>1:3,046 - 1:13,837</p>
                     </c>
                     <c ca="left">
                        <p>1:62</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(2-9)-D</it>
                           <sub>1</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:15,152</p>
                     </c>
                     <c ca="center">
                        <p>1:5,610 - 1:55,568</p>
                     </c>
                     <c ca="left">
                        <p>1:167</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(8-9)-D</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:15,152</p>
                     </c>
                     <c ca="center">
                        <p>1:5,610 - 1:55,568</p>
                     </c>
                     <c ca="left">
                        <p>1:167</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(4-7)-D</it>
                           <sub>1</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:18,036</p>
                     </c>
                     <c ca="center">
                        <p>1:6,678 - 1:66,145</p>
                     </c>
                     <c ca="left">
                        <p>1:101</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cdE</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(2-7)-D</it>
                           <sub>1</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:22,727</p>
                     </c>
                     <c ca="center">
                        <p>1:6,798 - 1:128,041</p>
                     </c>
                     <c ca="left">
                        <p>1:250</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(2-7)-D</it>
                           <sub>2</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:22,727</p>
                     </c>
                     <c ca="center">
                        <p>1:6,798 - 1:128,041</p>
                     </c>
                     <c ca="left">
                        <p>1:250</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(W16X)</p>
                     </c>
                     <c ca="left">
                        <p>1:22,727</p>
                     </c>
                     <c ca="center">
                        <p>1:6,798 - 1:128,041</p>
                     </c>
                     <c ca="left">
                        <p>1:250</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD&#968;</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:37,431</p>
                     </c>
                     <c ca="center">
                        <p>1:7,032 - 1:733,950</p>
                     </c>
                     <c ca="left">
                        <p>1:14,748</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>RHD-CE(4-7)-D</it>
                           <sub>2</sub>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:45,455<sup>*</sup></p>
                     </c>
                     <c ca="center">
                        <p>1:8,539 - 1:891,266</p>
                     </c>
                     <c ca="left">
                        <p>1:500<sup>*</sup></p>
                     </c>
                     <c ca="left">
                        <p><it>Cde</it> or <it>cdE</it></p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p>
                           <it>Cde</it>
                           <sup>s</sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1:45,455</p>
                     </c>
                     <c ca="center">
                        <p>1:8,539 - 1:891,266</p>
                     </c>
                     <c ca="left">
                        <p>1:500</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cede<sup>s</sup></it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(G212V)</p>
                     </c>
                     <c ca="left">
                        <p>1:45,455</p>
                     </c>
                     <c ca="center">
                        <p>1:8,539 - 1:891,266</p>
                     </c>
                     <c ca="left">
                        <p>1:500</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(Y330X)</p>
                     </c>
                     <c ca="left">
                        <p>1:45,455</p>
                     </c>
                     <c ca="center">
                        <p>1:8,539 - 1:891,266</p>
                     </c>
                     <c ca="left">
                        <p>1:500</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(IVS8+1G>A)</p>
                     </c>
                     <c ca="left">
                        <p>1:45,455</p>
                     </c>
                     <c ca="center">
                        <p>1:8,539 - 1:891,266</p>
                     </c>
                     <c ca="left">
                        <p>1:500</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHCE</it>(1-9)-D</p>
                     </c>
                     <c ca="left">
                        <p>1:54,107</p>
                     </c>
                     <c ca="center">
                        <p>1:10,164 - 1:1,060,924</p>
                     </c>
                     <c ca="left">
                        <p>1:303</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cdE</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>associated with <it>Cde</it></p>
                     </c>
                     <c ca="left">
                        <p>1:1,818</p>
                     </c>
                     <c ca="center">
                        <p>1:1,262 -1:2,711</p>
                     </c>
                     <c ca="left">
                        <p>1:20</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>associated with <it>cdE</it></p>
                     </c>
                     <c ca="left">
                        <p>1:13,527</p>
                     </c>
                     <c ca="center">
                        <p>1:5,638 - 1:39,610</p>
                     </c>
                     <c ca="left">
                        <p>1:75</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cdE</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>associated with <it>cde</it></p>
                     </c>
                     <c ca="left">
                        <p>1:37,431</p>
                     </c>
                     <c ca="center">
                        <p>1:7,032 - 1:733,950</p>
                     </c>
                     <c ca="left">
                        <p>1:14,748</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total</p>
                     </c>
                     <c ca="left">
                        <p>1:1,537</p>
                     </c>
                     <c ca="center">
                        <p>not applicable</p>
                     </c>
                     <c ca="left">
                        <p>not applicable</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5" ca="left">
                        <p>
                           <it>D</it>
                           <sub>el</sub>
                           <it>alleles</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(M295I)</p>
                     </c>
                     <c ca="left">
                        <p>1:6,493</p>
                     </c>
                     <c ca="center">
                        <p>1:3,302 - 1:13,837</p>
                     </c>
                     <c ca="left">
                        <p>1:71</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(K409K)<sup>&#8224;</sup></p>
                     </c>
                     <c ca="left">
                        <p>1:9,091</p>
                     </c>
                     <c ca="center">
                        <p>1:4,067 - 1:23,073</p>
                     </c>
                     <c ca="left">
                        <p>1:100</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c indent="1" ca="left">
                        <p><it>RHD</it>(IVS3+1G>A)</p>
                     </c>
                     <c ca="left">
                        <p>1:15,152</p>
                     </c>
                     <c ca="center">
                        <p>1:5,610 - 1:55,568</p>
                     </c>
                     <c ca="left">
                        <p>1:167</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Total</p>
                     </c>
                     <c ca="left">
                        <p>1:3,030</p>
                     </c>
                     <c ca="center">
                        <p>1:1,913 - 1:5,610</p>
                     </c>
                     <c ca="left">
                        <p>1:33</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Cde</it>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>*</sup> Assuming a <it>Cde</it> haplotype; a <it>cdE</it> haplotype would result in a frequency of 1: 54,107 (95% confidence interval: 1:10,164 - 1:1,060,924; frequency within haplotype 1:303). <sup>&#8224;</sup> Silent mutation adjacent to an intron/exon boundary, probably affecting splicing.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Analysis of SCARF samples</p>
            </st>
            <p>We obtained 2 ccddEE, 1 CcddEe and 1 ccddee (G+) DNA samples through the SCARF Exchange and tested them for promoter, intron 4, exon 7 and the 3' untranslated region by <it>RHD</it> PCR-SSP. Positive reactions were obtained with the CcddEe sample only, which was assigned to the <it>RHD-CE(8-9)-D</it> allele by <it>RHD</it> exon-specific PCR-SSP.</p>
         </sec>
         <sec>
            <st>
               <p>Optimized <it>RHD</it> PCR</p>
            </st>
            <p>Based on the population frequencies, we calculated the expected positive predictive values of a positive result for different <it>RHD</it> PCR strategies (Table <tblr tid="T3">3</tblr>). <it>RHD</it> PCR based on intron 4 and exon 7 had a considerably higher positive predictive value than testing exon 10 alone. Testing for <it>RHD&#968;</it> [<abbr bid="B14">14</abbr>] improved specificity. Even greater improvements were effected by testing for other allele like <it>RHD-CE(8-9)-D</it> or <it>RHD</it>(W16X). An optimized PCR strategy would comprise checking for <it>RHD</it> intron 4, exon 7 and intron 7 complemented by the specific detection of <it>RHD(W16X)</it> and <it>RHD&#968;</it> Antigen prediction in the rare samples positive for either of these alleles necessitates complementary methods, since the allele <it>in trans</it> may be D positive. The five polymorphism tested can be multiplexed in two PCR tubes (Fig. <figr fid="F5">5</figr>). This assay was about twice as reliable as current exon scanning approaches [<abbr bid="B6">6</abbr>,<abbr bid="B26">26</abbr>] requiring, if not multiplexed [<abbr bid="B26">26</abbr>], up to 8 separate PCR tubes [<abbr bid="B6">6</abbr>].</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p><it>RHD</it> PCR-SSP optimized for specificity.</p>
               </caption>
               <text>
                  <p><it>RHD</it> PCR-SSP optimized for specificity. The PCR is performed as a modular system consisting of two multiplex reactions. An <it>RHD</it> intron 4/exon 7 multiplex PCR-SSP (Panel A) is combined with an <it>RHD</it> intron 7 PCR that is multiplexed with reactions for the specific detection of <it>RHD</it>(W16X) and <it>RHD&#968;</it> (Panel B). Results are shown for a normal D positive sample (lane 1), a normal D negative sample (lane 2), several rare D negative samples (lanes 3 to 6) and major D positive <it>RHD</it> variants (lanes 7 and 8). Standard D positive and D negative samples and D categories VI and IV are recognized in panel A. <it>RHD-CE(8-9)-D</it> is detected in panel B by the absence of the intron 7 band (lane 3). The presence of <it>RHD</it>(W16X) and <it>RHD&#968;</it> is detected in panel B because of their specific amplicons (lanes 4 and 5). Amplicon size is Panel A, control, 434 bp (<it>HGH</it> gene); intron 4, 226 bp; exon 7, 123 bp; Panel B, control, 659 bp (chromosome 1 genomic sequence about 90,000 bp 5' of <it>Rhesus box);</it> intron 7, 390 bp; <it>RHD</it>(W16X), 248 bp; <it>RHD&#968;,</it> 154 bp. The internal control amplicons, which were devised to be larger than the specific amplicons, may be suppressed because of competition, if a specific product is amplified.</p>
               </text>
               <graphic file="1471-2156-2-10-5"/>
            </fig>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Expected rates of false positive results and expected positive predictive values for different<it>RHD</it> PCR strategies<sup>*</sup></p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>Rate of</p>
                     </c>
                     <c ca="center">
                        <p>Positive predictive value</p>
                     </c>
                     <c ca="center">
                        <p>Number of</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PCR strategy</p>
                     </c>
                     <c ca="center">
                        <p>false positives</p>
                     </c>
                     <c ca="center">
                        <p>of positive result</p>
                     </c>
                     <c ca="center">
                        <p>polymorphism tested</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exon 10 only [<abbr bid="B1">1</abbr>,<abbr bid="B2">2</abbr>]</p>
                     </c>
                     <c ca="center">
                        <p>1:1,276</p>
                     </c>
                     <c ca="center">
                        <p>0.999216</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7 [<abbr bid="B13">13</abbr>]</p>
                     </c>
                     <c ca="center">
                        <p>1:4,081</p>
                     </c>
                     <c ca="center">
                        <p>0.999755</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon <it>7/RHD&#968;</it> [<abbr bid="B14">14</abbr>]</p>
                     </c>
                     <c ca="center">
                        <p>1:4,700</p>
                     </c>
                     <c ca="center">
                        <p>0.999787</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7/W16X</p>
                     </c>
                     <c ca="center">
                        <p>1:5,212</p>
                     </c>
                     <c ca="center">
                        <p>0.999808</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7/Intron 7</p>
                     </c>
                     <c ca="center">
                        <p>1:6,051</p>
                     </c>
                     <c ca="center">
                        <p>0.999835</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exons 3, 4, 5, <it>6, 7, 9</it> [<abbr bid="B26">26</abbr>]</p>
                     </c>
                     <c ca="center">
                        <p>1:6,051</p>
                     </c>
                     <c ca="center">
                        <p>0.999835</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Exons 2, 3, 4, 5, 6, 7, 9, 10 [<abbr bid="B27">27</abbr>]</p>
                     </c>
                     <c ca="center">
                        <p>1:6,051</p>
                     </c>
                     <c ca="center">
                        <p>0.999835</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7/W16X/<it>RHD&#968;</it></p>
                     </c>
                     <c ca="center">
                        <p>1:6,267</p>
                     </c>
                     <c ca="center">
                        <p>0.999840</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>All <it>Exons/RHD&#968;</it></p>
                     </c>
                     <c ca="center">
                        <p>1:7,520</p>
                     </c>
                     <c ca="center">
                        <p>0.999867</p>
                     </c>
                     <c ca="center">
                        <p>9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7/Intron 7/W16X</p>
                     </c>
                     <c ca="center">
                        <p>1:8,921</p>
                     </c>
                     <c ca="center">
                        <p>0.999888</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Intron 4/Exon 7/Intron 7/W16X/<it>RHD&#968;</it></p>
                     </c>
                     <c ca="center">
                        <p>1:12,533</p>
                     </c>
                     <c ca="center">
                        <p>0.999920</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>*</sup> Rates were calculated based on the population frequencies of different alleles determined in the Table <tblr tid="T2">2</tblr>. The exact rates are population dependent and may vary according to the prevalence of alleles in the population tested.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Gene conversions <it>in cis</it></p>
            </st>
            <p>The gene conversion of five hybrid alleles observed in this study involved intron 2 (Fig. <figr fid="F1">1</figr>) which was utilized to delineate the allele origin of the <it>RHCE</it> gene segment found in the <it>RHD</it> gene. In all five haplotypes, a gene conversion <it>in cis</it> was likely (Fig. <figr fid="F6">6A</figr>). We proposed that gene conversions <it>in cis</it> occur during hairpin formation, which is favored by the clustered gene arrangement (Fig. <figr fid="F6">6B</figr>).</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Gene conversion <it>in cis.</it></p>
               </caption>
               <text>
                  <p>Gene conversion <it>in cis.</it> Panel A: Origin of the <it>RHCE</it> gene segments. The allele origin of the <it>RHCE</it> segments in the <it>RHD</it> gene was analyzed by a PCR length polymorphism in intron 2 [<abbr bid="B31">31</abbr>,<abbr bid="B43">43</abbr>]. The 1,177 bp product is specific for the <it>C</it> allele of <it>RHCE,</it> the 1,068 bp product for the <it>c</it> allele of <it>RHCE</it> and for <it>RHD.</it> The CcDee control shows a strong band at the c/D position and a weaker band at the C position (lane 1). The cE associated <it>RHCE(1-9)-D</it> hybrid allele lacks the C band (lane 2), indicating that the intron 2 of the hybrid allele derives from c. In contrast, all Ce associated hybrid alleles involving intron 2 show a strong C band and a weaker c/D band (lanes 3 to 6), indicating that the introns 2 of those hybrids derive from C. Panel B: Proposed mechanism of gene conversion <it>in cis.</it> (i) The <it>RHD</it> and <it>RHCE</it> genes are inversely orientated [<abbr bid="B7">7</abbr>] as typical for clustered genes. (ii) A putative hairpin formation of the chromosome allows the close proximity of homologous segments in identical orientation. This structural feature is instrumental for gene conversion events <it>in cis.</it> (iii) Resolving the hairpin yields an <it>RHD-CE-D</it> hybrid gene structure, many of which have been observed to date at the <it>RH gene</it> locus. As an example, the <it>RHD-CE(4-7)-D</it> hybrid exon structure is shown. Symbols are according to Fig. <figr fid="F1">1</figr>.</p>
               </text>
               <graphic file="1471-2156-2-10-6"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Anti-D immunizations</p>
            </st>
            <p>A flow cytometry study of the RBC from the D<sup>+/-</sup> chimera revealed 94% D negative RBC and an admixture of 6 % D positive RBC (Fig. <figr fid="F7">7</figr>). This chimera was confirmed in a 3 month follow-up. The 24 year old donor was healthy and had no twin. A look-back of this donor revealed 13 units that had been issued as D negative. Two D negative recipients were traced and available for an antibody screen, both of whom were anti-D immunized.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Flow cytometric analysis of a D<sup>+/-</sup> chimera.</p>
               </caption>
               <text>
                  <p>Flow cytometric analysis of a D<sup>+/-</sup> chimera. The fluorescence histograms obtained by indirect immunofluorescence with a polyclonal anti-D are shown for the index donation of the chimerical donor (Panel A), a second donation three month later (Panel B) and a control mixture containing 5% D positive RBC (Panel C). There are two peaks separated by a large gap indicating that two different RBC populations are present. The left peak represents D negative RBC, the right peak D positive RBC carrying a normal strength antigen D. The positive RBC population of the donor was about 6%.</p>
               </text>
               <graphic file="1471-2156-2-10-7"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In a systematic population survey including more than 8,000 antigen D negative blood donations, we identified 14 different <it>RHD</it> positive antigen D negative and 3 different D<sub>el</sub> haplotypes, the majority of which were novel. The molecular bases were alleles comprising <it>RHD/RHCE</it> hybrids, stop codons, missense mutations and splice site mutations. The cumulative frequency of <it>RHD</it> gene positive antigen D negative haplotypes was about 1:1,500; that of the <it>D<sub>el</sub></it> alleles was about 1:3,000. We determined the specificity of antigen D prediction by PCR and devised an optimized <it>RHD</it> PCR strategy with a calculated positive predictive value greater than 0.9999. Five antigen D positive samples missed by routine D typing were uncovered and two anti-D immunizations traced.</p>
         <p>For practical purposes, two groups of <it>RHD</it> alleles that do not express antigen D can be distinguished. <it>RHD</it> alleles of the first group lack some or many <it>RHD</it> specific polymorphism and usually represent <it>RHD/CE</it> hybrids. For alleles of this group, a correct antigen D prediction may be accomplished by a prudent selection of the <it>RHD</it> specific polymorphism utilized for <it>RHD</it> genotyping. <it>RHD</it> alleles of the second group carry all <it>RHD</it> specific polymorphism and most often harbor point mutations. For alleles of this group, a correct antigen D prediction necessitates the specific detection of an aberration that is usually unique to the allele. The identification of four new alleles in this group increased the number of known alleles from 3 to 7 and was critical for improving <it>RHD</it> genotyping.</p>
         <p>The data of this study allowed for the first time to calculate population frequencies of <it>RHD</it> positive antigen D negative and <it>D<sub>el</sub></it> alleles. This information was indispensable to derive rational <it>RHD</it> typing strategies and will be essential for establishing cost-efficient approaches. The majority of samples belonging to the first group of D negative alleles (probable <it>RHD/CE</it> hybrids) was compatible with <it>RHD-CE-D</it> hybrid alleles, in which the DNA segment derived from the <it>RHCE</it> gene encompassed at least exon 4 to exon 7. These samples would be correctly typed, if exon 4/intron 4 and exon 7 were used for <it>RHD</it> genotyping, as proposed previously [<abbr bid="B13">13</abbr>]. With the exception of <it>RHD</it> exon 9, testing additional <it>RHD</it> exons would not have improved the specificity of antigen D prediction. Improving this specificity, however, became possible by the specific detection of frequent alleles of the second group, like <it>RHD&#968;</it> and <it>RHD</it>(W16X). We demonstrated that testing 5 carefully selected polymorphism would have resulted in an assay yielding false positive results at a rate less than 1:12,000, and hence would have doubled the specificity compared to contemporary approaches testing all informative <it>RHD</it> exons [<abbr bid="B6">6</abbr>,<abbr bid="B26">26</abbr>]. Further improvements may be achieved by the specific detection of additional alleles, that might become practical in massively parallel molecular assays.</p>
         <p>The detailed analysis including intron polymorphism revealed that the first group of alleles (probable <it>RHD/CE</it> hybrids) represented at least 9 different molecular events. We proposed that the proximity and inverse orientation of both <it>RH</it> genes favored gene conversions occurring <it>in cis</it> (Fig. <figr fid="F6">6</figr>), which have also been noted in partial D [<abbr bid="B31">31</abbr>]. An exact definition of the molecular bases of the <it>RHD/CE</it> hybrids would allow their specific detection, even if they were positioned <it>in trans</it> to the regular <it>RHD</it> allele. Such a detection would be necessary, if molecular <it>RH</it> zygosity testing is expected to achieve the same specificity as antigen D prediction.</p>
         <p>A considerable proportion of seemingly D negative samples carrying the <it>RHD</it> gene presented a D<sub>el</sub> phenotype. Interestingly, <it>RHD</it>(M295I) coded for weak D, if associated with a <it>ce</it> haplotype [<abbr bid="B32">32</abbr>], but for D<sub>el</sub>, if associated with a <it>Ce</it> haplotype; this observation may be explained by the suppressive effect of C <it>in cis</it> [<abbr bid="B33">33</abbr>].</p>
         <p>The nature and frequency of <it>RHD</it> gene positive antigen D negative alleles differ among populations. Apart from a probably lower absolute frequency, we detected in Europeans many parallels to oriental populations: Both populations shared the diverse nature of <it>RHD</it> haplotypes of the first group (probable <it>RHD/CE</it> hybrids) [<abbr bid="B18">18</abbr>,<abbr bid="B19">19</abbr>,<abbr bid="B20">20</abbr>], the preferential occurrence of <it>RHD</it> positive antigen D negative alleles in <it>Cde</it> haplotypes [<abbr bid="B18">18</abbr>], and the comparatively frequent observation of D<sub>el</sub> phenotypes [<abbr bid="B19">19</abbr>]. In contrast, <it>RHD&#968;</it> and <it>Cde<sup>s</sup></it> are predominant in African populations [<abbr bid="B14">14</abbr>]. Still another situation may be present in the middle-west USA, where 6 of 26 <it>RHD</it> gene positive antigen D negative samples had aberrations limited to a single exon yet detectable by PCR [<abbr bid="B34">34</abbr>].</p>
         <p>Blood group serologists might note the observation of 5 D positive samples in our study with disturbance. In many centers, donors are checked for antigen D by sensitive methods at first and second donations only. On subsequent donations, carriers of partial D, like D<sup>vI</sup> or DIM, some weak D and D<sup>+/-</sup> chimerism may pass unnoticed in tests based on direct agglutination, even with the most avid IgM anti-D. Immunizations caused by units of such donors will generally be missed, because the occurrence of an anti-D in a patient is usually not further investigated [<abbr bid="B35">35</abbr>]. For example, the two anti-D immunizations induced by units of the chimerical donor of this study were found only in a look-back triggered by our molecular screen. Chimeras in the Rh system have repeatedly been observed [<abbr bid="B36">36</abbr>,<abbr bid="B37">37</abbr>] and chimeras may be a more widespread phenomenon than anticipated [<abbr bid="B38">38</abbr>]. A lower antigen density threshold for anti-D immunization has not been established yet, and future studies might indicate a need to exclude even D<sub>el</sub> donors from transfusion to D negative recipients. A routine investigation of all samples by adsorption and elution is not feasible. However, checking D-negative samples, especially those occurring with a C or E or both, for <it>RHD</it> specific sequences by nucleic amplification techniques may become practical in the near future. The knowledge of the detected alleles is also important for fetal genotyping assays using fetal DNA in maternal plasma, because false positive results will be obtained in mothers harboring <it>RHD</it> positive D negative alleles.</p>
      </sec>
      <sec>
         <st>
            <p>Subjects and Methods</p>
         </st>
         <sec>
            <st>
               <p>Blood samples</p>
            </st>
            <p>EDTA- or citrate-anticoagulated blood samples were collected from blood donors characterized as D negative in routine typing including an antiglobulin test with anti-D. The D antigen determination in antiglobulin technique was performed as part of routine blood donor typing over a period of more than 15 years with varying commercial anti-D in tube or column agglutination. For each donor, this antiglobulin test was done only once, if the donor lacked the antigens C or E, and two times from independent samples, if the donor was either C or E positive. Subsequent donations were checked by direct agglutination using an Olympus PK7200 autoanalyzer only. Samples were collected at random for specific CcEe phenotypes. DNA was isolated by a modified salting-out procedure as described [<abbr bid="B27">27</abbr>,<abbr bid="B39">39</abbr>].</p>
         </sec>
         <sec>
            <st>
               <p>Screening by PCR with sequence specific priming (PCR-SSP)</p>
            </st>
            <p>For the first population survey, 314 ccddee, 433 Ccddee, 271 ccddEe, 19 CcddEe, 24 CCddee, 1 CcddEE and 6 ccddEE samples were tested individually for the presence of <it>RHD</it> specific polymorphism located in the <it>RHD</it> promoter, intron 4, exon 7 and the 3' untranslated region of exon 10 by PCR-SSP. The donor previously reported as "CCD<sup>nex</sup>ee" [<abbr bid="B27">27</abbr>] returned by chance and his allele was further characterized as <it>RHD-CE(8-9)-D.</it></p>
            <p>For the second population survey, 7,374 ccddee samples were analyzed in pools. Equal volumes of 20 samples were mixed. To confirm the sensitivity of the pool testing, 1% of D positive blood was added to an aliquot as positive control. DNA was extracted and checked for <it>RHD</it> promoter, intron 4, and exon 10 using modified PCR-SSP to enhance sensitivity. Repeated testing of donors was minimal, because the mandatory donation interval exceeded the collection period.</p>
            <p>The donors were representative for the population currently living in the county of <it>(Land)</it> Baden-W&#252;rttemberg. The ethnic origin of individual donors, in particular of those carrying <it>Cde<sup>s</sup></it> or <it>RHD&#968;</it> was not identified. Independent of the population surveys, 2 ccddEE, 1 CcddEe and 1 ccddee DNA samples of unknown ethnic backgrounds were obtained from the SCARF Exchange (Hahnemann University, Philadelphia, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Further molecular characterization</p>
            </st>
            <p>All samples positive for any of the above mentioned PCR-SSP assays were further investigated for the presence of <it>RHD</it> specific polymorphism in exon 3, exon 4, exon 5, exon 6, exon 7, and exon 9 by PCR-SSP. Samples positive for all PCR-SSP were sequenced, until they could be assigned to a distinct <it>RHD</it> allele. Samples negative for some PCR-SSP were checked for informative polymorphism in intron 1, intron 2, intron 7, intron 8, and intron 9.</p>
         </sec>
         <sec>
            <st>
               <p>Analysis for <it>Cde<sup>s</sup></it> and <it>RHD&#968;</it></p>
            </st>
            <p><it>RHD</it>(N152T) and <it>RHCE</it>(L245V) present in <it>Cde<sup>s</sup></it> [<abbr bid="B16">16</abbr>] were checked by PCR-SSP. The 37 bp insertion present in <it>RHD&#968;</it> was detected by PCR-SSP. The 37 bp insertion, the M218I, F223V and S225F missense mutations and the Y269X nonsense mutation previously described for <it>RHD&#968;</it> [<abbr bid="B14">14</abbr>] were confirmed by sequencing of all 10 exons; no additional aberrations were detected.</p>
         </sec>
         <sec>
            <st>
               <p>Nucleotide sequencing</p>
            </st>
            <p>The ten <it>RHD</it> exons were sequenced as described [<abbr bid="B29">29</abbr>,<abbr bid="B32">32</abbr>]. The promoter was amplified with primers rend31k (for <it>RHD</it> alleles) or re04 (for <it>RHCE)</it> and rb45 and a DNA stretch encompassing primer re012 was sequenced using primers re08 and re09.</p>
         </sec>
         <sec>
            <st>
               <p><it>RHD</it> PCR</p>
            </st>
            <p>Most <it>RHD</it> PCR-SSP were similar to the <it>RHD</it> exon specific PCR-SSP previously described [<abbr bid="B27">27</abbr>]. Cycling conditions consisted of an initial denaturation of 2 min at 94&#176;C, followed by ten cycles of 10 s denaturation at 94&#176;C and 1 min annealing/extension at 65&#176;C; and finally 25 cycles of 30 s denaturation at 94&#176;C, 1 min annealing at 61&#176;C and 30 s extension at 72&#176;C. 0.4 U Taq polymerase (Qiagen, Hilden, Germany) were used in a final volume of 10 &#956;l. Primers (Table 4) were re012 and re011d for the promoter; re41 and rb12 for intron 4; ga71 and ga72 for exon 7 in the PCR-SSP screening; rea7 and rr4 for exon 10; ga31 and rb21 for exon 3; ga41 and ga42 for exon 4; rb24 and ga51 for exon 5; ga62 and ga61 for exon 6; rb26 and re71 for exon 7 in the molecular work-up; re83 and re94 for exon 9; rb51 and rb52 for intron 7; RhPsiF and RhPsiB for <it>RHD&#968; ;</it> Rh152Tb and ga31 for <it>RHD</it>(N152T); and Rh223Vf and Rh245Vb for <it>RHCE</it>(L245V). Primer concentrations were 0.2 &#956;M except for exon 6 (0.1 &#956;M), <it>RHD</it>(N152T)(0.3 &#956;M), and intron 7 and exon 9 (both 0.4 &#956;M). For most samples intron 4/exon 7 was tested as multiplex reaction containing 0.2 &#956;M of exon 7 (ga71/ga72) and 0.1 &#956;M of intron 4 primers. As internal control, two primers amplifying an <it>HGH</it> gene fragment were added in concentrations of 0.05 &#956;M for promoter, intron 4, and exon 7 (ga71/ga72); 0.075 &#956;M for exon 10; 0.1 &#956;M for intron 7, RHD&#968;, <it>RHD</it>(N152T) and RHCE<it>(L245V);</it> 0.15 &#956;M for exon 3, exon 4, exon 7 (rb26/re71), and exon 9; 0.2 &#956;M for exon 5 and exon 6. Mg<sup>2+</sup> concentration was 0.15 &#956;M, except 0.4 &#956;M for intron 7. For exon 6, 20 % solution Q (Qiagen) was added. To enhance sensitivity, the pools were tested with <it>RHD</it> primers in a concentration of 0.3 &#956;M and <it>HGH</it> primers at 0.1 &#956;M.</p>
            <p>Intron 1 was tested 1173 and 1174 bp 5' of the intron 1/exon 2 boundary by <it>RHD</it> specific amplification of exon 2 as described [<abbr bid="B32">32</abbr>]. Intron 2 was evaluated by PCR with length polymorphism as described [<abbr bid="B31">31</abbr>]. The <it>BamH</it>I restriction site introduced by the 9 bp deletion in <it>RHD</it> intron 8 position 1114 to 1122 (Genbank accession number AL139426) was checked after amplification with primers re74 and re93 and digestion with <it>BamH</it>I. The 980 bp deletion starting at position 633 in <it>RHD</it> intron 9 (Genbank accession number AL139426) was evaluated using primers re93k and re916.</p>
         </sec>
         <sec>
            <st>
               <p>Optimized <it>RHD</it> PCR-SSP for routine DNA typing</p>
            </st>
            <p>Reaction A contained primers ga71 and ga72 at 0.3 &#956;M, rb12 and re41 at 0.1 &#956;M, and <it>HGH</it> primers at 0.1 &#956;M. Mg<sup>2+</sup> was at 0.175 &#956;M. Reaction B contained primers RhPsiF and RhPsiB at 0.5 &#956;M, re11d and RhX1f1 at 0.3 &#956;M, re721 and rb9 at 0.2 &#956;M and as control primers rend9b1 and rend9b2 at 0.2 &#956;M. Mg<sup>2+</sup> was at 0.15 &#956;M.</p>
         </sec>
         <sec>
            <st>
               <p>Immunohematology</p>
            </st>
            <p>One sample of each <it>RHD</it> positive allele was evaluated by direct agglutination with two monoclonal anti-D (Seraclone anti-D, clone BS226; Biotest, Dreieich, Germany; and Frekaklon anti-D, clone MS201; Gull, Bad Homburg, Germany). Indirect antiglobulin test was done in a gel matrix test (LISS-Coombs 37&#176;C, DiaMed-ID Micro Typing System, DiaMed, Cressier sur Morat, Switzerland) using an oligoclonal anti-D (Seraclone anti-D blend, clones H41 11B7, BS221 and BS232; Biotest). Samples reactive in gel matrix technique were further investigated using the monoclonal anti-D HM10, HM16, P3x61, P3x35, P3x212 11F1, P3x212 23B10, P3x241, P3x249, P3x290 (Diagast, Loos, France) and H41 11B7 (Biotest). The presence of a D<sub>el</sub> phenotype was determined by adsorption of 500 &#956;l of a polyclonal anti-D (human incomplete anti-D; Lorne Laboratories, Reading, UK) to 500 &#956;l packed red blood cells (RBC) for 1 h at 37&#176;C and elution using a chloroform technique [<abbr bid="B35">35</abbr>]. A detailed serologic report of the <it>RHD</it>(C285Y) sample, dubbed DIM [<abbr bid="B29">29</abbr>], has been published separately.</p>
         </sec>
         <sec>
            <st>
               <p>Flow cytometry</p>
            </st>
            <p>Flow cytometry was performed as described [<abbr bid="B40">40</abbr>,<abbr bid="B41">41</abbr>] using a polyclonal anti-D (anti-D Molter; Ortho Clinical Diagnostics, Neckarsgm&#252;nd, Germany) as primary and goat anti-human IgG, F<sub>ab</sub>-fragment, FITC-conjugated (Dianova, Hamburg, Germany) as secondary antibody. Markers were set to encompass >99.5% of a D positive control and less than 0.5% of a D negative control. The percentage of cells in the marker area was evaluated.</p>
         </sec>
         <sec>
            <st>
               <p>Haplotype frequencies</p>
            </st>
            <p>For alleles observed more than once, the haplotype association with <it>Cde</it> and <it>cdE</it> was obvious, because of their repeated observations in association with the rare phenotypes Ccddee or ccddEe, respectively. Based on the paucity of <it>RHD</it> positive samples among the ccddee samples, alleles that were observed only once were assumed to be associated with the <it>Cde</it> or <it>cdE</it> haplotype rather than the <it>cde</it> haplotype. An allele occurring in an unique CcddEe sample was counted as <it>Cde.</it> The <it>RHD&#968;</it> allele was assumed to be associated with the <it>ce</it>(W16C) allele, because <it>RHCE</it> specific sequencing of exon 1 revealed a C/G heterozygosity at position 64 and <it>ce</it>(W16C) is almost absent from the <it>cde</it> haplotypes in our population [<abbr bid="B27">27</abbr>]. The frequency of a given aberrant <it>RHD</it> allele in its haplotype was calculated as the number of observed samples divided by the number of the corresponding haplotypes under observation (500 <it>Cde,</it> 303 <it>cdE).</it> For <it>cde,</it> the haplotype frequency was calculated from the 14,748 haplotypes checked in the second survey. The population frequency of an <it>RHD</it> allele was calculated from the frequency of this allele in its haplotype and the known frequency of the haplotype in the local population [<abbr bid="B28">28</abbr>]. Confidence intervals were calculated according to the Poisson distribution [<abbr bid="B42">42</abbr>]. Donors were not generally checked for kinship. However, the three <it>RHD-CE(8-9)-D</it> donors were siblings; a fourth sample was independently observed in the single <it>RHD</it> positive DNA from the SCARF Exchange.</p>
         </sec>
         <tbl id="T4">
            <title>
               <p>Table 4</p>
            </title>
            <caption>
               <p>Primers used</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>Genomic</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Name</p>
                  </c>
                  <c ca="left">
                     <p>Nucleotide sequence</p>
                  </c>
                  <c ca="center">
                     <p>region</p>
                  </c>
                  <c ca="center">
                     <p>Position<sup>*</sup></p>
                  </c>
                  <c ca="left">
                     <p>Strandedness</p>
                  </c>
                  <c ca="left">
                     <p>specificity</p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga31</p>
                  </c>
                  <c ca="left">
                     <p>ttgtcggtgctgatctcagtgga</p>
                  </c>
                  <c ca="center">
                     <p>exon 3</p>
                  </c>
                  <c ca="center">
                     <p>362 to 383</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga41</p>
                  </c>
                  <c ca="left">
                     <p>acatgatgcacatctacgtgttcgc</p>
                  </c>
                  <c ca="center">
                     <p>exon 4</p>
                  </c>
                  <c ca="center">
                     <p>503 to 527</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga42</p>
                  </c>
                  <c ca="left">
                     <p>cagacaaactgggtatcgttgctg</p>
                  </c>
                  <c ca="center">
                     <p>exon 4</p>
                  </c>
                  <c ca="center">
                     <p>625 to 602</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga51</p>
                  </c>
                  <c ca="left">
                     <p>ctgctcaccttgctgatcttccc</p>
                  </c>
                  <c ca="center">
                     <p>intron 5/exon.</p>
                  </c>
                  <c ca="center">
                     <p>5 8 to 787</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga61</p>
                  </c>
                  <c ca="left">
                     <p>caggtacttggctcccccgac</p>
                  </c>
                  <c ca="center">
                     <p>exon 6</p>
                  </c>
                  <c ca="center">
                     <p>936 to 916</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga62</p>
                  </c>
                  <c ca="left">
                     <p>ttatgtgcacagtgcggtgttgg</p>
                  </c>
                  <c ca="center">
                     <p>exon 6</p>
                  </c>
                  <c ca="center">
                     <p>804 to 826</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga71</p>
                  </c>
                  <c ca="left">
                     <p>gttgtaaccgagtgctggggattc</p>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>944 to 967</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ga72</p>
                  </c>
                  <c ca="left">
                     <p>tgccggctccgacggtatc</p>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1066 to 1048</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb12</p>
                  </c>
                  <c ca="left">
                     <p>tcctgaacctgctctgtgaagtgc</p>
                  </c>
                  <c ca="center">
                     <p>intron 4</p>
                  </c>
                  <c ca="center">
                     <p>198 to 175</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb21</p>
                  </c>
                  <c ca="left">
                     <p>aggtccctcctccagcac</p>
                  </c>
                  <c ca="center">
                     <p>intron 3</p>
                  </c>
                  <c ca="center">
                     <p>28 to 11</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb24</p>
                  </c>
                  <c ca="left">
                     <p>agacctttggagcaggagtg</p>
                  </c>
                  <c ca="center">
                     <p>intron 4</p>
                  </c>
                  <c ca="center">
                     <p>-53 to -34</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb26</p>
                  </c>
                  <c ca="left">
                     <p>aggggtgggtagggaatatg</p>
                  </c>
                  <c ca="center">
                     <p>intron 6</p>
                  </c>
                  <c ca="center">
                     <p>-62 to -43</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb45</p>
                  </c>
                  <c ca="left">
                     <p>acactgttgrctgaatttcggtgc</p>
                  </c>
                  <c ca="center">
                     <p>intron 1</p>
                  </c>
                  <c ca="center">
                     <p>164 to 139</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb51</p>
                  </c>
                  <c ca="left">
                     <p>gcatgacgtgttctgcctcttg</p>
                  </c>
                  <c ca="center">
                     <p>intron 7</p>
                  </c>
                  <c ca="center">
                     <p>-3365 to - 3386</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rb52</p>
                  </c>
                  <c ca="left">
                     <p>ccaggttgttaagcattgctgtacc</p>
                  </c>
                  <c ca="center">
                     <p>intron 7</p>
                  </c>
                  <c ca="center">
                     <p>-3433 to -3409</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re04</p>
                  </c>
                  <c ca="left">
                     <p>aggtcacatccatttatcccactg</p>
                  </c>
                  <c ca="center">
                     <p>promoter</p>
                  </c>
                  <c ca="center">
                     <p>-2498 to -2474</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re08</p>
                  </c>
                  <c ca="left">
                     <p>gggcttgggacttagttctaac</p>
                  </c>
                  <c ca="center">
                     <p>promoter</p>
                  </c>
                  <c ca="center">
                     <p>-858 to -879</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re09</p>
                  </c>
                  <c ca="left">
                     <p>cgactgggtgattaaaatctcc</p>
                  </c>
                  <c ca="center">
                     <p>promoter</p>
                  </c>
                  <c ca="center">
                     <p>-1280to-1259</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re011d</p>
                  </c>
                  <c ca="left">
                     <p>gcagccaacttcccctgtg</p>
                  </c>
                  <c ca="center">
                     <p>promoter</p>
                  </c>
                  <c ca="center">
                     <p>-883 to -905</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re012</p>
                  </c>
                  <c ca="left">
                     <p>tccactttccacctccctgc</p>
                  </c>
                  <c ca="center">
                     <p>promoter</p>
                  </c>
                  <c ca="center">
                     <p>-1148to-1122</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>relld</p>
                  </c>
                  <c ca="left">
                     <p>agaagatgggggaatctttttcct</p>
                  </c>
                  <c ca="center">
                     <p>intron 1</p>
                  </c>
                  <c ca="center">
                     <p>129 to 106</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re41</p>
                  </c>
                  <c ca="left">
                     <p>cgatacccagtttgtctgccatgc</p>
                  </c>
                  <c ca="center">
                     <p>exon 4</p>
                  </c>
                  <c ca="center">
                     <p>608 to 631</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re71</p>
                  </c>
                  <c ca="left">
                     <p>acccagcaagctgaagttgtagcc</p>
                  </c>
                  <c ca="center">
                     <p>exon 7</p>
                  </c>
                  <c ca="center">
                     <p>1,008 to 985</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re74</p>
                  </c>
                  <c ca="left">
                     <p>tatccatgaggtgctgggaac</p>
                  </c>
                  <c ca="center">
                     <p>intron 7</p>
                  </c>
                  <c ca="center">
                     <p>-244 to -224</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re721</p>
                  </c>
                  <c ca="left">
                     <p>ctggaggctctgagaggttgag</p>
                  </c>
                  <c ca="center">
                     <p>intron 7</p>
                  </c>
                  <c ca="center">
                     <p>-348 to -326</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re83</p>
                  </c>
                  <c ca="left">
                     <p>gagattaaaaatcctgtgctcca</p>
                  </c>
                  <c ca="center">
                     <p>intron 8</p>
                  </c>
                  <c ca="center">
                     <p>-54 to - 34</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re93</p>
                  </c>
                  <c ca="left">
                     <p>cacccgcatgtcagactatttggc</p>
                  </c>
                  <c ca="center">
                     <p>intron 9</p>
                  </c>
                  <c ca="center">
                     <p>320 to 297</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re93k</p>
                  </c>
                  <c ca="left">
                     <p>gccaaatagtttgacatgcgggtg</p>
                  </c>
                  <c ca="center">
                     <p>intron 9</p>
                  </c>
                  <c ca="center">
                     <p>297 to 320</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re94</p>
                  </c>
                  <c ca="left">
                     <p>cttggtcatcaaaatatttagcct</p>
                  </c>
                  <c ca="center">
                     <p>exon 9</p>
                  </c>
                  <c ca="center">
                     <p>1216 to 1193</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>re916</p>
                  </c>
                  <c ca="left">
                     <p>gtttttgaggcaaagtctcgctc</p>
                  </c>
                  <c ca="center">
                     <p>intron 9</p>
                  </c>
                  <c ca="center">
                     <p>1689 to 1666</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rea7</p>
                  </c>
                  <c ca="left">
                     <p>tgttgcctgcatttgtacgtgag</p>
                  </c>
                  <c ca="center">
                     <p>3' UTR<sup>&#8224;</sup></p>
                  </c>
                  <c ca="center">
                     <p>1311 to 1333</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD/RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rend31k</p>
                  </c>
                  <c ca="left">
                     <p>cctccccaacccagacagaattag</p>
                  </c>
                  <c ca="center">
                     <p>AJ252311<sup>&#8225;</sup></p>
                  </c>
                  <c ca="center">
                     <p>8506 to 8529</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>not applicable</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rend9b1</p>
                  </c>
                  <c ca="left">
                     <p>cactgcacttggcaccattgag</p>
                  </c>
                  <c ca="center">
                     <p>AL031432</p>
                  </c>
                  <c ca="center">
                     <p>29489 to 29468</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>not applicable</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rend9b2</p>
                  </c>
                  <c ca="left">
                     <p>ttccgaaggctgcttttccc</p>
                  </c>
                  <c ca="center">
                     <p>AL031432</p>
                  </c>
                  <c ca="center">
                     <p>28840 to 28859</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>not applicable</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rh152Tb</p>
                  </c>
                  <c ca="left">
                     <p>gatattactgatgaccatcctcatgg</p>
                  </c>
                  <c ca="center">
                     <p>exon3</p>
                  </c>
                  <c ca="center">
                     <p>480 to 455</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rh223Vf</p>
                  </c>
                  <c ca="left">
                     <p>ttgtggatgttctggccaagtg</p>
                  </c>
                  <c ca="center">
                     <p>exon 5</p>
                  </c>
                  <c ca="center">
                     <p>646 to 667</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHCE</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Rh245Vb</p>
                  </c>
                  <c ca="left">
                     <p>gctgtcaccactctgactgctac</p>
                  </c>
                  <c ca="center">
                     <p>exon5</p>
                  </c>
                  <c ca="center">
                     <p>755 to 733</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RhPsiB</p>
                  </c>
                  <c ca="left">
                     <p>tctgatctttatcctccgttccctc</p>
                  </c>
                  <c ca="center">
                     <p>exon 4</p>
                  </c>
                  <c ca="center">
                     <p>601 to 577</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RhPsiF</p>
                  </c>
                  <c ca="left">
                     <p>agacagactaccacatgaacttac</p>
                  </c>
                  <c ca="center">
                     <p>intron 3</p>
                  </c>
                  <c ca="center">
                     <p>-38 to-15</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD&#968;</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RhX1f1</p>
                  </c>
                  <c ca="left">
                     <p>cgctgcctgcccctctga</p>
                  </c>
                  <c ca="center">
                     <p>exon 1</p>
                  </c>
                  <c ca="center">
                     <p>31 to 48</p>
                  </c>
                  <c ca="left">
                     <p>sense</p>
                  </c>
                  <c ca="left">
                     <p><it>RHD</it>(W16X)</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>rr4</p>
                  </c>
                  <c ca="left">
                     <p>agcttactggatgaccacca</p>
                  </c>
                  <c ca="center">
                     <p>3'UTR</p>
                  </c>
                  <c ca="center">
                     <p>1,541 to 1,522</p>
                  </c>
                  <c ca="left">
                     <p>antisense</p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>RHD</it>
                     </p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>*</sup>The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons including the 3' untranslated part of exon 10, relative to their adjacent exon/intron boundaries of <it>RHCE</it> for primers in introns; and according to the numbering in the genomic sequences indicated. Primers rh1 [<abbr bid="B44">44</abbr>], ga31 (previously dubbed D-3-383), ga41 (D-4-527), ga42 (D-4-602), ga51 (D-5-787), ga61 (D-6-916), ga62 (D-6-826), ga71 (D-7-967), ga72 (D-7-1048) [<abbr bid="B27">27</abbr>], rb5, rb12, rb24, rh5, rh7 [<abbr bid="B31">31</abbr>], rb21, rb26, re11d, re71, re74, re83, re93, rr4 [<abbr bid="B32">32</abbr>], re012 [<abbr bid="B29">29</abbr>], re011d and rea7 [<abbr bid="B7">7</abbr>] have been published previously. <sup>&#8224;</sup> 5' UTR: 5' untranslated region of exon 1; 3' UTR: 3' untranslated region of exon 10. <sup>&#8225;</sup> Accession number of nucleic acid sequence in EMBL/GenBank/DDBJ; AJ252311 represents upstream <it>Rhesus box;</it> AL031431 Chromosome 1 genomic clone dJ465N24.</p>
            </tblfn>
         </tbl>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgement</p>
            </st>
            <p>We thank E. Andreas Scharberg, Baden-Baden, Germany for supplying blood samples and Joann M. Moulds, Philadelphia, for rare DNA samples from the SCARF Exchange program, and Beate Wagner, Bremen, Germany, for helpful discussions. We acknowledge the expert technical assistance of Marianne Lotsch, Sabine Zahn, Anita Hacker, Sabine Kaiser and Katharina Schmid. This study was supported by the DRK-Blutspendedienst Baden-W&#252;rttemberg, Stuttgart, Germany, and the Universit&#228;tsklinikum Ulm (Forschungsf&#246;rderungsprojekt P.531), and the Deutsche Gesellschaft f&#252;r Transfusionsmedizin und Immunh&#228;matologie (Project DGTI/fle/00-01).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Prenatal determination of fetal RhD status by analysis of peripheral blood of rhesus negative mothers</p>
            </title>
            <aug>
               <au>
                  <snm>Lo</snm>
                  <fnm>Y-MD</fnm>
               </au>
               <au>
                  <snm>Bowell</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Selinger</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mackenzie</snm>
                  <fnm>IZ</fnm>
               </au>
               <au>
                  <snm>Chamberlain</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gillmer</snm>
                  <fnm>MDG</fnm>
               </au>
               <au>
                  <snm>Littlewood</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Fleming</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Wainscoat</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1993</pubdate>
            <volume>341</volume>
            <fpage>1147</fpage>
            <lpage>1148</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0140-6736(93)93161-S</pubid>
                  <pubid idtype="pmpid">8097823</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Prenatal determination of fetal RhD type by DNA amplification</p>
            </title>
            <aug>
               <au>
                  <snm>Bennett</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Le Van Kim</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Colin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Warwick</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Cherif-Zahar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Fisk</snm>
                  <fnm>NM</fnm>
               </au>
               <au>
                  <snm>Cartron</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>1993</pubdate>
            <volume>329</volume>
            <fpage>607</fpage>
            <lpage>610</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJM199308263290903</pubid>
                  <pubid idtype="pmpid" link="fulltext">8341334</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>DNA typing of the human MN and Ss blood group antigens in amniotic fluid and following massive transfusion</p>
            </title>
            <aug>
               <au>
                  <snm>Eshleman</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Shakin-Eshleman</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Church</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kant</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Spitalnik</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Am J Clin Pathol</source>
            <pubdate>1995</pubdate>
            <volume>103</volume>
            <fpage>353</fpage>
            <lpage>357</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7872260</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Application of <it>RHD</it> and <it>RHCE</it> genotyping for correct blood group determination in chronically transfused patients</p>
            </title>
            <aug>
               <au>
                  <snm>Legler</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Eber</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Lakomek</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lynen</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Maas</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Pekrun</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Repas-Humpe</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Schroter</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kohler</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1999</pubdate>
            <volume>39</volume>
            <fpage>852</fpage>
            <lpage>855</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1999.39080852.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10504121</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>DNA from blood samples can be used to genotype patients who have recently received a transfusion</p>
            </title>
            <aug>
               <au>
                  <snm>Reid</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Rios</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Powell</snm>
                  <fnm>VI</fnm>
               </au>
               <au>
                  <snm>Charles-Pierre</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Malavade</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>2000</pubdate>
            <volume>40</volume>
            <fpage>48</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.2000.40010048.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10644811</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Differentiation of autologous <it>ABO, RHD, RHCE, KEL, JK,</it> and <it>FY</it> blood group genotypes by analysis of peripheral blood samples of patients who have recently received multiple transfusions</p>
            </title>
            <aug>
               <au>
                  <snm>Rozman</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Dove</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gassner</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>2000</pubdate>
            <volume>40</volume>
            <fpage>936</fpage>
            <lpage>942</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.2000.40080936.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10960520</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p><it>RHD</it> gene deletion occurred in the <it>Rhesus box</it></p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2000</pubdate>
            <volume>95</volume>
            <fpage>3662</fpage>
            <lpage>3668</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10845894</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Gene organization and rearrangements at the human Rhesus blood group locus revealed by fiber-FISH analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Suto</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ishikawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hyodo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Uchikawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Juji</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Hum Genet</source>
            <pubdate>2000</pubdate>
            <volume>106</volume>
            <fpage>164</fpage>
            <lpage>171</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s004390051024</pubid>
                  <pubid idtype="pmpid" link="fulltext">10746557</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>The analysis of nucleotide substitutions, gaps, and recombination events between <it>RHD</it> and <it>RHCE</it> genes through complete sequencing</p>
            </title>
            <aug>
               <au>
                  <snm>Okuda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Suganuma</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kamesaki</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kumada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tsudo</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Omi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Iwamoto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kajii</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2000</pubdate>
            <volume>274</volume>
            <fpage>670</fpage>
            <lpage>683</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.2000.3206</pubid>
                  <pubid idtype="pmpid" link="fulltext">10924335</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by southern analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Colin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Cherif-Zahar</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Le Van Kim</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Raynal</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>van Huffel</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Cartron</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1991</pubdate>
            <volume>78</volume>
            <fpage>2747</fpage>
            <lpage>2752</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1824267</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification</p>
            </title>
            <aug>
               <au>
                  <snm>Aubin</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>Le Van Kim</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Mouro</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Colin</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Bignozzi</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Brossard</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Cartron</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Br J Haematol</source>
            <pubdate>1997</pubdate>
            <volume>98</volume>
            <fpage>356</fpage>
            <lpage>364</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2141.1997.2193040.x</pubid>
                  <pubid idtype="pmpid">9266934</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Identification and analysis of RH genes: application of PCR and RFLP typing tests</p>
            </title>
            <aug>
               <au>
                  <snm>Hyland</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Wolter</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Saul</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Transfus Med Rev</source>
            <pubdate>1995</pubdate>
            <volume>9</volume>
            <fpage>289</fpage>
            <lpage>301</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8541712</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Rh phenotype prediction by DNA typing and its application to practice</p>
            </title>
            <aug>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Gassner</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Transfus Med</source>
            <pubdate>1998</pubdate>
            <volume>8</volume>
            <fpage>281</fpage>
            <lpage>302</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-3148.1998.00173.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9881423</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The presence of an <it>RHD</it> pseudogene containing a 37 base pair duplication and a nonsense mutation in africans with the Rh D- negative blood group phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Singleton</snm>
                  <fnm>BK</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Avent</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Smart</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Daka</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Narter-Olaga</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>LM</snm>
                  <fnm>Hawthorne</fnm>
               </au>
               <au>
                  <snm>G</snm>
                  <fnm>Daniels</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2000</pubdate>
            <volume>95</volume>
            <fpage>12</fpage>
            <lpage>18</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10607679</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Serotype switching in a partially deleted RHD gene</p>
            </title>
            <aug>
               <au>
                  <snm>Blunt</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Daniels</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Carritt</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1994</pubdate>
            <volume>67</volume>
            <fpage>397</fpage>
            <lpage>401</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7701812</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Molecular background of VS and weak C expression in blacks</p>
            </title>
            <aug>
               <au>
                  <snm>Faas</snm>
                  <fnm>BHW</fnm>
               </au>
               <au>
                  <snm>Becker</snm>
                  <fnm>EAM</fnm>
               </au>
               <au>
                  <snm>Wildoer</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ligthart</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Overbeeke</snm>
                  <fnm>MAM</fnm>
               </au>
               <au>
                  <snm>Zondervan</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>von dem Borne</snm>
                  <fnm>AEGK</fnm>
               </au>
               <au>
                  <snm>van der School</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1997</pubdate>
            <volume>37</volume>
            <fpage>38</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1997.37197176949.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9024488</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>The VS and V blood group polymorphisms in Africans: a serologic and molecular analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Daniels</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Faas</snm>
                  <fnm>BH</fnm>
               </au>
               <au>
                  <snm>Green</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Smart</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Maaskant-van Wijk</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Avent</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Zondervan</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>von dem Borne</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>van der School</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1998</pubdate>
            <volume>38</volume>
            <fpage>951</fpage>
            <lpage>958</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1998.381098440860.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9767746</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>The <it>RHD</it> gene is highly detectable in RhD-negative Japanese donors</p>
            </title>
            <aug>
               <au>
                  <snm>Okuda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kawano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwamoto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Seno</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Okubo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kajii</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1997</pubdate>
            <volume>100</volume>
            <fpage>373</fpage>
            <lpage>379</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9218514</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>RHD gene polymorphisms among RhD-Negative Chinese in Taiwan</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chou</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lai</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1998</pubdate>
            <volume>75</volume>
            <fpage>52</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1159/000030958</pubid>
                  <pubid idtype="pmpid" link="fulltext">9745154</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Genetic polymorphism of RhD-negative associated haplotypes in the Chinese</p>
            </title>
            <aug>
               <au>
                  <snm>Lan</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Ding</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pong</snm>
                  <fnm>DB</fnm>
               </au>
               <au>
                  <snm>Zhao</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Hum Genet</source>
            <pubdate>2000</pubdate>
            <volume>45</volume>
            <fpage>224</fpage>
            <lpage>227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s100380050006</pubid>
                  <pubid idtype="pmpid">10944852</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Evidence of genetic diversity underlying Rh D negative, weak D (D") and partial D phenotypes as determined by multiplex PCR analysis of the <it>RHD</it> gene</p>
            </title>
            <aug>
               <au>
                  <snm>Avent</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Martin</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Armstrong-Fisher</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Finning</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Maddocks</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Urbaniak</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1997</pubdate>
            <volume>89</volume>
            <fpage>2568</fpage>
            <lpage>2577</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9116304</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Three unrelated Rh D gene polymorphisms identified among blood donors with Rhesus CCee (r'r') phenotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Hyland</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Wolter</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Saul</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1994</pubdate>
            <volume>84</volume>
            <fpage>321</fpage>
            <lpage>324</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7912557</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>The RhD- trait in a white patient with the RhCCee phenotype attributed to a four-nucleotide deletion in the <it>RHD</it> gene</p>
            </title>
            <aug>
               <au>
                  <snm>Andrews</snm>
                  <fnm>KT</fnm>
               </au>
               <au>
                  <snm>Wolter</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>Saul</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hyland</snm>
                  <fnm>CA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1998</pubdate>
            <volume>92</volume>
            <fpage>1839</fpage>
            <lpage>1840</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9716619</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Alteration of <it>RH</it> gene structure and expression in human dCCee and DCW- red blood cells: phenotypic homozygosity versus genotypic heterozygosity</p>
            </title>
            <aug>
               <au>
                  <snm>Huang</snm>
                  <fnm>CH</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1996</pubdate>
            <volume>88</volume>
            <fpage>2326</fpage>
            <lpage>2333</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8822955</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Involvement of Ser103 of the Rh polypeptides in G epitope formation</p>
            </title>
            <aug>
               <au>
                  <snm>Faas</snm>
                  <fnm>BHW</fnm>
               </au>
               <au>
                  <snm>Beckers</snm>
                  <fnm>EAM</fnm>
               </au>
               <au>
                  <snm>Simsek</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Overbeeke</snm>
                  <fnm>MAM</fnm>
               </au>
               <au>
                  <snm>Pepper</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>van Rhenen</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>von dem Borne</snm>
                  <fnm>AEGK</fnm>
               </au>
               <au>
                  <snm>van der School</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1996</pubdate>
            <volume>36</volume>
            <fpage>506</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1996.36696269508.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">8669081</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Genotyping of RHD by multiplex polymerase chain reaction analysis of six RHD-specific exons</p>
            </title>
            <aug>
               <au>
                  <snm>Maaskant-van Wijk</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Faas</snm>
                  <fnm>BHW</fnm>
               </au>
               <au>
                  <snm>de Ruijter</snm>
                  <fnm>JAM</fnm>
               </au>
               <au>
                  <snm>Overbeeke</snm>
                  <fnm>MAM</fnm>
               </au>
               <au>
                  <snm>von dem Borne</snm>
                  <fnm>AEGK</fnm>
               </au>
               <au>
                  <snm>van Rhenen</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>van der Schoot</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1998</pubdate>
            <volume>38</volume>
            <fpage>1015</fpage>
            <lpage>1021</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1998.38111299056309.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9838930</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>RhesusD/CE typing by polymerase chain reaction using sequence-specific primers</p>
            </title>
            <aug>
               <au>
                  <snm>Gassner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Schmarda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kilga-Nogler</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jenny-Feldkircher</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Rainer</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Schonitzer</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1997</pubdate>
            <volume>37</volume>
            <fpage>1020</fpage>
            <lpage>1026</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1997.371098016439.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9354819</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in South-Western Germany</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Kasuike</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kerowgan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Infusionsther Transfusionsmed</source>
            <pubdate>1995</pubdate>
            <volume>22</volume>
            <fpage>285</fpage>
            <lpage>290</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8924742</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Weak D alleles express distinct phenotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Frohmajer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ladewig</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Eicher</snm>
                  <fnm>NI</fnm>
               </au>
               <au>
                  <snm>Lonicer</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>M&#252;ller</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Siegel</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2000</pubdate>
            <volume>95</volume>
            <fpage>2699</fpage>
            <lpage>2708</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10753853</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>A D variant, D<sub>el</sub>?</p>
            </title>
            <aug>
               <au>
                  <snm>Okubo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nagao</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1984</pubdate>
            <volume>24</volume>
            <fpage>542</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1984.24685066827.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">6438843</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Gassner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>M&#252;ller</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Sch&#246;n&#239;tzer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schunter</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1998</pubdate>
            <volume>91</volume>
            <fpage>2157</fpage>
            <lpage>2168</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9490704</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Molecular basis of weak D phenotypes</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Gassner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>M&#252;ller</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Sch&#246;n&#239;tzer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schunter</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1999</pubdate>
            <volume>93</volume>
            <fpage>385</fpage>
            <lpage>393</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9864185</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Quantitative studies on the Rh-antigen D. Effect of the C gene</p>
            </title>
            <aug>
               <au>
                  <snm>Araszkiewicz</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Szymanski</snm>
                  <fnm>IO</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1987</pubdate>
            <volume>27</volume>
            <fpage>257</fpage>
            <lpage>261</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1987.27387235634.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">2438827</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Prenatal genotyping for the RhD blood group antigen: considerations in developing an accurate test</p>
            </title>
            <aug>
               <au>
                  <snm>Allen</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Ward</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Harris</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Genet Test</source>
            <pubdate>2001</pubdate>
            <volume>4</volume>
            <fpage>377</fpage>
            <lpage>381</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1089/109065700750065126</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Primary anti-D immunization by weak D type 2 RBC</p>
            </title>
            <aug>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Khull</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>2000</pubdate>
            <volume>40</volume>
            <fpage>428</fpage>
            <lpage>434</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.2000.40040428.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">10773054</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>A patient, mosaic for Rh and Fy antigens lacking other signs of chimerism or chromosomal disorder</p>
            </title>
            <aug>
               <au>
                  <snm>Northoff</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Goldmann</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Lattke</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Steinbach</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1984</pubdate>
            <volume>47</volume>
            <fpage>164</fpage>
            <lpage>169</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6431693</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Rh blood group mosaicism in a healthy elderly woman</p>
            </title>
            <aug>
               <au>
                  <snm>Salaru</snm>
                  <fnm>NN</fnm>
               </au>
               <au>
                  <snm>Lay</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Vox Sang</source>
            <pubdate>1985</pubdate>
            <volume>48</volume>
            <fpage>362</fpage>
            <lpage>365</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3925633</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Blood group chimerism in human multiple births is not rare</p>
            </title>
            <aug>
               <au>
                  <snm>van Dijk</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Boomsma</snm>
                  <fnm>DI</fnm>
               </au>
               <au>
                  <snm>de Man</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Am J Med Genet</source>
            <pubdate>1996</pubdate>
            <volume>61</volume>
            <fpage>264</fpage>
            <lpage>268</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-8628(19960122)61:3&lt;264::AID-AJMG11>3.0.CO;2-R</pubid>
                  <pubid idtype="pmpid">8741872</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>A simple salting-out procedure for extracting DNA from human nucleated cells</p>
            </title>
            <aug>
               <au>
                  <snm>Miller</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Dykes</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>Polesky</snm>
                  <fnm>HF</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>1988</pubdate>
            <volume>16</volume>
            <fpage>1215</fpage>
            <lpage>1215</lpage>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Influence of Rh phenotype on the antigen density of C, c, and D: flow cytometric study using a frozen standard red cell</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
            </aug>
            <source>Transfusion</source>
            <pubdate>1994</pubdate>
            <volume>34</volume>
            <fpage>671</fpage>
            <lpage>676</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1537-2995.1994.34894353461.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">8073482</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Analysis by flow cytometry of chimerism after bone-marrow transplantation and of erythrocyte antigen density</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Flegel</snm>
                  <fnm>WA</fnm>
               </au>
            </aug>
            <source>In Aspects of the Flow-Cytometric Analysis of Red Blood Cells (Edited by Gutensohn K, Sonneborn H-H, Kuehnl P) Heidelberg, Clin Lab Publications</source>
            <pubdate>1997</pubdate>
            <fpage>95</fpage>
            <lpage>103</lpage>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Angewandte Statistik</p>
            </title>
            <aug>
               <au>
                  <snm>Sachs</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>7th edition Berlin, springer</source>
            <pubdate>1992</pubdate>
         </bibl>
         <bibl id="B43">
            <title>
               <p>DNA-based Rhesus typing: simultaneous determination of <it>RHC</it> and <it>RHD</it> status using the polymerase chain reaction</p>
            </title>
            <aug>
               <au>
                  <snm>Poulter</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kemp</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Carritt</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Vox Sang.</source>
            <pubdate>1996</pubdate>
            <volume>7</volume>
            <fpage>164</fpage>
            <lpage>168</lpage>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Sequence analysis of cDNA derived from reticulocyte mRNAs coding for Rh polypeptides and demonstration of E/e and C/c polymorphisms</p>
            </title>
            <aug>
               <au>
                  <snm>Simsek</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>de Jong</snm>
                  <fnm>CAM</fnm>
               </au>
               <au>
                  <snm>Cuijpers</snm>
                  <fnm>HTM</fnm>
               </au>
               <au>
                  <snm>Bleeker</snm>
                  <fnm>PMM</fnm>
               </au>
               <au>
                  <snm>Overbeeke</snm>
                  <fnm>MAM</fnm>
               </au>
               <au>
                  <snm>Goldschmeding</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>van der Schoot</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>von dem Borne</snm>
                  <fnm>AEGK</fnm>
               </au>
            </aug>
            <source>Vox Sang.</source>
            <pubdate>1994</pubdate>
            <volume>67</volume>
            <fpage>203</fpage>
            <lpage>209</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7801613</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
