<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-9-250</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Polyploid evolution in <it>Oryza officinalis </it>complex of the genus <it>Oryza</it></p>
         </title>
         <aug>
            <au id="A1">
               <snm>Wang</snm>
               <fnm>Baosheng</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>wangbsh@ibcas.ac.cn</email>
            </au>
            <au id="A2" ce="yes">
               <snm>Ding</snm>
               <fnm>Zhuoya</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>ya_1101@163.com</email>
            </au>
            <au id="A3" ce="yes">
               <snm>Liu</snm>
               <fnm>Wei</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>liuwei@ibcas.ac.cn</email>
            </au>
            <au id="A4" ce="yes">
               <snm>Pan</snm>
               <fnm>Jin</fnm>
               <insr iid="I1"/>
               <email>panjin@ibcas.ac.cn</email>
            </au>
            <au id="A5">
               <snm>Li</snm>
               <fnm>Changbao</fnm>
               <insr iid="I1"/>
               <email>licb@ibcas.ac.cn</email>
            </au>
            <au id="A6">
               <snm>Ge</snm>
               <fnm>Song</fnm>
               <insr iid="I1"/>
               <email>gesong@ibcas.ac.cn</email>
            </au>
            <au ca="yes" id="A7">
               <snm>Zhang</snm>
               <fnm>Daming</fnm>
               <insr iid="I1"/>
               <email>zhangdm@ibcas.ac.cn</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, the Chinese Academy of Sciences, Beijing 100093, PR China</p>
            </ins>
            <ins id="I2">
               <p>Graduate University of the Chinese Academy of Sciences, Beijing 100039, PR China</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2009</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>250</fpage>
         <url>http://www.biomedcentral.com/1471-2148/9/250</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/1471-2148-9-250</pubid>
               <pubid idtype="pmpid">19828030</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>9</day>
               <month>6</month>
               <year>2009</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>14</day>
               <month>10</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>14</day>
               <month>10</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Wang et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Polyploidization is a prominent process in plant evolution, whereas the mechanism and tempo-spatial process remained poorly understood. <it>Oryza officinalis </it>complex, a polyploid complex in the genus <it>Oryza</it>, could exemplify the issues not only for it covering a variety of ploidy levels, but also for the pantropical geographic pattern of its polyploids in Asia, Africa, Australia and Americas, in which a pivotal genome, the C-genome, witnessed all the polyploidization process.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Tracing the C-genome evolutionary history in <it>Oryza officinalis </it>complex, this study revealed the genomic relationships, polyploid forming and diverging times, and diploidization process, based on phylogeny, molecular-clock analyses and fluorescent <it>in situ </it>hybridization using genome-specific probes. Results showed that C-genome split with B-genome at ca. 4.8 Mya, followed by a series of speciation of C-genome diploids (ca. 1.8-0.9 Mya), which then partook in successive polyploidization events, forming CCDD tetraploids in ca. 0.9 Mya, and stepwise forming BBCC tetraploids between ca. 0.3-0.6 Mya. Inter-genomic translocations between B- and C-genomes were identified in BBCC tetraploid, <it>O. punctata</it>. Distinct FISH (fluorescent <it>in situ </it>hybridization) patterns among three CCDD species were visualized by C-genome-specific probes. B-genome was modified before forming the BBCC tetraploid, <it>O. malampuzhaensis</it>.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>C-genome, shared by all polyploid species in the complex, had experienced different evolutionary history particularly after polyploidization, e.g., inter-genomic exchange in BBCC and genomic invasion in CCDD tetraploids. It diverged from B-genome at 4.8 Mya, then participated in the tetraploid formation spanning from 0.9 to 0.3 Mya, and spread into tropics of the disjunct continents by transcontinentally long-distance dispersal, instead of vicariance, as proposed by this study, given that the continental splitting was much earlier than the C-genome species radiation. We also find reliable evidence indicated that an extinct BB diploid species in Asia was presumptively the direct genomic donor of their sympatric tetraploids.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification id="endnote" subtype="user_supplied_xml" type="bmc"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Polyploidization is a prominent process in the evolution of high plants. Between 50% and 70% of angiosperm species were identified as polyploids by intensive screening, while recent studies estimated that up to 100% of angiosperms underwent genome duplication at least once in their evolutionary history <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. The commonity of polyploidy suggests a potential advantage of polyploids to survive better in harsh environments than diploids <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. Thronged facts related to polyploidy were discovered, e.g., genomic divergence in allopolyploids by diploidization, rapid genomic changes, and inter-genomic invasion <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. However, more evidence is needed to reveal the mechanism and tempo-spatial process of polyploidization. Polyploid complex, a group of species with a variety of ploidy levels, could be an ideal model to address the problems. <it>Oryza officinalis </it>complex is an excellent example, not only because it contains diploids and heterochronically formed polyploids, but also it has a "pivotal genome" <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>, the C-genome, which participated in all the polyploid formation, potentially as an inner criterion to trace polyploid evolution. Moreover, geographic patterns of the polyploids distributed pantropically to isolated continents within a rather recent period, have remained mysterious <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>.</p>
         <p>With agricultural importance, the genus <it>Oryza </it>comprises 23 species including cultivated rice, combined into four species complexes <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. In the last decades, molecular methods have been used to reconstruct species phylogeny and to trace evolution process in <it>Oryza </it><abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. Ten distinctive genomes were identified on the basis of DNA sequences <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, or genomic <it>in situ </it>hybridization (GISH) <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Particularly in <it>O. officinalis </it>complex, the largest in <it>Oryza</it>, genomic relationships were found extraordinarily complicated, e.g., the BBCC tetraploid species formed independently with different parenthood by three polyploidization events, in which <it>O. eichingeri </it>was the maternal parent of tetraploid <it>O. punctata </it>while diploid <it>O. punctata </it>was that of tetraploids <it>O. malampuzhaensis </it>and <it>O. minuta </it><abbrgrp><abbr bid="B14">14</abbr><abbr bid="B22">22</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. Furthermore, three tetraploid species with CCDD genomes were assumed to be formed by one polyploidization event, where the CC genome progenitor served as the maternal parent <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. Additionally, it seems much intriguing that the C-genome diploids and tetraploids are distributed across Asian, African and American tropics. And the CCDD tetraploids are entirely endemic to Central and South Americas where no extant diploid with C- or D-genome was found <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Therefore, the questions arose: (a) How was the C-genome, as the pivotal genome in all the tetraploids, differentiated after polyploidizating? (b) When were the tetraploids formed and how did they spread transcontinentally? (c) Whether inter-genomic interaction, e.g., exchange or invasion, happened in the allopolyploids?</p>
         <p>Focused on the questions, we reconstructed the phylogenetic relationship, dated the divergence time among the genomes in <it>O. officinalis </it>complex, and detected genomic changes thereafter polyploidization by FISH methods with genome-specific probes. The goal of this study is to reveal the evolution history of the <it>O. officinalis </it>complex, particularly the polyploidization and its genomic impact, by tracing C-genome differentiating and dispersing process.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Plant materials</p>
            </st>
            <p>Thirty eight accessions representing eleven species of <it>O. officinalis </it>complex were sampled, and one accession of <it>O. granulata</it>, a species outside the complex, was used as outgroup (Table <tblr tid="T1">1</tblr>). Of them, eight species with different ploidy levels and geographic origins were used for cytogenetic analysis. All the accessions used in this study, are showed in Table <tblr tid="T1">1</tblr>, including their species names, genome constitutions, original collection locations and GenBank accession numbers. Total DNAs were extracted from fresh leaves of individual plants by the CTAB method <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Plant materials used and all sequences obtained in this study</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Taxa</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Code<sup>a</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Genome</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Acccession</b>
                        </p>
                        <p><b>No</b>.<sup>b</sup></p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Origin</b>
                        </p>
                     </c>
                     <c cspan="2" ca="left">
                        <p><b>GenBank Accession No</b>.</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Os125</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>
                              <it>SDBE</it>
                           </b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_THA</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>100179</p>
                     </c>
                     <c ca="left">
                        <p>Thailand</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918688">FJ918688</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918761">FJ918761</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_VIE</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>101399</p>
                     </c>
                     <c ca="left">
                        <p>Vietnam</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918689">FJ918689</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918762">FJ918762</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                           <sup>
                              <it>cd</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_BAN</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>102460</p>
                     </c>
                     <c ca="left">
                        <p>Bangladesh</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918690">FJ918690</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918763">FJ918763</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_CHI</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>104618</p>
                     </c>
                     <c ca="left">
                        <p>China</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918691">FJ918691</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918764">FJ918764</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_MAL</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>104672</p>
                     </c>
                     <c ca="left">
                        <p>Malaysia</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918692">FJ918692</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918765">FJ918765</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_IND</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>104708</p>
                     </c>
                     <c ca="left">
                        <p>India</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918693">FJ918693</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918766">FJ918766</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_MYA</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>106390</p>
                     </c>
                     <c ca="left">
                        <p>Myanmar</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918694">FJ918694</ext-link>, <ext-link ext-link-type="gen" ext-link-id="695">695</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918767">FJ918767</ext-link>, <ext-link ext-link-type="gen" ext-link-id="768">768</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>off_PNG</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>106519</p>
                     </c>
                     <c ca="left">
                        <p>Papua New Guinea</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918696">FJ918696</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918769">FJ918769</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>eic_UGA1</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>105159</p>
                     </c>
                     <c ca="left">
                        <p>Uganda</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918702">FJ918702</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918770">FJ918770</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>eic_UGA2</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>105162</p>
                     </c>
                     <c ca="left">
                        <p>Uganda</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918701">FJ918701</ext-link>, <ext-link ext-link-type="gen" ext-link-id="703">703</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918771">FJ918771</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>eic_LAK1</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>105407</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918700">FJ918700</ext-link>, <ext-link ext-link-type="gen" ext-link-id="704">704</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918772">FJ918772</ext-link>, <ext-link ext-link-type="gen" ext-link-id="773">773</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>eic_LAK2</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>104608</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918705">FJ918705</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918774">FJ918774</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                           <sup>
                              <it>d</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>eic_LAK3</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>105415</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918706">FJ918706</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918775">FJ918775</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. rhizomatis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rhi_LAK1</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>105440</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918697">FJ918697</ext-link>, <ext-link ext-link-type="gen" ext-link-id="698">698</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918776">FJ918776</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. rhizomatis</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>rhi _LAK2</p>
                     </c>
                     <c ca="left">
                        <p>CC</p>
                     </c>
                     <c ca="left">
                        <p>103414</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918699">FJ918699</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ91877">FJ91877</ext-link>, <ext-link ext-link-type="gen" ext-link-id="878">878</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>pun _KEN</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>104975</p>
                     </c>
                     <c ca="left">
                        <p>Kenya</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918707">FJ918707</ext-link>, <ext-link ext-link-type="gen" ext-link-id="724">724</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918780">FJ918780</ext-link>, <ext-link ext-link-type="gen" ext-link-id="795">795</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>pun _UGA</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>105160</p>
                     </c>
                     <c ca="left">
                        <p>Uganda</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918708">FJ918708</ext-link>, <ext-link ext-link-type="gen" ext-link-id="722">722</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918781">FJ918781</ext-link>, <ext-link ext-link-type="gen" ext-link-id="794">794</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                           <sup>
                              <it>d</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>pun _IND</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>100125</p>
                     </c>
                     <c ca="left">
                        <p>India</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918709">FJ918709</ext-link>, <ext-link ext-link-type="gen" ext-link-id="723">723</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918779">FJ918779</ext-link>, <ext-link ext-link-type="gen" ext-link-id="796">796</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. malampuzhaensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>mal _IND1</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>80765</p>
                     </c>
                     <c ca="left">
                        <p>India</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918710">FJ918710</ext-link>, <ext-link ext-link-type="gen" ext-link-id="729">729</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918786">FJ918786</ext-link>, <ext-link ext-link-type="gen" ext-link-id="799">799</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. malampuzhaensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>mal _IND2</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>80767</p>
                     </c>
                     <c ca="left">
                        <p>India</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918711">FJ918711</ext-link>, <ext-link ext-link-type="gen" ext-link-id="728">728</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918785">FJ918785</ext-link>, <ext-link ext-link-type="gen" ext-link-id="800">800</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. malampuzhaensis</it>
                           <sup>
                              <it>cd</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>mal _IND3</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>80768</p>
                     </c>
                     <c ca="left">
                        <p>India</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918712">FJ918712</ext-link>, <ext-link ext-link-type="gen" ext-link-id="727">727</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918784">FJ918784</ext-link>, <ext-link ext-link-type="gen" ext-link-id="801">801</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. minuta</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>min _PHI1</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>101141</p>
                     </c>
                     <c ca="left">
                        <p>Philippine</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918713">FJ918713</ext-link>, <ext-link ext-link-type="gen" ext-link-id="725">725</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918782">FJ918782</ext-link>, <ext-link ext-link-type="gen" ext-link-id="798">798</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. minuta</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>min _PHI2</p>
                     </c>
                     <c ca="left">
                        <p>BBCC</p>
                     </c>
                     <c ca="left">
                        <p>104674</p>
                     </c>
                     <c ca="left">
                        <p>Philippine</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918714">FJ918714</ext-link>, <ext-link ext-link-type="gen" ext-link-id="726">726</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918783">FJ918783</ext-link>, <ext-link ext-link-type="gen" ext-link-id="797">797</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. alta</it>
                           <sup>
                              <it>cd</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>alt _SUR</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100967</p>
                     </c>
                     <c ca="left">
                        <p>Suriname</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918715">FJ918715</ext-link>, <ext-link ext-link-type="gen" ext-link-id="731">731</ext-link>, <ext-link ext-link-type="gen" ext-link-id="739">739</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918787">FJ918787</ext-link>, <ext-link ext-link-type="gen" ext-link-id="802">802</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. alta</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>alt _BRA</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100161</p>
                     </c>
                     <c ca="left">
                        <p>Brazil</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918755">FJ918755</ext-link>, <ext-link ext-link-type="gen" ext-link-id="756">756</ext-link>, <ext-link ext-link-type="gen" ext-link-id="757">757</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918812">FJ918812</ext-link>, <ext-link ext-link-type="gen" ext-link-id="817">817</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. alta</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>alt _GUY</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>105143</p>
                     </c>
                     <c ca="left">
                        <p>Guyana</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918752">FJ918752</ext-link>, <ext-link ext-link-type="gen" ext-link-id="753">753</ext-link>, <ext-link ext-link-type="gen" ext-link-id="754">754</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918810">FJ918810</ext-link>, <ext-link ext-link-type="gen" ext-link-id="816">816</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. grandiglumis</it>
                           <sup>
                              <it>cd</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gla _BRA1</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>105669</p>
                     </c>
                     <c ca="left">
                        <p>Brazil</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918716">FJ918716</ext-link>, <ext-link ext-link-type="gen" ext-link-id="730">730</ext-link>, <ext-link ext-link-type="gen" ext-link-id="738">738</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918788">FJ918788</ext-link>, <ext-link ext-link-type="gen" ext-link-id="803">803</ext-link>, <ext-link ext-link-type="gen" ext-link-id="804">804</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. grandiglumis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gla _BRA2</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>101405</p>
                     </c>
                     <c ca="left">
                        <p>Brazil</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918743">FJ918743</ext-link>, <ext-link ext-link-type="gen" ext-link-id="744">744</ext-link>, <ext-link ext-link-type="gen" ext-link-id="745">745</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918815">FJ918815</ext-link>, <ext-link ext-link-type="gen" ext-link-id="820">820</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. grandiglumis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gla _BRA3</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>105664</p>
                     </c>
                     <c ca="left">
                        <p>Brazil</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918758">FJ918758</ext-link>, <ext-link ext-link-type="gen" ext-link-id="759">759</ext-link>, <ext-link ext-link-type="gen" ext-link-id="760">760</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918814">FJ918814</ext-link>, <ext-link ext-link-type="gen" ext-link-id="821">821</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. latifolia</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>lat _CRA</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100167</p>
                     </c>
                     <c ca="left">
                        <p>Costa Rica</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918717">FJ918717</ext-link>, <ext-link ext-link-type="gen" ext-link-id="734">734</ext-link>, <ext-link ext-link-type="gen" ext-link-id="736">736</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918791">FJ918791</ext-link>, <ext-link ext-link-type="gen" ext-link-id="805">805</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. latifolia</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>lat _PAN</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100966</p>
                     </c>
                     <c ca="left">
                        <p>Panama</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918718">FJ918718</ext-link>, <ext-link ext-link-type="gen" ext-link-id="732">732</ext-link>, <ext-link ext-link-type="gen" ext-link-id="735">735</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918789">FJ918789</ext-link>, <ext-link ext-link-type="gen" ext-link-id="806">806</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. latifolia</it>
                           <sup>
                              <it>cd</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>lat _NIG</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>102481</p>
                     </c>
                     <c ca="left">
                        <p>Nigaragua</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918719">FJ918719</ext-link>, <ext-link ext-link-type="gen" ext-link-id="733">733</ext-link>, <ext-link ext-link-type="gen" ext-link-id="737">737</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918790">FJ918790</ext-link>, <ext-link ext-link-type="gen" ext-link-id="807">807</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. latifolia</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>lat _GUA</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100171</p>
                     </c>
                     <c ca="left">
                        <p>Guatemala</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918749">FJ918749</ext-link>, <ext-link ext-link-type="gen" ext-link-id="750">750</ext-link>, <ext-link ext-link-type="gen" ext-link-id="751">751</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918811">FJ918811</ext-link>, <ext-link ext-link-type="gen" ext-link-id="819">819</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. latifolia</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>lat _MEX</p>
                     </c>
                     <c ca="left">
                        <p>CCDD</p>
                     </c>
                     <c ca="left">
                        <p>100914</p>
                     </c>
                     <c ca="left">
                        <p>Mexico</p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918746">FJ918746</ext-link>, <ext-link ext-link-type="gen" ext-link-id="747">747</ext-link>, <ext-link ext-link-type="gen" ext-link-id="748">748</ext-link><sup>e</sup></p>
                     </c>
                     <c ca="left">
                        <p><ext-link ext-link-type="gen" ext-link-id="FJ918813">FJ918813</ext-link>, <ext-link ext-link-type="gen" ext-link-id="818">818</ext-link><sup>e</sup></p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>pun _CAM</p>
                     </c>
                     <c ca="left">
                        <p>BB</p>
                     </c>
                     <c ca="left">
                        <p>105984</p>
                     </c>
                     <c ca="left">
                        <p>Cameroon</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918720">FJ918720</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918792">FJ918792</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                           <sup>
                              <it>d</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>pun _CHA</p>
                     </c>
                     <c ca="left">
                        <p>BB</p>
                     </c>
                     <c ca="left">
                        <p>105607</p>
                     </c>
                     <c ca="left">
                        <p>Chad</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918721">FJ918721</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918793">FJ918793</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. australiensis</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>aus _AUS1</p>
                     </c>
                     <c ca="left">
                        <p>EE</p>
                     </c>
                     <c ca="left">
                        <p>105277</p>
                     </c>
                     <c ca="left">
                        <p>Australia</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918740">FJ918740</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918808">FJ918808</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. australiensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>aus _AUS2</p>
                     </c>
                     <c ca="left">
                        <p>EE</p>
                     </c>
                     <c ca="left">
                        <p>101410</p>
                     </c>
                     <c ca="left">
                        <p>Australia</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918741">FJ918741</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918809">FJ918809</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. granulate</it>
                           <sup>
                              <it>c</it>
                           </sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>gra _LAK</p>
                     </c>
                     <c ca="left">
                        <p>GG</p>
                     </c>
                     <c ca="left">
                        <p>100880</p>
                     </c>
                     <c ca="left">
                        <p>Sri Lanka</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918742">FJ918742</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="FJ918822">FJ918822</ext-link>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a </sup>The first three letters represent species name of an accession, followed by its origin country.</p>
                  <p><sup>b </sup>All accessions were provided by the Genetic Resources Center of the International Rice Research Institute (IRRI), Los Banos, the Philippines.</p>
                  <p><sup>c </sup>Accession selected to represent the species for divergence time analyses.</p>
                  <p><sup>d </sup>Accession selected for fluorescent <it>in situ </it>hybridization.</p>
                  <p><sup>e </sup>Heterozygous locus with more than one allele.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Primer design, PCR amplification and sequencing</p>
            </st>
            <p>Two genes, <it>Starch debranching enzyme </it>(<it>SDBE</it>) on chromosome 4 and <it>Os02 g0125000 </it>(<it>Os125</it>) on chromosome 2 of <it>O. sativa</it>, were chosen in the present study. <it>SDBE </it>is a single copy gene <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>, containing 25 introns, in which the seventh was used in this study. <it>Os125 </it>is also identified as a single copy gene by the criterion previously reported <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>, which had three introns and the second one was selected. Primers used for PCR amplifying and sequencing are listed in Table <tblr tid="T2">2</tblr>.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers used for <it>SDBE </it>and <it>Os125 </it>gene amplifying and sequencing</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence(5'-3')</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Starch Debranching Enzyme</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>SDBE</it>-F</p>
                     </c>
                     <c ca="left">
                        <p>ATTGTCTGCTGCTGGCTTGA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>SDBE</it>-R</p>
                     </c>
                     <c ca="left">
                        <p>CTATTGCCGCTTGTTGCTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>SDBE</it>-Fs2</p>
                     </c>
                     <c ca="left">
                        <p>AAAGGGCAAGCCAACGCAAAT</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>SDBE</it>-Fs3</p>
                     </c>
                     <c ca="left">
                        <p>TGGACAGCCGACAGACTTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Os02 g0125000</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>Os125</it>-F</p>
                     </c>
                     <c ca="left">
                        <p>CCAGAAGAATGGGACAGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>Os125</it>-R</p>
                     </c>
                     <c ca="left">
                        <p>GACAGGGAGTTCCAGAGC</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Amplification and purification of the PCR products were performed by standard methods. Purified PCR products were sequenced directly or after cloning into pGEM-T-easy vectors (Promega, Madison, WI, USA). Sequencing was performed by ABI 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA). All sequences obtained in this study have been deposited to the GenBank database under accession numbers FJ918688-FJ918822 (Table <tblr tid="T1">1</tblr>).</p>
         </sec>
         <sec>
            <st>
               <p>Date analysis</p>
            </st>
            <p>Sequences were aligned with CLUSTAL_X version 1.81 <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. GC content, base frequency, pairwise divergence and the percentage of phylogenetically informative characters were calculated by MEGA4 <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>.</p>
            <p>Phylogenetic tree was built using maximum parsimony (MP) and Bayesian inference (BI) methods. MP analyses were performed using heuristic search with 1000 replicates of random stepwise addition and tree bisection-reconnection (TBR) branch swapping in PAUP version 4.0b10 <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Gaps were treated as missing data. Bootstrap resampling <abbrgrp><abbr bid="B39">39</abbr></abbrgrp> was conducted to assess topological robustness with 1000 replicates. BI analyses were performed in MrBayes version 3.1.2 <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> by Metropolis-coupled Markov Chain Monte Carlo algorithm. Sequences of each gene were divided into three different partitions (exon, intron and insertion), and the combined data have six partitions. GTR+I+G model was applied for the exon of <it>Os125</it>, GTR+G model for the insertion of <it>SDBE</it>, and HKY model for the rest. Four Markov chains were conducted for 1,000,000 generations, trees were sampled every 100 generations, and then the first 2500 trees were discarded in the burn-in period. Optimal models and parameters under the Akaike Information Criterion (AIC) were determined by Modeltest 3.06 <abbrgrp><abbr bid="B41">41</abbr></abbrgrp> for Bayesian analyses. When different alleles from heterozygotes were grouped into one clade, one of them was excluded randomly in phylogeny of the combined data, unless they were otherwise grouped into different clades. Congruence between <it>SDBE </it>and <it>Os125 </it>was evaluated using the partition homogeneity test (PHT) <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>, implemented in PAUP with 1000 replicates, random taxon addition (10 replicates), and one tree saved per replicate. Results from the PHT indicated that incongruence between these two genes was P = 0.01, ten folds higher than the suggested (P &lt; 0.001) by Cunningham <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>.</p>
            <p>Divergence times were estimated by Bayesian dating methods <abbrgrp><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr><abbr bid="B46">46</abbr></abbrgrp>, using the programs <it>Baseml </it><abbrgrp><abbr bid="B47">47</abbr></abbrgrp>, <it>Estbranches </it><abbrgrp><abbr bid="B44">44</abbr></abbrgrp> and <it>Multidivtime </it><abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. Splitting times of <it>O. officinalis </it>complex from its affiliated genus <it>Oryza </it>and tribe Oryzeae were determined through the plastid gene <it>matK </it>of 11 representatives and two outgroups (Table <tblr tid="T3">3</tblr>). A recent report suggested that origin of Oryzeae was about 34.5 &#177; 6.8 Mya <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>, based on newly discovered pollen fossils <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp> and phytoliths <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. These dates were used as the maximum and the minimum constraints to the crown node of Oryzeae, respectively. Other settings were F84+G model <abbrgrp><abbr bid="B52">52</abbr></abbrgrp> and 100,000 MCMC (markov chain monte carlo) iterations, with <it>rttm </it>and <it>rttmsd </it>set at 6.0, <it>rtrate </it>and <it>rtratesd </it>set at 0.02, <it>brownmean </it>and <it>brownsd </it>set at 0.16, and big time set at 100.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Taxa used for divergence-time analyses in Oryzeae</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Taxon</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GenBank</b>
                        </p>
                        <p><b>Accession No</b>.</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Taxon</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GenBank</b>
                        </p>
                        <p><b>Accession No</b>.</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. sativa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF148650">AF148650</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Leersia tisserantii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF489901">AF489901</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. punctata</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF148611">AF148611</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Luziola fluitans</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AY792567">AY792567</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. officinalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF148658">AF148658</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Prosphytochloa prehensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF489916">AF489916</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. eichingeri</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AY318858">AY318858</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Zizania latifolia</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AY092064">AY092064</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. australiensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF148667">AF148667</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>Ehrharta erecta</it>*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AY792568">AY792568</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>O. granulata</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF148674">AF148674</ext-link>
                        </p>
                     </c>
                     <c ca="left">
                        <p><it>Phyllostachys aurea</it>*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AF1643901">AF1643901</ext-link>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Leersia oryzoides</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <ext-link ext-link-type="gen" ext-link-id="AY792566">AY792566</ext-link>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* Outgroups used in the divergence-time analyses in Oryzeae.</p>
               </tblfn>
            </tbl>
            <p>For divergence time estimation within the <it>O. officinalis </it>complex, an MP tree with 19 sequences representing the taxa of the complex (Table <tblr tid="T1">1</tblr>) was applied. Insert sequences were excluded due to their considerably variable lengths. Calculations were performed using the same Bayesian relaxed clock methods stated above. Dating constraints between the complex and its outgroup, and between the first clades split within the complex, were set as 13.6 &#177; 3.6 Mya, and 8.0 &#177; 2.9 Mya respectively, which were determined by the dating of Oryzeae as described above. Other specific parameters were set as follows: <it>rttm </it>and <it>rttmsd </it>set to 1.36, <it>rtrate </it>and <it>rtratesd </it>to 0.04, <it>brownmean </it>and <it>brownsd </it>to 0.7, according to preliminary dating analysis.</p>
         </sec>
         <sec>
            <st>
               <p>Preparation of genome specific sequences</p>
            </st>
            <p>C-genome-specific sequences (against B-genome) were isolated by a modified subtractive hybridization methods <abbrgrp><abbr bid="B53">53</abbr></abbrgrp> as follows: genomic DNAs from <it>O. officinalis </it>(CC, Accession 102460) and <it>O. punctata </it>(BB, Accession 105607) were digested with <it>MseI </it>(New England Biolabs, Beverly, MA, USA) into 500 to 1000 bp fragments; and then the fragments of C-genome were ligated with adapter-C and those of B genome were ligated with biotinylated adapter-B (Table <tblr tid="T4">4</tblr>). Ligation efficiency was checked by PCR amplification using adapter specific primers, C-adp1 and B-adp1. The C-genome ligation was denatured and annealed together with excess B-genome ligation in a single tube. The anneal temperature was 68&#176;C with 0.99 M sodium salt overnight, and then the supernatant containing C-genome-specific sequences was selectively recovered from the reaction mix with streptavidin-coated magnetic beads (Dynabeads, Dynal, Lake Success, NY, USA). A more round of subtracting process was necessary to enrich the genome-specific sequences. Finally, molecules containing the genome-specific sequences were amplified with C-adp1 as primer, and then used for the plasmid transformation.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Adapters and Primers used in C genome specific sequence preparation</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>
                           <b>sequence name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>primer name</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence(5'-3')</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-1</p>
                     </c>
                     <c ca="left">
                        <p>CS1-F</p>
                     </c>
                     <c ca="left">
                        <p>TTTCCCAATCAAGTTCCT</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS1-R</p>
                     </c>
                     <c ca="left">
                        <p>ACGGTGGTAATGGTAGCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-2</p>
                     </c>
                     <c ca="left">
                        <p>CS2-F</p>
                     </c>
                     <c ca="left">
                        <p>AAACAGCAGCGGAAAGAG</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS2-R</p>
                     </c>
                     <c ca="left">
                        <p>GCAAATAGCCATAAGCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-3</p>
                     </c>
                     <c ca="left">
                        <p>CS3-F</p>
                     </c>
                     <c ca="left">
                        <p>CAAACCCAAACCACCCAAGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS3-R</p>
                     </c>
                     <c ca="left">
                        <p>GAACCATACCATCGCCGTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-4</p>
                     </c>
                     <c ca="left">
                        <p>CS4-F</p>
                     </c>
                     <c ca="left">
                        <p>CTGGTGCCTGCTTTAGTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS4-R</p>
                     </c>
                     <c ca="left">
                        <p>CCATACCGTTGCCTCTTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-5</p>
                     </c>
                     <c ca="left">
                        <p>CS5-F</p>
                     </c>
                     <c ca="left">
                        <p>ACGACCAAGCCGACCAAC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS5-R</p>
                     </c>
                     <c ca="left">
                        <p>TGCCTCTTCCACCACTAACT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-6</p>
                     </c>
                     <c ca="left">
                        <p>CS6-F</p>
                     </c>
                     <c ca="left">
                        <p>GCTTTGGGTTGGACTTGAC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS6-R</p>
                     </c>
                     <c ca="left">
                        <p>TGAACTCGGTGAGATTGGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-7</p>
                     </c>
                     <c ca="left">
                        <p>CS7-F</p>
                     </c>
                     <c ca="left">
                        <p>GGCTGACTGAAGGGAGGAGG</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS7-R</p>
                     </c>
                     <c ca="left">
                        <p>TGAGGTTGGACGCTGGACTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CS-8</p>
                     </c>
                     <c ca="left">
                        <p>CS8-F</p>
                     </c>
                     <c ca="left">
                        <p>ATCATTCATTGCTCCATTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CS8-R</p>
                     </c>
                     <c ca="left">
                        <p>AACAGCGTCCTCACCAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>adapter-C</p>
                     </c>
                     <c ca="left">
                        <p>C-adp1</p>
                     </c>
                     <c ca="left">
                        <p>GACCTCGTGTCTGCGTACC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>C-adp2</p>
                     </c>
                     <c ca="left">
                        <p>TAGGTACGCAGACACGAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>adapter-B</p>
                     </c>
                     <c ca="left">
                        <p>B-adp1*</p>
                     </c>
                     <c ca="left">
                        <p>GACGATGAGTCCTGAG</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>B-adp2</p>
                     </c>
                     <c ca="left">
                        <p>TACTCAGGACTCAT</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>* 5' end biotinylated</p>
               </tblfn>
            </tbl>
            <p>The transformed plasmids were sequenced, and the sequences were BLAST searched in GenBank. Then a series of primers (Table <tblr tid="T4">4</tblr>) designed from the sequences were used to test whether the sequences were genome-specific or not by PCR amplification onto the related accessions, no correspond bands were seen in BB diploid species (date not shown). Further, the genome-specific sequences were labelled as probes and finally verified by fluorescent <it>in situ </it>hybridization (FISH). The FISH images showed no signal on the chromosomes and nuclei of BB diploid species (data not showed). All these data confirmed that the sequences were C-genome-specific.</p>
         </sec>
         <sec>
            <st>
               <p>Cytogenetics analysis</p>
            </st>
            <p>Chromosome spreads were prepared by enzymatic maceration/air-dry method <abbrgrp><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. Total genomic, genome-specific and 45S rDNA probes were labelled by nick translation with biotin-16-dUTP (Roche Diagnostics GmbH, Mannheim, Germany) or DIG-11-dUTP (Roche Diagnostics GmbH, Mannheim, Germany), respectively. Multicolor fluorescence <it>in situ </it>hybridization (FISH) was performed as described <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> with slight modification. After overnight hybridization, the slides were given a stringent wash in 20% (v/v) formamide in 0.1&#215; SSC at 42&#176;C, resulting in 80%-85% stringency. The biotinylated-probes were detected by avidin-FITC (Roche Diagnostics GmbH, Mannheim, Germany), and the digoxigenin-labelled probes by anti-digoxigenin rhodamine conjugate (Roche Diagnostics GmbH, Mannheim, Germany). The chromosome spreads were mounted in Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA, USA), and examined under a Leica DMRBE microscope (Leica, Wetzlar, Germany). Photographs were captured by a SPOT cooled color digital camera system (Diagnostic instruments Inc., MI, USA), then imported into Adobe Photoshop 7.0 (Adobe Systems Inc., San Jose, CA, USA) for processing.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Sequence characterization</p>
            </st>
            <p>Two distinct sequences in both <it>SDBE </it>and <it>Os125 </it>genes were identified from each accession of all tetraploids. One was longer (740-2272 bp in <it>SDBE </it>and 871-1021 bp in <it>Os125</it>) and the other was shorter (420-458 bp in <it>SDBE </it>and 400-701 bp in <it>Os125</it>). Each longer sequence was highly similar to and phylogenetically grouped with the corresponding sequences of CC diploids (Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>), and thereby was named as C-like copy. Each shorter one was similar to that of BB or EE diploids, and thus was named as B- or E- like copy accordingly. Aligned sequence of <it>SDBE </it>(2337 bp) had 101 (4.3%) informative sites, and that of the <it>Os125 </it>(1112 bp) contained 164 (14.7%) informative sites. The combined sequence of these two genes was aligned to be 3449 bp in length (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Characteristics of each gene and combined dataset</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Locus</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Aligned length (range)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GC (%)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Mean sequence divergence (range)(%)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Variable sites (%)</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Informative sites (%)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>SDBE</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>2337(420-2272)</p>
                     </c>
                     <c ca="left">
                        <p>34.7</p>
                     </c>
                     <c ca="left">
                        <p>4.2 (0-11.6)</p>
                     </c>
                     <c ca="left">
                        <p>155 (6.6)</p>
                     </c>
                     <c ca="left">
                        <p>101 (4.3)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Os125</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>1112(400-1021)</p>
                     </c>
                     <c ca="left">
                        <p>38.6</p>
                     </c>
                     <c ca="left">
                        <p>7.1 (0-20.6)</p>
                     </c>
                     <c ca="left">
                        <p>256 (23.0)</p>
                     </c>
                     <c ca="left">
                        <p>164 (14.7)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>combined</p>
                     </c>
                     <c ca="left">
                        <p>3449(1112-3290)</p>
                     </c>
                     <c ca="left">
                        <p>36.8</p>
                     </c>
                     <c ca="left">
                        <p>5.6 (0-15.7)</p>
                     </c>
                     <c ca="left">
                        <p>389 (11.3)</p>
                     </c>
                     <c ca="left">
                        <p>249 (7.2)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Sequence divergence was estimated using the Jukes-Cantor distance</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Strict consensus trees of <it>SDBE </it>gene from 72 most parsimonious trees</p>
               </caption>
               <text>
                  <p><b>Strict consensus trees of <it>SDBE </it>gene from 72 most parsimonious trees</b>. Numbers above branches: bootstrap values (only those > 50% showed), below: Posterior probability (only those > 0.5 showed). a or b: alleles of a heterozygous locus. 2&#215; or 4&#215;: ploidy levels. Dash lines indicated the nodes supported by Bayesian inference. Tree length = 184, Consistency index (CI) = 0.8859, Retention index (RI) = 0.9694, Bayesian inference -ln L = -4517.46 (Gray Square: C and C-like copy; White Square: B and B-like copy; Black Square: E and E-like copy).</p>
               </text>
               <graphic file="1471-2148-9-250-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Strict consensus trees of <it>Os125 </it>genes from 500 most parsimonious trees</p>
               </caption>
               <text>
                  <p><b>Strict consensus trees of <it>Os125 </it>genes from 500 most parsimonious trees</b>. Numbers above branches: bootstrap values (only those > 50% showed), below: Posterior probability (only those > 0.5 showed). a or b: alleles of a heterozygous locus. 2&#215; or 4&#215;: ploidy levels. Tree length = 319, Consistency index (CI) = 0.8715, Retention index (RI) = 0.9807, Bayesian inference -ln L = -3585.67 (Gray Square: C and C-like copy; White Square: B and B-like copy; Black Square: E and E-like copy).</p>
               </text>
               <graphic file="1471-2148-9-250-2"/>
            </fig>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Strict consensus trees of combined data set from 126 most parsimonious trees</p>
               </caption>
               <text>
                  <p><b>Strict consensus trees of combined data set from 126 most parsimonious trees</b>. Numbers above branches: bootstrap values (only those > 50% showed), below: Posterior probability (only those > 0.5 showed). a or b: alleles of a heterozygous locus. 2&#215; or 4&#215;: ploidy levels. Tree length = 463, Consistency index (CI) = 0.8985, Retention index (RI) = 0.9771, Bayesian inference -ln L = -7735.44 (Gray Square: C and C-like copy; White Square: B and B-like copy; Black Square: E and E-like copy).</p>
               </text>
               <graphic file="1471-2148-9-250-3"/>
            </fig>
            <p>A ~320 bp insertion in <it>SDBE </it>and a ~150 bp insertion in <it>Os125 </it>were recognized in each of the C-genome-bearing species. BLAST searches in the TIGR rice repeated database <url>http://www.tigr.org/tdb/e2k1/plant.repeats/</url> and then mask against Repbase Update <url>http://www.girinst.org</url> using CENSOR <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>, identified the insertion of <it>SDBE </it>to be MITE-<it>MDM2 </it>(miniature inverted transposable element-<it>MDM2</it>), but no matching sequence of the <it>Os125 </it>insertion was found. The <it>Os125 </it>insertion was flanked by a short direct repeat (sequence: TACATGGCTCTTTC), but no terminal inverted-repeating sequence nor tRNA-related region was found, suggesting that this fragment is an unidentified retrotransposable element instead of a SINE (short interspersed repetitive element) <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>.</p>
            <p>In addition, a partial fragment (~1.5 kb) of L1-type retrotransposon family was found to insert into C-like <it>SDBE </it>gene in some accessions of <it>O. alta </it>and <it>O. grandiglumis</it>.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogeny reconstruction based on <it>SDBE</it>, <it>Os125 </it>and combineddataset</p>
            </st>
            <p>Phylogenetic analyses of <it>SDBE</it>, <it>Os125 </it>and combined dataset using maximum parsimony (MP) and Bayesian inference (BI), all yielded similar topologies. Parsimony analysis yielded 72, 500 and 126 equally most parsimonious trees, from <it>SDBE, Os125 </it>and combined dataset, respectively. The strict consensus trees of each dataset were showed in Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr> and <figr fid="F3">3</figr> with general features as follows: (a) The main clades were strongly supported by bootstrap values and Bayesian posterior probability. (b) B-, C- and E-like copies in tetraploid species formed three monophyletic clades with the corresponding sequences of BB, CC and EE diploid species, respectively. (c) In the C-genome clade, two monophyletic clades were formed, one involving <it>O. eichingeri </it>and the tetraploid <it>O. punctata</it>, and the other covering all the rest C-genome species. (d) The B-like copies of BBCC tetraploid species were divided into two clades, one including the Africa endemic <it>O. punctata </it>(comprising BB diploid and BBCC tetraploid), and the other including the Asian tetraploids only. We also put the <it>SDBE </it>and <it>Os125 </it>sequences of <it>O. sativa </it>(A-genome, GenBank Accession No. <ext-link ext-link-id="AB012915" ext-link-type="gen">AB012915</ext-link> and <ext-link ext-link-id="AP004885" ext-link-type="gen">AP004885</ext-link>) into the datasets, but the positions of B-, C- and E-like copies, and the topology of the inferred cladegram, remained unchanged (data not showed).</p>
            <p>With more informative sites, the cladograms of the complex constructed from <it>Os125 </it>and combined dataset were more resolvable (Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>). <it>O. officinalis </it>(CC) and C-like copies of the BBCC tetraploids, i.e., <it>O. malampuzhaensis </it>and <it>O. minuta</it>, were consistently united into one clade. The clade was further grouped with C-like copies of all CCDD tetraploid species. Apart from the C-like copies of <it>Os125 </it>sequences, two E-like copies were isolated from CCDD species, which formed two clades in parallel and finally grouped with <it>O. australiensis </it>(EE) trichotomously in both MP and BI trees (Figure <figr fid="F2">2</figr>).</p>
            <p>It is noteworthy that two alleles of the heterozygous accessions were grouped with each other, except eic_LAK1 and eic_UGA2, in which one of the alleles was clustered with that of different species (Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>), suggesting that interspecific hybridization and introgression in those accessions occurred, as proposed by previous research <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. For those heterozygous loci, the allele that clustered into the <it>O. eichingeri </it>clade, was selected in the combined dataset.</p>
         </sec>
         <sec>
            <st>
               <p>Divergence Dates</p>
            </st>
            <p>As showed in Figure <figr fid="F4">4</figr>, the <it>O. officinalis </it>complex was estimated to diverge from the rest of the genus <it>Oryza </it>at 7.9 &#177; 1.6 Mya, and the separation between B- and C- genomes took place at 4.8 &#177; 1.3 Mya. The molecular dating indicated that three C-genome diploid species radiated between ca. 0.9-1.8 Mya during Pliocene. In BBCC tetraploid species, C-like copy of <it>O. punctata </it>diverged from C genome of <it>O. eichingeri </it>at 0.3 Mya, very close to the divergent time (0.5 Mya) of the B-like copy from the B genome of diploid <it>O. punctata</it>. In other two BBCC species (<it>O. malampuzhaensis </it>and <it>O. minuta</it>), the C-like copies diverged from their common paternal progenitor (<it>O. officinalis </it>alike) at ca. 0.6 Mya, later than the divergence time of their B-like copies from the B-genome of <it>O. punctata </it>(BB) at ca. 1.8 Mya. Similarly, the divergence time between C-like copies of CCDD tetraploids and their C-genome donor, was set at ca. 0.9 Mya, while the node to separate their D-genomes from <it>O. australiensis </it>(EE) was dated at ca. 2.8 Mya (Figure <figr fid="F4">4</figr>).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Divergence times of main lineages in <it>O. officinalis </it>complex</p>
               </caption>
               <text>
                  <p><b>Divergence times of main lineages in <it>O. officinalis </it>complex</b>. Calculated by Bayesian relaxed-clock methods (details see Materials and Methods). Estimated Mya and the standard deviation were noted above the branches. 2&#215;: diploid; 4&#215;: tetraploid (Gray Square: C and C-like copy; White Square: B and B-like copy; Black Square: E and E-like copy).</p>
               </text>
               <graphic file="1471-2148-9-250-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>FISH analysis</p>
            </st>
            <p>Figure <figr fid="F5">5</figr> shows multicolor fluorescent <it>in situ </it>hybridization images of <it>O. officinalis </it>complex, hybridized by C-genome-specific probes (red), together with B-genome probes (green) or E-genome probes (green), counterstained by DAPI (blue).</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Multicolor fluorescent <it>in situ </it>hybridization images of <it>O. officinalis </it>complex</p>
               </caption>
               <text>
                  <p><b>Multicolor fluorescent <it>in situ </it>hybridization images of <it>O. officinalis </it>complex</b>. Hybridized by C genome-specific probes (red), together with B genome probes (green, e-g, n-s) or E genome probes (green, h-m, t-v), counterstained by DAPI (blue, a-d, k-m). Arrows indicated inter-genomic (B-C genomes) translocations, which were enlarged in the below box (e-g). (a) <it>O. officinalis </it>(CC), and its karyotype (b). (c) <it>O. eichingeri </it>(CC), and its karyotype (d). (e-f) <it>O. punctata </it>(BBCC). (g) <it>O. malampuzhaensis </it>(BBCC). (h, k) <it>O. latifolia </it>(CCDD). (i, l) <it>O. grandiglumis </it>(CCDD). (j, m) <it>O. alta </it>(CCDD). Parental genomes in the nuclei of allotetraploids, separated spatially in <it>O. punctata </it>(n, interphase; o, prophase; p, anaphase), in <it>O. malampuzhaensis </it>(q and r, interphase stages; s, anaphase), and in interphase nuclei of <it>O. latifolia </it>(t), <it>O. grandiglumis </it>(u), and <it>O. alta </it>(v), respectively. Bar, 5 &#956;m.</p>
               </text>
               <graphic file="1471-2148-9-250-5"/>
            </fig>
            <p>Figures <figr fid="F5">5a-d</figr> show that the C-genome-specific probes were localized on all chromosomes of two diploid CC species, <it>O. officinalis </it>and <it>O. eichingeri</it>. The C- genome-specific sequences were scattered non-uniformly along each of the chromosome as well as among twelve homologous pairs, as the FISH patterns showed obviously (Figures <figr fid="F5">5a, c</figr>). The total 24 chromosomes were karyotypically arranged into twelve homologous pairs according to their FISH patterns, relative length, centromere position and heterochromatin, as showed in Figure <figr fid="F5">5b</figr> and Figure <figr fid="F5">5d</figr>.</p>
            <p>Figures <figr fid="F5">5e</figr> and <figr fid="F5">5f</figr> show the FISH images of the tetraploid <it>O. punctata </it>using digoxigenin-labelled C-genome-specific probes and biotin-labelled total genomic DNA of diploid <it>O. punctata </it>(BB). B- and C-genomes were clearly discriminated in the same nucleus, where 24 chromosomes showed strong bright green signals of the B-genome probes, and the rest 24 chromosomes showed strong red signals of the C-genome-specific probes (Figures <figr fid="F5">5e, f</figr>). It is worth to notice that two pairs of B-genome chromosomes were clearly involved in inter-genomic translocations with the C-genome, one small and the other rather large.</p>
            <p>Figure <figr fid="F5">5g</figr> shows that a prometaphase nucleus of <it>O. malampuzhaensis </it>was hybridized with C- genome-specific probes (red) together with B-genome probes (green). The 24 B-genome chromosomes exhibited strong green signals, and the rest 24 chromosomes belonging to C-genome showed bright red signals. Two B-genome signals were identified at short arm terminals of one pair of C-genome chromosomes. However, when <it>O. malampuzhaensis </it>was hybridized with B-genome probes (green) together with 45S rDNA probes (red), these two C-genome chromosomes with 45S rDNA signals were also painted by B-genome signals on same areas (Additional file <supplr sid="S1">1</supplr>). Therefore, in <it>O. malampuzhaensis </it>which was with different origin from tetraploid <it>O. punctata</it>, B-genome signals located on the two C-genome chromosomes may not be inter-genomic translocation but homologous sequences of 45S rDNAs.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Multicolour fluorescent <it>in situ </it>hybridization images of <it>O. malampuzhaensis</it></b>. Prometaphase chromosomes of <it>O. malampuzhaensis </it>were hybridized by 45S rDNA probes (red) together with B-genome probes (green), and counterstained by DAPI (blue). Arrow indicated one pair of C-genome chromosomes which painted by both 45S rDNA and B-genome signals on same areas. (a) and (d) Two pairs of 45S rDNA loci (red). (b) and (e) The B-genome chromosomes showing blue-green signals. (c) and (f) The chromosomes counterstained by DAPI after hybridized with both 45S rDNA and B-genome probes. Bar, 5 &#956;m.</p>
               </text>
               <file name="1471-2148-9-250-S1.TIFF">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>Multicolor FISH was also used for three CCDD species, where two probes were applied, one from <it>O. australiensis </it>(EE) genome (labelled in green), and one from the C-genome-specific probe (labelled in red). Figure <figr fid="F5">5h</figr> shows in <it>O. latifolia</it>, strong C-genome-specific signals (orange) painted 24 chromosomes, while green signals (from the E-genome probes) stained all chromosomes, in which 24 chromosomes with pure green signals should belong to the D-genome. The FISH patterns of <it>O. latifolia </it>differed remarkably from those of <it>O. alta </it>and <it>O. grandiglumis</it>. In <it>O. latifolia </it>all chromosomes were painted by E-genome signals (Figures <figr fid="F5">5h, K</figr>), whereas in <it>O. alta </it>and <it>O. grandiglumis </it>all chromosomes were painted by C-genome signals (red), in which merely some of the chromosomes showed the E-genome signals (green) faintly or strongly near centromere regions (Figures <figr fid="F5">5i-j</figr>; <figr fid="F5">5l-m</figr>). This difference could also be seen in the interphase cells, as showed in Figures <figr fid="F5">5t-v</figr>, where nuclei of <it>O. latifolia </it>were dominantly painted by E-genome probes while those of <it>O. alta </it>and <it>O. grandiglumis </it>were strongly painted by C-genome-specific probes with dot-like signals of E-genome probes.</p>
            <p>Figure <figr fid="F5">5n-s</figr> shows each of the two parental genomes separated spatially in BBCC tetraploid species in interphase, prophase and anaphase nuclei. In <it>O. malampuzhaensis</it>, about 10 chromocenters of B-genome were found at late stage of interphase (Figure <figr fid="F5">5r</figr>); however, no similar chromocenters were found in <it>O. punctata</it>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The key to trace the complicated evolution process of polyploid complex lies on a universal criterion. C-genome in <it>O. officinalis </it>complex could play such a role. As the pivotal genome, C-genome participated each of the polyploid formation in the complex, and its evolution process in genomic differentiation and geographical patterning can therefore reflect the temporal and spatial history of polyploid evolution.</p>
         <sec>
            <st>
               <p>Genomic relationships in <it>O. officinalis </it>complex</p>
            </st>
            <p>In <it>O. officinalis </it>complex, four extant genomes, B, C, D or E, were identified <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B21">21</abbr><abbr bid="B27">27</abbr></abbrgrp>. The present study showed that each genome in the complex occurred only once when rooted by the outgroup, <it>O. granulata</it>, where E-genome sited at the basal position of the complex. The clade of <it>O. officinalis </it>complex was first divided into two clades, E-genome clade and the other clade involving B-and C-genomes. In E-genome clade, D-genome was located as E's sister group. These results were consistent with previous reports <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. In the other clade, C-genomes in different diploid species had differentiated apparently thereafter they partook in different polyploid formation (Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>), in agreement with other authors <abbrgrp><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr></abbrgrp>.</p>
            <p>Although there is only one extant diploid with B-genome, <it>O. punctata</it>, the B-genomes in tetraploids were differentiated, as revealed by AFLP <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, RFLP <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>, SSR <abbrgrp><abbr bid="B60">60</abbr></abbrgrp> and GISH <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. In this study, multicolor FISH (Figure <figr fid="F5">5g</figr>) revealed that the B-genome of <it>O. punctata </it>(BB) was clearly diverged from that of <it>O. malampuzhaensis</it>. Further evidence of molecular phylogeny and dating showed that the divergence happened even before polyploidization, which formed <it>O. malampuzhaensis </it>and <it>O. minuta </it>(Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>, <figr fid="F4">4</figr>). Therefore, a diploid B-genome species extinct nowadays in Asia was assumed to be the direct genomic donor of Asian distributed BBCC tetraploids.</p>
            <p>Since no diploid DD species has ever been found, the D donor for the CCDD tetraploids has long been controversial <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr><abbr bid="B32">32</abbr></abbrgrp>. The Australian diploid, <it>O. australiensis</it>, as the unique E-genome holder, was assumed to be D-genome donor by several authors <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B32">32</abbr></abbrgrp>. Nevertheless, genomic comparison by GISH and retrotransposon analysis found obvious differences between D- and E-genomes, and thus suspected E as the direct donor <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B63">63</abbr></abbrgrp>. Based on a universal criterion of C-genome differentiation, our study in phylogeny and molecular dating (Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>, <figr fid="F4">4</figr>) showed that D- and E-genome were tied together as sister group, but they diverged much earlier than CCDD tetraploid formation. Multicolor FISH using E-genome probes for the CCDD tetraploids also revealed obvious differentiation between D- and E-genome, and this was even remarkable in D-genome itself, as showed in Figure <figr fid="F5">5</figr>, where the D-genomes of <it>O. alta </it>and <it>O. grandiglumis </it>exhibited sharply different from that of <it>O. latifolia</it>.</p>
         </sec>
         <sec>
            <st>
               <p>C-genome variation and polyploid evolution in <it>O. officinalis </it>complex</p>
            </st>
            <p>To date six tetraploid species, three BBCC and three CCDD, have been recorded in <it>O. officinalis </it>complex, and all are C-genome carriers <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B64">64</abbr></abbrgrp>. The relationship and origin of the tetraploids have long been in debate <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B32">32</abbr></abbrgrp>. In this study, C-genome of diploid <it>O. eichingeri </it>was localized at the basal of C-genomes, and it subsequently diverged, resulting two C-genome diploids, <it>O. rhizomatis </it>and <it>O. officinalis</it>. Later on, the three C diploids participated separately in hybridization and polyploidization, finally forming six tetraploids. For <it>O. eichingeri</it>, it merely joined formation of <it>O. punctata </it>(BBCC), while <it>O. officinalis </it>(CC) partook in formation of <it>O. malampuzhaensis </it>and <it>O. minuta</it>. On the other hand, a species closely related to present <it>O. officinalis </it>(or <it>O. rhizomatis</it>) offered its C-genome to the three CCDD tetraploids, <it>O. alta</it>, <it>O. grandiglumis </it>and <it>O. latifolia </it>(Figures <figr fid="F1">1</figr>, <figr fid="F2">2</figr>, <figr fid="F3">3</figr>).</p>
            <p>C-genomes in different BBCC tetraploids confronted variable fates, such as changes by inter-genomic translocation. Multicolor FISH probing different genomes in an allopolyploid can be a powerful indicator for identifying such changes. As showed in multicolor FISH (Figure <figr fid="F5">5e-g</figr>), inter-genomic translocations between C-and B-genomes were visualized for the first time in two tetraploids of the complex, which was speculated as the result of diploidization impact <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B8">8</abbr><abbr bid="B65">65</abbr><abbr bid="B66">66</abbr></abbrgrp>. In <it>O. punctata </it>two fragments of C-chromosomes were translocated to different B-chromosomes, while in <it>O. malampuzhaensis </it>no obvious inter-genomic translocation was found. Although C-genomes experienced different history in various polyploid formations, few fragments of C-genome-specific were detectably lost after hybridization and polyploidization, as found in multicolor FISH with genome-specific probes (Figures <figr fid="F5">5e-g, n-s</figr>).</p>
            <p>The fate of C-genomes in CCDD tetraploids was different even more. In <it>O. alta </it>and <it>O. grandiglumis </it>C-genome-specific probes apparently dominated the nuclei, most probably by inter-genomic invasion <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B8">8</abbr><abbr bid="B67">67</abbr><abbr bid="B68">68</abbr></abbrgrp>, as showed in multicolor FISH images, while in <it>O. latifolia </it>C-genome kept almost unchanged (Figures 5 <figr fid="F5">5h-m, t-v</figr>). Considering that <it>O. alta </it>and <it>O. grandiglumis </it>diverged from <it>O. latifolia </it>(Figure <figr fid="F4">4</figr>), the inter-genomic invasion would have happened during their speciation.</p>
         </sec>
         <sec>
            <st>
               <p>Temporal and spatial evolution of <it>O. officinalis </it>complex</p>
            </st>
            <p>Geographical pattern of intercontinental pantropics in <it>O. officinalis </it>complex, framed by its relatively recent history, makes its evolution process paradoxical for long time. Based on molecular clock of <it>matK </it>and <it>GAP1 </it>sequences, the origin of the complex was dated at late Miocene (ca.9 Mya) <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>, and speciation of <it>O. australiensis </it>was set in ca. 8.5 Mya through <it>Adh2 </it>gene <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>. However, re-dating the origin and divergence times became necessary, because (a) previous dating dealt mainly with diploids while the polyploids evolution history remained unclear; (b) new molecular timescales based on non-parametric rate smoothing, penalized likelihood, and Bayesian-relaxed clock methods have been recently developed for the grasses <abbrgrp><abbr bid="B70">70</abbr></abbrgrp>.</p>
            <p>In this study, the estimated divergence time between <it>O. officinalis </it>complex and its outgroup, <it>O. granulata</it>, was 13.6 &#177; 3.6 Mya, earlier than the previous suggestion, and the time of the first species divergence in the complex, was 7.9 &#177; 1.6 Mya (Figure <figr fid="F4">4</figr>). C-genome was separated with B-genome at about 4.8 Mya, and then C-genome itself was split into two clades in approximately 1.8-0.9 Mya, one including <it>O. eichingeri </it>and the other including the rest two CC diploid species. These times were earlier than previously suggested <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>, but closed to recent research <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. The time of polyploidization to synthesize tetraploids was estimated to be ca. 0.3-0.9 Mya in Pleistocene, in which the CCDD species (ca. 0.7-0.9 Mya) were formed obviously earlier than BBCC species, also closed to that recently reported <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
            <p>If all C-genome species separated no earlier than two Mya, the distribution of these species can be feasibly explained by long-distance dispersal rather than vicariance, given that the continental splitting was much earlier than the species radiation. As suggest by Vaughan et al <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>, animal migration may play a role for this complex in seed dispersal between Asia and Africa. Bird could be another carrier, which could account for the disjunctive distribution of some <it>Oryza </it>species, such as <it>O. eichingeri </it><abbrgrp><abbr bid="B11">11</abbr><abbr bid="B58">58</abbr></abbrgrp>. For the CCDD tetraploids, this and previous studies <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> both revealed that their putative parents were <it>O. officinalis </it>and <it>O. australiensis</it>. The problem was that the putative parents were confined to south Asia-Australia but the CCDD tetraploids were nowadays endemic to the tropics of Americas. Therefore, a new pathway to bridge these two continents for long-distance dispersal was put forward (Figure <figr fid="F6">6</figr>). The strong floristic affinities between the South America and the antipodes were also confirmed by biogeographical studies of other Poaceae species <abbrgrp><abbr bid="B70">70</abbr><abbr bid="B71">71</abbr></abbrgrp>. However, how the species in the complex could transcontinentally spread across the oceans, remains mysterious.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Biogeographical scenario of species with C genome in <it>O. officinalis </it>complex</p>
               </caption>
               <text>
                  <p><b>Biogeographical scenario of species with C genome in <it>O. officinalis </it>complex</b>. Above: divergence time calculated using Bayesian relaxed-clock methods (the cladegram narrowed from Figure 2). Below: Distribution areas (outline and noted) and inferred migration procedure among continents. CC diploids (eic = <it>O. eichingeri</it>, off = <it>O. officinalis</it>, rhi = <it>O. rhizomatis</it>), BBCC tetraploids (pun = <it>O. punctata</it>, mal = <it>O. malampuzhaensis</it>, min = <it>O. minuta</it>), and CCDD tetraploids (lat = <it>O. latifolia</it>, alt = <it>O. alta</it>, gra = <it>O. grandiglumis</it>).</p>
               </text>
               <graphic file="1471-2148-9-250-6"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The genomic relationships, polyploid formations and divergence times in <it>Oryza officinalis </it>complex of the genus <it>Oryza</it>, were revealed based on DNA sequences and FISH evidence. Focused on C-genome, the "pivotal genome" of the polyploids, we found that the polyploids were formed by stepwise polyploidizations in ca. 0.3-0.9 Mya, followed by a series of inter-genomic translocations and invasions. The pantropical distribution of the complex was suggested to be formed by long-distance dispersal transcontinentally, instead of vicariance. This study offers a typical example in tracing tempo-spatial process of polyploidization, and for the first time it gives new stands for the complex in dating the detailed times of polyploid formation, visualizing inter-genomic changes, and viewing the spatial evolution history of the polyploids.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>BW carried out the molecular and cytogenetic studies, wrote the manuscript and participated in the design of the study. ZD, WL and JP made equal contributions in chromosome preparation, data analyses, and phylogenetic inference. CL provided partial DNA sequences for phylogenetic analysis. SG identified all the <it>Oryza </it>materials and modified the manuscript. DZ contributed to the design of the study, supervised the experiment steps, and prepared the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Drs. Yuzhu Dong, Junxia Yuan and Zhukuan Cheng for their technical assistance and helpful suggestions on the manuscript. We are also grateful to the International Rice Research Institute (Los Banos, Philippines) for providing seed samples. This work was supported by the National Natural Science Foundation of China (30430030) and Program for Key International S &amp; T Cooperation project of P. R. China (2009CB119102).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Polyploidy and angiosperm diversification</p>
            </title>
            <aug>
               <au>
                  <snm>Soltis</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Albert</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Leebens-Mack</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bell</snm>
                  <fnm>CD</fnm>
               </au>
               <au>
                  <snm>Paterson</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>CF</fnm>
               </au>
               <au>
                  <snm>Sankoff</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>dePamphilis</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Wall</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>American Journal of Botany</source>
            <pubdate>2009</pubdate>
            <volume>96</volume>
            <issue>1</issue>
            <fpage>336</fpage>
            <lpage>348</lpage>
            <xrefbib>
               <pubid idtype="doi">10.3732/ajb.0800079</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Widespread genome duplications throughout the history of flowering plants</p>
            </title>
            <aug>
               <au>
                  <snm>Cui</snm>
                  <fnm>LY</fnm>
               </au>
               <au>
                  <snm>Wall</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Leebens-Mack</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Lindsay</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Doyle</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Carlson</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Arumuganathan</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Barakat</snm>
                  <fnm>A</fnm>
               </au>
               <etal/>
            </aug>
            <source>Genome Research</source>
            <pubdate>2006</pubdate>
            <volume>16</volume>
            <issue>6</issue>
            <fpage>738</fpage>
            <lpage>749</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gr.4825606</pubid>
                  <pubid idtype="pmcid">1479859</pubid>
                  <pubid idtype="pmpid" link="fulltext">16702410</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The advantages and disadvantages of being polyploid</p>
            </title>
            <aug>
               <au>
                  <snm>Comai</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Nature Reviews Genetics</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>11</issue>
            <fpage>836</fpage>
            <lpage>846</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrg1711</pubid>
                  <pubid idtype="pmpid" link="fulltext">16304599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Polyploidy: Doubling up for evolutionary success</p>
            </title>
            <aug>
               <au>
                  <snm>Hegarty</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hiscock</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Current Biology</source>
            <pubdate>2007</pubdate>
            <volume>17</volume>
            <fpage>R927</fpage>
            <lpage>R929</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cub.2007.08.060</pubid>
                  <pubid idtype="pmpid" link="fulltext">17983572</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Genome evolution in polyploids</p>
            </title>
            <aug>
               <au>
                  <snm>Wendel</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Plant Molecular Biology</source>
            <pubdate>2000</pubdate>
            <volume>42</volume>
            <issue>1</issue>
            <fpage>225</fpage>
            <lpage>249</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1006392424384</pubid>
                  <pubid idtype="pmpid" link="fulltext">10688139</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Polyploidy and genome evolution in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Adams</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Wendel</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Current Opinion in Plant Biology</source>
            <pubdate>2005</pubdate>
            <volume>8</volume>
            <issue>2</issue>
            <fpage>135</fpage>
            <lpage>141</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.pbi.2005.01.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">15752992</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Polyploidy: genome obesity and its consequences</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>ZJ</fnm>
               </au>
               <au>
                  <snm>Ha</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>New Phytologist</source>
            <pubdate>2007</pubdate>
            <volume>174</volume>
            <issue>4</issue>
            <fpage>717</fpage>
            <lpage>720</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-8137.2007.02084.x</pubid>
                  <pubid idtype="pmcid">1950720</pubid>
                  <pubid idtype="pmpid" link="fulltext">17504455</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Evolutionary Genetics of Genome Merger and Doubling in Plants</p>
            </title>
            <aug>
               <au>
                  <snm>Doyle</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Flagel</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Paterson</snm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Rapp</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Wendel</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Annual Review of Genetics</source>
            <pubdate>2008</pubdate>
            <volume>42</volume>
            <fpage>443</fpage>
            <lpage>461</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.genet.42.110807.091524</pubid>
                  <pubid idtype="pmpid" link="fulltext">18983261</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Mechanisms of genomic rearrangements and gene expression changes in plant polyploids</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>ZJ</fnm>
               </au>
               <au>
                  <snm>Ni</snm>
                  <fnm>ZF</fnm>
               </au>
            </aug>
            <source>Bioessays</source>
            <pubdate>2006</pubdate>
            <volume>28</volume>
            <issue>3</issue>
            <fpage>240</fpage>
            <lpage>252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/bies.20374</pubid>
                  <pubid idtype="pmcid">1986666</pubid>
                  <pubid idtype="pmpid" link="fulltext">16479580</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Hybridization between amphidiploids and evolution of polyploids in wheat (<it>Aegilops-Triticum</it>) group</p>
            </title>
            <aug>
               <au>
                  <snm>Zohary</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Feldman</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1962</pubdate>
            <volume>16</volume>
            <issue>1</issue>
            <fpage>44</fpage>
            <lpage>61</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2406265</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Phylogeny and Biogeography of the Genus Oryza</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kaga</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tomooka</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Biotechnology in Agriculture and Forestry</source>
            <editor>Hirano HHA, Sano Y, Sasaki T</editor>
            <pubdate>2008</pubdate>
            <fpage>219</fpage>
            <lpage>234</lpage>
            <xrefbib>
               <pubid idtype="doi">full_text</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>On the phylogeny and biogeography of the genus Oryza</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Kadowaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kaga</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tomooka</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Breeding Science</source>
            <pubdate>2005</pubdate>
            <volume>55</volume>
            <issue>2</issue>
            <fpage>113</fpage>
            <lpage>122</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1270/jsbbs.55.113</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Diversity in the Oryza genus</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Morishima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kadowaki</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Current Opinion in Plant Biology</source>
            <pubdate>2003</pubdate>
            <volume>6</volume>
            <issue>2</issue>
            <fpage>139</fpage>
            <lpage>146</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1369-5266(03)00009-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12667870</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Phylogeny of rice genomes with emphasis on origins of allotetraploid species</p>
            </title>
            <aug>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sang</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>DY</fnm>
               </au>
            </aug>
            <source>Proceedings of the National Academy of Sciences of the United States of America</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <issue>25</issue>
            <fpage>14400</fpage>
            <lpage>14405</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.96.25.14400</pubid>
                  <pubid idtype="pmcid">24448</pubid>
                  <pubid idtype="pmpid" link="fulltext">10588717</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Phylogenetic analysis of Oryza species, based on simple sequence repeats and their flanking nucleotide sequences from the mitochondrial and chloroplast genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Nishikawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Kadowaki</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>2005</pubdate>
            <volume>110</volume>
            <issue>4</issue>
            <fpage>696</fpage>
            <lpage>705</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00122-004-1895-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">15650813</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>The genus Oryza L. Current status of taxonomy</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>IRRI Res Paper Series</source>
            <pubdate>1989</pubdate>
            <volume>138</volume>
            <fpage>1</fpage>
            <lpage>21</lpage>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Taxonomy of the genus Oryza (Poaceae): Historical perspective and current status</p>
            </title>
            <aug>
               <au>
                  <snm>Lu</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Khush</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Kinoshita</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>International Rice Research Notes</source>
            <pubdate>1999</pubdate>
            <volume>24</volume>
            <issue>3</issue>
            <fpage>4</fpage>
            <lpage>8</lpage>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Taxonomic studies of Oryza. III. Key to the species and their enumeration</p>
            </title>
            <aug>
               <au>
                  <snm>Tateoka</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Bot Mag Tokoy</source>
            <pubdate>1963</pubdate>
            <volume>76</volume>
            <fpage>165</fpage>
            <lpage>173</lpage>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Taxonomic studies of Oryza. II. Several species complexes</p>
            </title>
            <aug>
               <au>
                  <snm>Tateoka</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Bot Mag Tokyo</source>
            <pubdate>1962</pubdate>
            <volume>75</volume>
            <fpage>455</fpage>
            <lpage>461</lpage>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Genetic diversity and phylogenetic relationship as revealed by inter simple sequence repeat (ISSR) polymorphism in the genus Oryza</p>
            </title>
            <aug>
               <au>
                  <snm>Joshi</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Gupta</snm>
                  <fnm>VS</fnm>
               </au>
               <au>
                  <snm>Aggarwal</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Ranjekar</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Brar</snm>
                  <fnm>DS</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>2000</pubdate>
            <volume>100</volume>
            <issue>8</issue>
            <fpage>1311</fpage>
            <lpage>1320</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s001220051440</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Phylogenetic relationships among Oryza species revealed by AFLP markers</p>
            </title>
            <aug>
               <au>
                  <snm>Aggarwal</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Brar</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Nandi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Khush</snm>
                  <fnm>GS</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>1999</pubdate>
            <volume>98</volume>
            <issue>8</issue>
            <fpage>1320</fpage>
            <lpage>1328</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s001220051198</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Polymorphism and phylogenetic-relationships among species in the genus <it>Oryza </it>as determined by analysis of nuclear RFLP</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>ZY</fnm>
               </au>
               <au>
                  <snm>Second</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tanksley</snm>
                  <fnm>SD</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>1992</pubdate>
            <volume>83</volume>
            <issue>5</issue>
            <fpage>565</fpage>
            <lpage>581</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00226900</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Analysis of 142 genes resolves the rapid diversification of the rice genus</p>
            </title>
            <aug>
               <au>
                  <snm>Zou</snm>
                  <fnm>XH</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Zang</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Tang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sang</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Genome Biology</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <issue>3</issue>
            <fpage>R49</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/gb-2008-9-3-r49</pubid>
                  <pubid idtype="pmcid">2397501</pubid>
                  <pubid idtype="pmpid" link="fulltext">18315873</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Comparative sequence analysis of MONOCULM1-orthologous regions in 14 Oryza genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Lu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ammiraju</snm>
                  <fnm>JSS</fnm>
               </au>
               <au>
                  <snm>Sanyal</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Sui</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>ZK</fnm>
               </au>
               <etal/>
            </aug>
            <source>Proceedings of the National Academy of Sciences of the United States of America</source>
            <pubdate>2009</pubdate>
            <volume>106</volume>
            <issue>6</issue>
            <fpage>2071</fpage>
            <lpage>2076</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0812798106</pubid>
                  <pubid idtype="pmcid">2629783,2629783</pubid>
                  <pubid idtype="pmpid" link="fulltext">19164767</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Dynamic Evolution of Oryza Genomes Is Revealed by Comparative Genomic Analysis of a Genus-Wide Vertical Data Set</p>
            </title>
            <aug>
               <au>
                  <snm>Ammiraju</snm>
                  <fnm>JSS</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Sanyal</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Jiang</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Pontaroli</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Rambo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Currie</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Collura</snm>
                  <fnm>K</fnm>
               </au>
               <etal/>
            </aug>
            <source>Plant Cell</source>
            <pubdate>2008</pubdate>
            <volume>20</volume>
            <issue>12</issue>
            <fpage>3191</fpage>
            <lpage>3209</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1105/tpc.108.063727</pubid>
                  <pubid idtype="pmcid">2630430</pubid>
                  <pubid idtype="pmpid" link="fulltext">19098269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Transposable element distribution, abundance and role in genome size variation in the genus Oryza</p>
            </title>
            <aug>
               <au>
                  <snm>Zuccolo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sebastian</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Talag</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Collura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kudrna</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Wing</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>BMC Evolutionary Biology</source>
            <pubdate>2007</pubdate>
            <volume>7</volume>
            <fpage>152</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2148-7-152</pubid>
                  <pubid idtype="pmcid">2041954</pubid>
                  <pubid idtype="pmpid" link="fulltext">17727727</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Identification of the rice D-genome chromosomes by genomic in situ hybridisation</p>
            </title>
            <aug>
               <au>
                  <snm>Fukui</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shishido</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kinoshita</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>1997</pubdate>
            <volume>95</volume>
            <issue>8</issue>
            <fpage>1239</fpage>
            <lpage>1245</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s001220050687</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Differentiation and inter-genomic relationships among C, E and D genomes in the Oryza officinalis complex (Poaceae) as revealed by multicolor genomic in situ hybridization</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>DY</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>2001</pubdate>
            <volume>103</volume>
            <issue>2-3</issue>
            <fpage>197</fpage>
            <lpage>203</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s001220100562</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Identification of genome constitution of <it>Oryza malampuzhaensis</it>, <it>O. minuta</it>, and <it>O. punctata </it>by multicolor genomic in situ hybridization</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>DY</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>2001</pubdate>
            <volume>103</volume>
            <issue>2-3</issue>
            <fpage>204</fpage>
            <lpage>211</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s001220100563</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Chloroplast DNA diversity in wild and cultivated species of rice (Genus Oryza, section Oryza). Cladistic-mutation and genetic-distance analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Dally</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Second</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>TAG Theoretical and Applied Genetics</source>
            <pubdate>1990</pubdate>
            <volume>80</volume>
            <issue>2</issue>
            <fpage>209</fpage>
            <lpage>222</lpage>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Comparative studies of the structure of chloroplast DNA from four species of Oryza: cloning and physical maps</p>
            </title>
            <aug>
               <au>
                  <snm>Kanno</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hirai</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>TAG Theoretical and Applied Genetics</source>
            <pubdate>1992</pubdate>
            <volume>83</volume>
            <issue>6</issue>
            <fpage>791</fpage>
            <lpage>798</lpage>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Origin and phylogeny of Oryza species with the CD genome based on multiple-gene sequence data</p>
            </title>
            <aug>
               <au>
                  <snm>Bao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Plant Systematics and Evolution</source>
            <pubdate>2004</pubdate>
            <volume>249</volume>
            <issue>1-2</issue>
            <fpage>55</fpage>
            <lpage>66</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/s00606-004-0173-8</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Restriction fragment length polymorphism analysis of CCDD genome species of the genus Oryza L</p>
            </title>
            <aug>
               <au>
                  <snm>Jena</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Kochert</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Plant Molecular Biology</source>
            <pubdate>1991</pubdate>
            <volume>16</volume>
            <issue>5</issue>
            <fpage>831</fpage>
            <lpage>839</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00015075</pubid>
                  <pubid idtype="pmpid">1677594</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>A rapid DNA isolation procedure for small quantities of fresh leaf tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Doyle</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Doyle</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Phytochemical Bulletin</source>
            <pubdate>1987</pubdate>
            <volume>19</volume>
            <fpage>11</fpage>
            <lpage>15</lpage>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Starch debranching enzyme (R-enzyme or pullulanase) from developing rice endosperm: purification, cDNA and chromosomal localization of the gene</p>
            </title>
            <aug>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Umemoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ogata</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kuboki</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sasaki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Planta</source>
            <pubdate>1996</pubdate>
            <volume>199</volume>
            <issue>2</issue>
            <fpage>209</fpage>
            <lpage>218</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00196561</pubid>
                  <pubid idtype="pmpid">8680309</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Plewniak</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jeanmougin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Research</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>24</issue>
            <fpage>4876</fpage>
            <lpage>4882</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/25.24.4876</pubid>
                  <pubid idtype="pmcid">147148</pubid>
                  <pubid idtype="pmpid" link="fulltext">9396791</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0</p>
            </title>
            <aug>
               <au>
                  <snm>Tamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Dudley</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kumar</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Molecular Biology and Evolution</source>
            <pubdate>2007</pubdate>
            <volume>24</volume>
            <issue>8</issue>
            <fpage>1596</fpage>
            <lpage>1599</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msm092</pubid>
                  <pubid idtype="pmpid" link="fulltext">17488738</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>PAUP*. Phylogenetic analysis using parsimony (* and other methods), Version 4.0b10</p>
            </title>
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <publisher>Sunderland, MA: Sinauer and Associates</publisher>
            <pubdate>2002</pubdate>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12504223</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Confidence limits on phylogeny: an approach using the bootstrap</p>
            </title>
            <aug>
               <au>
                  <snm>Felsenstein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1985</pubdate>
            <volume>39</volume>
            <fpage>783</fpage>
            <lpage>791</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2408678</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>MrBayes 3: Bayesian phylogenetic inference under mixed models</p>
            </title>
            <aug>
               <au>
                  <snm>Ronquist</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Huelsenbeck</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <issue>12</issue>
            <fpage>1572</fpage>
            <lpage>1574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg180</pubid>
                  <pubid idtype="pmpid" link="fulltext">12912839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>MODELTEST: testing the model of DNA substitution</p>
            </title>
            <aug>
               <au>
                  <snm>Posada</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Crandall</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <issue>9</issue>
            <fpage>817</fpage>
            <lpage>818</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/14.9.817</pubid>
                  <pubid idtype="pmpid" link="fulltext">9918953</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Testing significance of incongruence</p>
            </title>
            <aug>
               <au>
                  <snm>Farris</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Kallersjo</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kluge</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Bult</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Cladistics-the International Journal of the Willi Hennig Society</source>
            <pubdate>1994</pubdate>
            <volume>10</volume>
            <issue>3</issue>
            <fpage>315</fpage>
            <lpage>319</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1096-0031.1994.tb00181.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Can three incongruence tests predict when data should be combined?</p>
            </title>
            <aug>
               <au>
                  <snm>Cunningham</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>Molecular Biology and Evolution</source>
            <pubdate>1997</pubdate>
            <volume>14</volume>
            <issue>7</issue>
            <fpage>733</fpage>
            <lpage>740</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9214746</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Estimating the rate of evolution of the rate of molecular evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Thorne</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Painter</snm>
                  <fnm>IS</fnm>
               </au>
            </aug>
            <source>Molecular Biology and Evolution</source>
            <pubdate>1998</pubdate>
            <volume>15</volume>
            <issue>12</issue>
            <fpage>1647</fpage>
            <lpage>1657</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9866200</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Divergence time and evolutionary rate estimation with multilocus data</p>
            </title>
            <aug>
               <au>
                  <snm>Thorne</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Systematic Biology</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <issue>5</issue>
            <fpage>689</fpage>
            <lpage>702</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/10635150290102456</pubid>
                  <pubid idtype="pmpid" link="fulltext">12396584</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Performance of a divergence time estimation method under a probabilistic model of rate evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Thorne</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Bruno</snm>
                  <fnm>WJ</fnm>
               </au>
            </aug>
            <source>Molecular Biology and Evolution</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <issue>3</issue>
            <fpage>352</fpage>
            <lpage>361</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11230536</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>PAML: a program package for phylogenetic analysis by maximum likelihood</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>ZH</fnm>
               </au>
            </aug>
            <source>Computer Applications in the Biosciences</source>
            <pubdate>1997</pubdate>
            <volume>13</volume>
            <issue>5</issue>
            <fpage>555</fpage>
            <lpage>556</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9367129</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>The age of the grasses and clusters of origins of C-4 photosynthesis</p>
            </title>
            <aug>
               <au>
                  <snm>Vicentini</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Barber</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Aliscioni</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Giussani</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Kellogg</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Global Change Biology</source>
            <pubdate>2008</pubdate>
            <volume>14</volume>
            <issue>12</issue>
            <fpage>2963</fpage>
            <lpage>2977</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1365-2486.2008.01688.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>The origin of grassdominated ecosystems</p>
            </title>
            <aug>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>Kingston</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>LL</fnm>
               </au>
            </aug>
            <source>Annals of the Missouri Botanical Garden</source>
            <pubdate>1999</pubdate>
            <volume>86</volume>
            <fpage>590</fpage>
            <lpage>643</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2666186</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Evolutionary history of the grasses</p>
            </title>
            <aug>
               <au>
                  <snm>Kellogg</snm>
                  <fnm>EA</fnm>
               </au>
            </aug>
            <source>Plant Physiology</source>
            <pubdate>2001</pubdate>
            <volume>125</volume>
            <fpage>1198</fpage>
            <lpage>1205</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1104/pp.125.3.1198</pubid>
                  <pubid idtype="pmcid">1539375</pubid>
                  <pubid idtype="pmpid" link="fulltext">11244101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Dinosaur coprolites and the early evolution of grasses and grazers</p>
            </title>
            <aug>
               <au>
                  <snm>Prasad</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Stromberg</snm>
                  <fnm>CAE</fnm>
               </au>
               <au>
                  <snm>Alimohammadian</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sahni</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>310</volume>
            <issue>5751</issue>
            <fpage>1177</fpage>
            <lpage>1180</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1118806</pubid>
                  <pubid idtype="pmpid" link="fulltext">16293759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Evaluation of the maximum-likelihood estimate of the evolutionary tree topologies from DNA-sequence date, and the branching order in hominoidea</p>
            </title>
            <aug>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Journal of Molecular Evolution</source>
            <pubdate>1989</pubdate>
            <volume>29</volume>
            <issue>2</issue>
            <fpage>170</fpage>
            <lpage>179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02100115</pubid>
                  <pubid idtype="pmpid">2509717</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: Cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate</p>
            </title>
            <aug>
               <au>
                  <snm>Gurskaya</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Diatchenko</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Chenchik</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Siebert</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Khaspekov</snm>
                  <fnm>GL</fnm>
               </au>
               <au>
                  <snm>Lukyanov</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Vagner</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Ermolaeva</snm>
                  <fnm>OD</fnm>
               </au>
               <au>
                  <snm>Lukyanov</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Sverdlov</snm>
                  <fnm>ED</fnm>
               </au>
            </aug>
            <source>Analytical Biochemistry</source>
            <pubdate>1996</pubdate>
            <volume>240</volume>
            <issue>1</issue>
            <fpage>90</fpage>
            <lpage>97</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/abio.1996.0334</pubid>
                  <pubid idtype="pmpid" link="fulltext">8811883</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Somatic chromosome map of rice by imaging methods</p>
            </title>
            <aug>
               <au>
                  <snm>Fukui</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Iijima</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>1991</pubdate>
            <volume>81</volume>
            <issue>5</issue>
            <fpage>589</fpage>
            <lpage>596</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00226723</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Variability in rDNA loci in the genus <it>Oryza </it>detected through fluorescence <it>in-situ </it>hybridization</p>
            </title>
            <aug>
               <au>
                  <snm>Fukui</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ohmido</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Khush</snm>
                  <fnm>GS</fnm>
               </au>
            </aug>
            <source>Theoretical and Applied Genetics</source>
            <pubdate>1994</pubdate>
            <volume>87</volume>
            <issue>8</issue>
            <fpage>893</fpage>
            <lpage>899</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF00225782</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor</p>
            </title>
            <aug>
               <au>
                  <snm>Kohany</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Gentles</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Hankus</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Jurka</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Bmc Bioinformatics</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2105-7-474</pubid>
                  <pubid idtype="pmcid">1634758</pubid>
                  <pubid idtype="pmpid" link="fulltext">17064419</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Retroposon Mapping in Molecular Systematics</p>
            </title>
            <aug>
               <au>
                  <snm>Okada</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Shedlock</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Nikaido</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mobile genetic elements: protocols and genomic applications</source>
            <publisher>Totowa (NJ): Humana Press</publisher>
            <editor>Capy WJMaP</editor>
            <pubdate>2004</pubdate>
            <fpage>189</fpage>
            <lpage>226</lpage>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Multilocus analysis of nucleotide variation and speciation in Oryza officinalis and its close relatives</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Molecular Biology and Evolution</source>
            <pubdate>2007</pubdate>
            <volume>24</volume>
            <issue>3</issue>
            <fpage>769</fpage>
            <lpage>783</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msl204</pubid>
                  <pubid idtype="pmpid" link="fulltext">17182895</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Phylogenetic relationships among diploid species of Oryza officinalis complex revealed by multiple gene sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Bao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Acta Phytotaxonomica Sinica</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <issue>6</issue>
            <fpage>497</fpage>
            <lpage>508</lpage>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Genetic diversity and evolutionary relationships of Oryza species with the B- and C-genomes as revealed by SSR markers</p>
            </title>
            <aug>
               <au>
                  <snm>Bao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>HF</fnm>
               </au>
               <au>
                  <snm>Hong</snm>
                  <fnm>DY</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Journal of Plant Biology</source>
            <pubdate>2006</pubdate>
            <volume>49</volume>
            <issue>5</issue>
            <fpage>339</fpage>
            <lpage>347</lpage>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Diversity of centromeric repeats in two closely related wild rice species, Oryza officinalis and Oryza rhizomatis</p>
            </title>
            <aug>
               <au>
                  <snm>Bao</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>WL</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>QY</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Gu</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>YB</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>ZK</fnm>
               </au>
            </aug>
            <source>Molecular Genetics and Genomics</source>
            <pubdate>2006</pubdate>
            <volume>275</volume>
            <issue>5</issue>
            <fpage>421</fpage>
            <lpage>430</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00438-006-0103-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">16463049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Analysis of genetic diversity in the Oryza officinalis complex</p>
            </title>
            <aug>
               <au>
                  <snm>Federici</snm>
                  <fnm>MT</fnm>
               </au>
               <au>
                  <snm>Shcherban</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Capdevielle</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Francis</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Electronic Journal of Biotechnology</source>
            <pubdate>2002</pubdate>
            <volume>5</volume>
            <issue>2</issue>
            <fpage>173</fpage>
            <lpage>181</lpage>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Doubling genome size without polyploidization: Dynamics of retrotransposition-driven genomic expansions in Oryza australiensis, a wild relative of rice</p>
            </title>
            <aug>
               <au>
                  <snm>Piegu</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Guyot</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Picault</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Roulin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Saniyal</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Collura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Brar</snm>
                  <fnm>DS</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wing</snm>
                  <fnm>RA</fnm>
               </au>
               <etal/>
            </aug>
            <source>Genome Research</source>
            <pubdate>2006</pubdate>
            <volume>16</volume>
            <issue>10</issue>
            <fpage>1262</fpage>
            <lpage>1269</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gr.5290206</pubid>
                  <pubid idtype="pmcid">1581435</pubid>
                  <pubid idtype="pmpid" link="fulltext">16963705</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>The wild relatives of rice: a genetic resources handbook</p>
            </title>
            <aug>
               <au>
                  <snm>Vaughan</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <publisher>Manila, The Philippines: International Rice Research Institution</publisher>
            <pubdate>1994</pubdate>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Sequence of events leading to near-complete genome turnover in allopolyploid Nicotiana within five million years</p>
            </title>
            <aug>
               <au>
                  <snm>Lim</snm>
                  <fnm>KY</fnm>
               </au>
               <au>
                  <snm>Kovarik</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Matyasek</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Chase</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Clarkson</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Grandbastien</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Leitch</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>New Phytologist</source>
            <pubdate>2007</pubdate>
            <volume>175</volume>
            <issue>4</issue>
            <fpage>756</fpage>
            <lpage>763</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-8137.2007.02121.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17688590</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Chromosomal stasis in diploids contrasts with genome restructuring in auto- and allopolyploid taxa of Hepatica (Ranunculaceae)</p>
            </title>
            <aug>
               <au>
                  <snm>Weiss-Schneeweiss</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Schneeweiss</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Stuessy</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Mabuchi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Jang</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>BY</fnm>
               </au>
            </aug>
            <source>New Phytologist</source>
            <pubdate>2007</pubdate>
            <volume>174</volume>
            <issue>3</issue>
            <fpage>669</fpage>
            <lpage>682</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-8137.2007.02019.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">17447921</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Coevolution of A and B genomes in allotetraploid Triticum dicoccoides</p>
            </title>
            <aug>
               <au>
                  <snm>Belyayev</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Raskina</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Korol</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nevo</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Genome</source>
            <pubdate>2000</pubdate>
            <volume>43</volume>
            <issue>6</issue>
            <fpage>1021</fpage>
            <lpage>1026</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1139/gen-43-6-1021</pubid>
                  <pubid idtype="pmpid" link="fulltext">11195333</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Long-term genome diploidization in allopolyploid Nicotiana section Repandae (Solanaceae)</p>
            </title>
            <aug>
               <au>
                  <snm>Clarkson</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>KY</fnm>
               </au>
               <au>
                  <snm>Kovarik</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Chase</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Knapp</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Leitch</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>New Phytologist</source>
            <pubdate>2005</pubdate>
            <volume>168</volume>
            <issue>1</issue>
            <fpage>241</fpage>
            <lpage>252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1469-8137.2005.01480.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16159337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>Molecular phylogeny of Oryzeae (Poaceae) based on DNA sequences from chloroplast, mitochondrial, and nuclear genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Guo</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>American Journal of Botany</source>
            <pubdate>2005</pubdate>
            <volume>92</volume>
            <issue>9</issue>
            <fpage>1548</fpage>
            <lpage>1558</lpage>
            <xrefbib>
               <pubid idtype="doi">10.3732/ajb.92.9.1548</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Dated historical biogeography of the temperate Loliinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres</p>
            </title>
            <aug>
               <au>
                  <snm>Inda</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Segarra-Moragues</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Peterson</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Catalan</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Molecular Phylogenetics and Evolution</source>
            <pubdate>2008</pubdate>
            <volume>46</volume>
            <issue>3</issue>
            <fpage>932</fpage>
            <lpage>957</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2007.11.022</pubid>
                  <pubid idtype="pmpid" link="fulltext">18226932</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>Phylogenetic structure in Poaceae subfamily Pooideae as inferred from molecular and morphological characters: Misclassification versus reticulation</p>
            </title>
            <aug>
               <au>
                  <snm>Soreng</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Davis</snm>
                  <fnm>JI</fnm>
               </au>
            </aug>
            <source>Grasses: Systematics and Evolution</source>
            <publisher>CSIRO, Collingwood</publisher>
            <editor>Jacobs SWL, Everett J</editor>
            <pubdate>2000</pubdate>
            <fpage>61</fpage>
            <lpage>74</lpage>
         </bibl>
      </refgrp>
   </bm>
</art>
