<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-9-198</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Gain and loss of an intron in a protein-coding gene in Archaea: the case of an archaeal RNA pseudouridine synthase gene</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Yokobori</snm>
               <fnm>Shin-ichi</fnm>
               <insr iid="I1"/>
               <email>yokobori@ls.toyaku.ac.jp</email>
            </au>
            <au id="A2">
               <snm>Itoh</snm>
               <fnm>Takashi</fnm>
               <insr iid="I2"/>
               <email>ito@jcm.riken.jp</email>
            </au>
            <au id="A3">
               <snm>Yoshinari</snm>
               <fnm>Shigeo</fnm>
               <insr iid="I3"/>
               <email>yoshinas@mac.com</email>
            </au>
            <au id="A4">
               <snm>Nomura</snm>
               <fnm>Norimichi</fnm>
               <insr iid="I4"/>
               <email>nom@kyoto.email.ne.jp</email>
            </au>
            <au id="A5">
               <snm>Sako</snm>
               <fnm>Yoshihiko</fnm>
               <insr iid="I4"/>
               <email>sako@kais.kyoto-u.ac.jp</email>
            </au>
            <au id="A6">
               <snm>Yamagishi</snm>
               <fnm>Akihiko</fnm>
               <insr iid="I1"/>
               <email>yamagish@ls.toyaku.ac.jp</email>
            </au>
            <au id="A7">
               <snm>Oshima</snm>
               <fnm>Tairo</fnm>
               <insr iid="I5"/>
               <email>tario.oshima@kyowa-kako.co.jp</email>
            </au>
            <au id="A8">
               <snm>Kita</snm>
               <fnm>Kiyoshi</fnm>
               <insr iid="I3"/>
               <email>kitak@m.u-tokyo.ac.jp</email>
            </au>
            <au ca="yes" id="A9">
               <snm>Watanabe</snm>
               <fnm>Yoh-ichi</fnm>
               <insr iid="I3"/>
               <email>ywatanab@m.u-tokyo.ac.jp</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Molecular Biology, School of Life Science, Tokyo University of Pharmacy and Life Science, Horinouchi, Hachioji, Tokyo 192-0392, Japan</p>
            </ins>
            <ins id="I2">
               <p>Japan Collection of Microorganisms, RIKEN (The Institute of Physical and Chemical Research) BioResource Center, Wako, Saitama 351-0198, Japan</p>
            </ins>
            <ins id="I3">
               <p>Department of Biomedical Chemistry, Graduate School of Medicine, University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan</p>
            </ins>
            <ins id="I4">
               <p>Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kyoto, Kyoto 606-8502, Japan</p>
            </ins>
            <ins id="I5">
               <p>Institute of Environmental Microbiology, Kyowa Kako, Tadao, Machida, Tokyo 194-0035, Japan</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2009</pubdate>
         <volume>9</volume>
         <issue>1</issue>
         <fpage>198</fpage>
         <url>http://www.biomedcentral.com/1471-2148/9/198</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19671140</pubid>
               <pubid idtype="doi">10.1186/1471-2148-9-198</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>21</day>
               <month>4</month>
               <year>2009</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>11</day>
               <month>8</month>
               <year>2009</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>11</day>
               <month>8</month>
               <year>2009</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2009</year>
         <collab>Yokobori et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>We previously found the first examples of splicing of archaeal pre-mRNAs for homologs of the eukaryotic CBF5 protein (also known as dyskerin in humans) in <it>Aeropyrum pernix, Sulfolobus solfataricus, S. tokodaii</it>, and <it>S. acidocaldarirus</it>, and also showed that crenarchaeal species in orders Desulfurococcales and Sulfolobales, except for <it>Hyperthermus butylicus, Pyrodictium occultum, Pyrolobus fumarii</it>, and <it>Ignicoccus islandicus</it>, contain the (putative) <it>cbf5 </it>intron. However, the exact timing of the intron insertion was not determined and verification of the putative secondary loss of the intron in some lineages was not performed.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>In the present study, we determined approximately two-thirds of the entire coding region of crenarchaeal Cbf5 sequences from 43 species. A phylogenetic analysis of our data and information from the available genome sequences suggested that the (putative) <it>cbf5 </it>intron existed in the common ancestor of the orders Desulfurococcales and Sulfolobales and that probably at least two independent lineages in the order Desulfurococcales lost the (putative) intron.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>This finding is the first observation of a lineage-specific loss of a pre-mRNA intron in Archaea. As the insertion or deletion of introns in protein-coding genes in Archaea has not yet been seriously considered, our finding suggests the possible difficulty of accurately and completely predicting protein-coding genes in Archaea.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Introns in protein-coding genes and pre-mRNA splicing are ubiquitous in Eukarya and, to a lesser extent, in Bacteria. Until 2001, pre-mRNA splicing had not been reported in Archaea. In 2002, we reported the first examples of archaeal pre-mRNA splicing for homologs of the eukaryotic CBF5 (centromere binding factor 5 in yeast, or dyskerin in humans) protein in <it>Aeropyrum pernix, Sulfolobus solfataricus</it>, and <it>S. tokodaii </it>[<abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, also in <it>S. acidocaldarius</it>, see <abbrgrp><abbr bid="B2">2</abbr></abbrgrp> in 2006]. We found that the cleavage of the pre-mRNA depends on the recognition of a bulge-helix-bulge (BHB)-like structure in the precursor <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp> by the splicing endonuclease EndA <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. In Archaea, pre-tRNA and pre-rRNA splicings also depend on the same system [<abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>; reviewed in <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>]. Although most species from the orders Desulfurococcales and Sulfolobales have the (putative) <it>cbf5 </it>intron, <it>H. butylicus, P. occultum, P. fumarii</it>, and <it>I. islandicus </it>in the order Desulfurococcales do not contain the intron <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. This observation suggested putative secondary loss of the intron. However, phylogenetic analysis of the Cbf5 protein sequences did not resolve the relationships between species from different orders of Crenarchaeota, likely due to the short sequence (about 70 amino acid residues) studied in the analysis <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>In the present study, we determined a formerly undetermined region of <it>cbf5 </it>sequences from the previously characterized 27 species and new sequences from an additional 16 species. We studied 43 species, which were almost all the available species from type culture collections. We determined up to two-thirds of the coding region, corresponding to about 220 amino acid residues, and then examined the timing of the gain and the possible loss of the intron in the archaeal protein-coding gene. We found that the intron existed in the <it>cbf5 </it>gene in the common ancestor of the orders Desulfurococcales and Sulfolobales, and then the intron was lost in some lineages in the order Desulfurococcales.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Strains and DNA for PCR screening</p>
            </st>
            <p>Most crenarchaeal strains were grown according to the conditions suggested by the Japan Collection of Microorganisms (JCM) <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Some strains were purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ). In most PCR reactions, the crude DNA was prepared as described previously <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In the case of <it>Thermofilum pendens</it>, the obtained DNA was too dilute; thus, for PCR with degenerate primers at the initial screening, the DNA was pre-amplified by using the illustra GenomiPhi DNA Amplification Kit (GE Healthcare Bioscience, Shinjuku, Tokyo, Japan). The DNA of '<it>Caldococcus noboribetus' </it>was kindly provided by Dr. M. Aoshima (University of Tokyo). The DNA from <it>Aeropyrum pernix </it>strains was prepared as previously described <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. See [Additional file <supplr sid="S1">1</supplr>], Table <tblr tid="T1">1</tblr> and <tblr tid="T2">2</tblr> (for <it>Aeropyrum pernix </it>strains) for further information about the strains.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p><b>Strains and size of cbf5 intron</b>. Details of the strains studied, including strain numbers, accession numbers, are shown.</p>
               </text>
               <file name="1471-2148-9-198-S1.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Strains and size of cbf5 intron.</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="left">
                        <p>order*</p>
                     </c>
                     <c ca="left">
                        <p>family**</p>
                     </c>
                     <c ca="left">
                        <p>species***</p>
                     </c>
                     <c ca="left">
                        <p>references****</p>
                     </c>
                     <c ca="left">
                        <p>intron (bp)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Acidilobus aceticus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aeropyrum camini</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Aeropyrum pernix</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B1">1</abbr>
                              <abbr bid="B2">2</abbr>
                              <abbr bid="B52">52</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>38</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Caldisphaera lagunensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Desulfurococcus amylolyticus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>21</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Desulfurococcus mobilis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Desulfurococcus mucosus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Ignicoccus hospitalis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B31">31</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Ignicoccus islandicus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Ignicoccus pacificus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Ignisphaera aggregans</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>39</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Staphylothermus hellenicus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>36</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Staphylothermus marinus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>36</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Stetteria hydrogenophila</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>33</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfophobococcus zilligii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermodiscus maritimus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermosphaera aggregans</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>P</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Hyperthermus butylicus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>P</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrodictium abyssi</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>P</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrodictium brockii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>P</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrodictium occultum</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>P</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrolobus fumarii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>D</p>
                     </c>
                     <c ca="left">
                        <p>u</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>'Caldococcus noboribetus'</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>29</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Acidianus ambivalens</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Acidianus brierleyi</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Acidianus infernus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Metallosphaera hakonensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Metallosphaera sedula</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Stygiolobus azoricus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus acidocaldarius</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B2">2</abbr>
                              <abbr bid="B48">48</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus acidocaldarius</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus metallicus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus shibatae</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus solfataricus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B1">1</abbr>
                              <abbr bid="B53">53</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfolobus tokodaii</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B1">1</abbr>
                              <abbr bid="B54">54</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>S</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Sulfurisphaera ohwakuensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tf</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>'Thermofilum librum'</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tf</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermofilum pendens</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Caldivirga maquilingensis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum aerophilum</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B55">55</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum arsenaticum</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum islandicum</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum oguniense</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum organotrophum</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Pyrobaculum calidifontis</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>unpublished</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermocladium modestius</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermoproteus neutrophilus</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Thermoproteus tenax</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Vulcanisaeta distributa</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p><abbrgrp><abbr bid="B2">2</abbr></abbrgrp>,a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T</p>
                     </c>
                     <c ca="left">
                        <p>Tp</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>Vulcanisaeta souniana</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>a</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>'Cenarchaeum symbiosum'</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B2">2</abbr>
                              <abbr bid="B56">56</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>N</p>
                     </c>
                     <c ca="left">
                        <p>N</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>'Nitrosopumilus maritimus'</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>unpublished</p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>K</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p><it>Ca</it>. Korarchaeum cryptofilum</p>
                     </c>
                     <c ca="left">
                        <p>
                           <abbrgrp>
                              <abbr bid="B30">30</abbr>
                           </abbrgrp>
                        </p>
                     </c>
                     <c ca="left">
                        <p>0</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*: D; Desulfurococcales, S; Sulfolobales, T; Thermoproteales, C; 'Cenarchaeales', N; 'Nitrosopumilales', K; 'Korarcheaota' (phylum)</p>
                  <p>**: D; Desulfurococcaceae, P; Pyrodictiaceae, u; unclassified, S; Sulfolobaceae, Tf; Thermofilaceae, Tp; Thermoproteaceae, C; Cenarchaeaceae, N; 'Nitrosopumilaceae'</p>
                  <p>***: Ca., Candidatus</p>
                  <p>****: Only the references for the data used in the present study are shown. See the text in the detail. a; the present study.</p>
               </tblfn>
            </tbl>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Introns in <it>cbf5 </it>and in rRNA genes in <it>Aeropyrum pernix </it>strains</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Strain</p>
                     </c>
                     <c ca="left">
                        <p>cbf5</p>
                     </c>
                     <c ca="left">
                        <p>arnS#1*</p>
                     </c>
                     <c ca="left">
                        <p>arnS#2*</p>
                     </c>
                     <c ca="left">
                        <p>arnL#3*</p>
                     </c>
                     <c ca="left">
                        <p>arnL#4*</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>K1</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Ialpha</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Igamma</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>OH1</p>
                     </c>
                     <c ca="left">
                        <p>type 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>OH2</p>
                     </c>
                     <c ca="left">
                        <p>type 2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>OH3</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB1</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB2</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB3</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB4</p>
                     </c>
                     <c ca="left">
                        <p>type 2</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Izeta</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB5</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Izeta</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB6</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Izeta</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB7</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Izeta</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TB8</p>
                     </c>
                     <c ca="left">
                        <p>type 1</p>
                     </c>
                     <c ca="left">
                        <p>Idelta</p>
                     </c>
                     <c ca="left">
                        <p>Iepsilon</p>
                     </c>
                     <c ca="left">
                        <p>Ibeta</p>
                     </c>
                     <c ca="left">
                        <p>Igamma</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*, positions and type of introns were designated as in <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>PCR screening of archaeal cbf5 genes</p>
            </st>
            <p>The typical reaction mixture for PCR (25 &#956;l) contained 1&#215; reaction buffer (Takara Bio, Ohtsu, Shiga, Japan), 0.2 mM of each deoxynucleoside triphosphate, 0.5 &#956;l of template, and 2.5 units of ExTaq (Takara Bio). At the first screening to obtain the gene fragment between Gly57 and Ile143 (<it>Sulfolobus tokodaii </it>numbering) with M13 sequencing primer (P-486 and P-583) binding sites at both ends, we used a set of degenerate primers based on conserved regions among known crenarchaeal Cbf5 sequences (1 &#956;M each of P-1607 and P-1608 (forward), and 2 &#956;M P-1516 (reverse)). For <it>Ignicoccus pacificus, Staphylothermus hellenicus, Pyrodictium brockii, 'Caldococcus noboribetus'</it>, and <it>Ignisphaera aggregans</it>, 2 &#956;M P-1608 was used as a forward primer instead of the combination of P-1607 and P-1608 to improve the amplification efficiency. In the case of <it>Pyrobaculum arsenaticum, P. islandicum</it>, and <it>P. organotrophum</it>, 2 &#956;M P-1911, specifically designed for the <it>Pyrobaculum </it>species, was used as the forward primer. The PCR products were purified and sequenced as described previously <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
            <p>To obtain additional sequence information from the 3' region of the gene in the species described above as well as in the species that we previously studied <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, we designed degenerate primers P-1609 and P-1610 with M13 sequencing primer binding sites and performed semi-nested PCR with two species-specific primers (forward) and P-1609/P-1610 (reverse). The second PCR products, or in some cases the first PCR products, if observed, were purified and sequenced with specific PCR primers or the universal reverse primer (as mentioned above). If necessary, internal primers were designed and used in primer walking.</p>
            <p>In the case of <it>Sulfolobus metallicus</it>, the reverse primer hybridized outside of the <it>cbf5 </it>gene in the 3' downstream region, and the PCR product included up to the termination codon of the <it>cbf5 </it>gene as well as the partial sequence of another coding region that partially overlapped <it>cbf5</it>.</p>
            <p>In the initial screening of the <it>Thermofilum </it>species, the above-mentioned combinations of primers did not work. Thus, we used P-1835 (forward) and P-1838 (reverse). Only the <it>T. pendens </it>pre-amplified DNA gave a product with the expected size. Sequence information from the product was used to design specific primers (P-1856 and P-1857). A semi-nested PCR that used P-1856 (in the first reaction, forward) and P-1857 (in the second reaction, forward) and a degenerate primer (P-1610, reverse) gave the products from non-amplified DNAs from both <it>T. pendens </it>and '<it>Thermofilum librum'</it>. Using the obtained sequence information, we designed specific primers (P-1860 and P-1862). To amplify the remaining portion of the 5' region of '<it>T. librum' cbf5</it>, semi-nested PCR that used P-1608 (forward) and P-1862 (in the first reaction) and P-1680 (in the second reaction) was performed.</p>
            <p>Primer sequences as well as species-specific primers used in the nested PCR and sequencing analysis are shown in Table <tblr tid="T3">3</tblr> and [Additional file <supplr sid="S2">2</supplr>], respectively. The deduced protein sequences from the <it>Thermofilum </it>species are identical; thus, we used only one sequence designated as <it>Thermofilum </it>in the phylogenetic analysis.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p><b>Oligodeoxynucleotides not listed in Table </b><tblr tid="T2">2</tblr>. Information of additional PCR and sequencing primers are shown.</p>
               </text>
               <file name="1471-2148-9-198-S2.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Oligonucleotides</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>name</p>
                     </c>
                     <c ca="left">
                        <p>sequence (5' to 3')*</p>
                     </c>
                     <c ca="left">
                        <p>target (peptide sequence)**</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-486</p>
                     </c>
                     <c ca="left">
                        <p>GAGCGGATAACAATTTCACACAGG</p>
                     </c>
                     <c ca="left">
                        <p>pUC/M13 rv</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-517</p>
                     </c>
                     <c ca="left">
                        <p>CCTACCCCATGAGAGGCCGTTGGA</p>
                     </c>
                     <c ca="left">
                        <p>A. pernix, fw</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-518</p>
                     </c>
                     <c ca="left">
                        <p>GGCCTATGGAGCTGCATCACGCA</p>
                     </c>
                     <c ca="left">
                        <p>A. pernix, rv</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-583</p>
                     </c>
                     <c ca="left">
                        <p>GTTTTCCCAGTCACGACGTTGTA</p>
                     </c>
                     <c ca="left">
                        <p>pUC/M13 fw</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1516</p>
                     </c>
                     <c ca="left">
                        <p>gagcggataacaatttcacacaggaVKGGKGGYYTYTGRTADAT</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, rv (IYQ(K/R)PP(L/V))</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1607</p>
                     </c>
                     <c ca="left">
                        <p>gttttcccagtcacgacgttgtaGGKCCKACKTCKCAYGARGT</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, fw (GPTSHEV)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1608</p>
                     </c>
                     <c ca="left">
                        <p>gttttcccagtcacgacgttgtaGGKCCKACKAGYCAYGARGT</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, fw (GPTSHEV)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1609</p>
                     </c>
                     <c ca="left">
                        <p>gagcggataacaatttcacacaggARYTCKCCYTTNAGNGT</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, rv (TLKGEL)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1610</p>
                     </c>
                     <c ca="left">
                        <p>gagcggataacaatttcacacaggARYTCKCCYTTYAANGT</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, rv (TLKGEL)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1835</p>
                     </c>
                     <c ca="left">
                        <p>gttttcccagtcacgacgttgtaGGKCCKACNAGYCAYGA</p>
                     </c>
                     <c ca="left">
                        <p>cbf5 fw (GPTSHE)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1838</p>
                     </c>
                     <c ca="left">
                        <p>gagcggataacaatttcacacaggTKGGRTCNAGNGTNCC</p>
                     </c>
                     <c ca="left">
                        <p>cbf5 rv (TTLDP(K/N/R))</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1856</p>
                     </c>
                     <c ca="left">
                        <p>GGTTGTAGCGTGGCTTAGGAAGCT</p>
                     </c>
                     <c ca="left">
                        <p>T. pendens, fw</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1857</p>
                     </c>
                     <c ca="left">
                        <p>GCTCCTAGGGATAGAGAGAATAGC</p>
                     </c>
                     <c ca="left">
                        <p>T. pendens, fw</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1860</p>
                     </c>
                     <c ca="left">
                        <p>TCGAACCTCCCTCTTCACAGCAGA</p>
                     </c>
                     <c ca="left">
                        <p>Thermofilum, rv</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1862</p>
                     </c>
                     <c ca="left">
                        <p>CAGCTTCGCACCAGACATGGAGGA</p>
                     </c>
                     <c ca="left">
                        <p>Thermofilum, rv</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>P-1911</p>
                     </c>
                     <c ca="left">
                        <p>gttttcccagtcacgacgttgtaGGKCCKAGYAGYCAYGA</p>
                     </c>
                     <c ca="left">
                        <p>cbf5, fw (GPSSHE)</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*; sequencing primer binding site is shown in lower case.</p>
                  <p>**; fw; forward, rv; reverse</p>
                  <p>K = G or T; R = G or A; Y = T or C; N = T, C, G or A; D = T, G, or A; V = C, G or A; S = C or G.</p>
               </tblfn>
            </tbl>
            <p>For strains of <it>Aeropyrum pernix</it>, PCR was performed with P-517 and P-518 as described in <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. The PCR product was treated with SAP-IT (GE Healthcare Bioscience) and used directly (without cloning) in a sequencing reaction with one of the PCR primers to determine a 249-bp region.</p>
            <p>Newly reported sequences were deposited in the DDBJ/EMBL/GenBank database under the accession numbers [DDBJ:<ext-link ext-link-id="AB245528" ext-link-type="ddbj">AB245528</ext-link>] to [DDBJ:<ext-link ext-link-id="AB245554" ext-link-type="ddbj">AB245554</ext-link>], [DDBJ:<ext-link ext-link-id="AB261609" ext-link-type="ddbj">AB261609</ext-link>] to [DDBJ:<ext-link ext-link-id="AB261610" ext-link-type="ddbj">AB261610</ext-link>], [DDBJ:<ext-link ext-link-id="AB304834" ext-link-type="ddbj">AB304834</ext-link>] to [DDBJ:<ext-link ext-link-id="AB304847" ext-link-type="ddbj">AB304847</ext-link>], and [DDBJ:<ext-link ext-link-id="AB469400" ext-link-type="ddbj">AB469400</ext-link>] to [DDBJ:<ext-link ext-link-id="AB469410" ext-link-type="ddbj">AB469410</ext-link>].</p>
            <p>During the preparation of this manuscript, genome sequence data from <it>Staphylothermus marinus </it><abbrgrp><abbr bid="B7">7</abbr></abbrgrp> (release date, Feburary 21, 2007), <it>Hyperthermus butylicus </it><abbrgrp><abbr bid="B8">8</abbr></abbrgrp> (release date; January 22, 2007), <it>Metallosphaera sedula </it>[Genbank:<ext-link ext-link-id="CP000682" ext-link-type="gen">CP000682</ext-link>] (released date; June 30, 2008), <it>Thermofilum pendens </it><abbrgrp><abbr bid="B9">9</abbr></abbrgrp> (release date; December 18, 2006), <it>Caldivirga maquilingensis </it>[Genbank: <ext-link ext-link-id="CP000852" ext-link-type="gen">CP000852</ext-link>] (release date: October 5, 2007), <it>Pyrobaculum arsenaticum </it>[Genbank: <ext-link ext-link-id="CP000660" ext-link-type="gen">CP000660</ext-link>] (release date; November 1, 2007), <it>Pyrobaculum islandicum </it>[Genbank: <ext-link ext-link-id="CP000504" ext-link-type="gen">CP000504</ext-link>] (release date; November 1, 2007), and <it>Thermoproteus neutrophilus </it>[Genbank: <ext-link ext-link-id="CP001014" ext-link-type="gen">CP001014</ext-link>] (release data; March 27, 2008), of which <it>cbf5 </it>we sequenced, became available. However, the gene annotation was different from ours when the gene had the putative intron (see below). Our sequence determination was independently performed before the release date of the data from other groups; the data from the additional 16 species were deposited to the database on May 31, 2007. Note that, as for <it>S. marinus </it>and <it>H. butylicus</it>, we released the partial <it>cbf5 </it>sequence data on June 28, 2006. Thus, we used our data for the above-mentioned seven species in the following analysis. To avoid the confusion, we did not include information of the above-mentioned seven species from other groups in Table <tblr tid="T1">1</tblr>.</p>
         </sec>
         <sec>
            <st>
               <p>Sequence and phylogenetic analysis</p>
            </st>
            <p>RNA secondary structure was predicted with the mfold version 3.1 web server (Figure <figr fid="F1">1</figr>) <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. The putative exon-intron boundaries were assigned between the first and second letters of the codon for the catalytic aspartic residue of Cbf5 <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. The predicted BHB motifs were also considered for the prediction of the exon-intron borders (Figure <figr fid="F1">1</figr>). The alignment of the cbf5 protein sequences (56 operational taxonomic units (OTUs)) was performed with ClustalW <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> (Additional file <supplr sid="S3">3</supplr>). Well-aligned regions were then selected (201 sites in total) with Gblocks <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> with the following parameters: the minimum number of sequences for a conserved position was 29, the minimum number of sequences for a flanking position was 47, the maximum number of contiguous nonconserved positions was 10, and the minimum length of a block was 5. Tree reconstruction was performed with the Treefinder version of June 2008 (for maximum likelihood inference) <abbrgrp><abbr bid="B14">14</abbr></abbrgrp> under the WAG+G model (WAG model <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> with consideration of gamma-shaped rate variation (4-parameter model) <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>) and MrBayes 3.12 (for Bayesian inference) <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> under the WAG+I+G model (WAG model with consideration of gamma-shaped rate variation (4-parameter model) and a proportion of invariable sites). For the Bayesian inference analysis (Figures <figr fid="F2">2</figr> and Additional file <supplr sid="S4">4</supplr>), a Markov chain Monte Carlo analysis was run for 2,000,000 generations, and trees were built in 100-generation intervals (burn-in = 5,000). Statistical support for the maximum likelihood inference tree was evaluated with a non-parametric bootstrap test with 1,000 re-sampling events. The AU (approximately unbiased) <abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, NP (non-scaled bootstrap probability) <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, and KH (Kishio-Hasegawa) <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> tests were performed with CONSEL <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. For these tests, to reduce number of trees to be considered, analyses were performed with the grouping of the sequences to form a reduced number of the dataset (36 OTUs, 202 sites) with Codeml in PAML 3.13 <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> under the WAG+G model (Additional file <supplr sid="S5">5</supplr>, see below) (for the alignment, see Additional file <supplr sid="S6">6</supplr>). The tree topologies tested were selected by the preliminary maximum likelihood analysis performed with TREE-PUZZLE 5.2 <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> (Figure <figr fid="F2">2</figr>). Same dataset was also used for Bayesian inference with MrBayes 3.12. In Figure <figr fid="F2">2</figr>, the obtained tree with Bayesian inference was shown. The 16S rRNA phylogenetic tree was reconstructed by using Treefinder version of June 2008 and MrBayes 3.12 under the GTR+I+G model (GTR: general time reversible, 6-parameter model). The 16S rRNA gene sequences (49 OTUs) were aligned with Clustal X <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> under the default condition. The well-aligned regions were selected (1,122 sites in total) with Gblocks under the default condition for nucleotide sequences. The model was selected by using modeltest 3.7 <abbrgrp><abbr bid="B25">25</abbr></abbrgrp> with PAUP4b10 <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> under Akaike's Information Criterion. The alignment of the <it>cbf5 </it>intron with the flanking sequences was performed with R-coffee <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> using default parameters. Most calculations were performed using a MacPro (Apple) with a 3.0-GHz 8-core (4 &#215; 2) Xeon Intel processor and 8-GB memory.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Secondary structures of (putative) exon-intron boundaries of crenarchaeal <it>cbf5 </it>newly identified in this study</p>
               </caption>
               <text>
                  <p><b>Secondary structures of (putative) exon-intron boundaries of crenarchaeal <it>cbf5 </it>newly identified in this study</b>. The structures were predicted with mfold <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. In the cases of <it>Staphylothermus hellenicus </it>and <it>Ignisphaera aggregans</it>, manually modified structures are also shown. The predicted exons and introns are shown in upper and lower cases, respectively.</p>
               </text>
               <graphic file="1471-2148-9-198-1"/>
            </fig>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Bayesian phylogenetic tree of representative Cbf5 protein sequences</p>
               </caption>
               <text>
                  <p><b>Bayesian phylogenetic tree of representative Cbf5 protein sequences</b>. Thirty-six species were selected for tree reconstruction and were divided into 11 categories. See sequence details in [Additional file <supplr sid="S1">1</supplr>], except for <it>Methanocaldococcus jannaschii </it>[Genbank:<ext-link ext-link-id="AAB98132" ext-link-type="gen">AAB98132</ext-link>], '<it>Nanoarchaeum equitans' </it>[Genbank:<ext-link ext-link-id="AAR39298" ext-link-type="gen">AAR39298</ext-link>)], and <it>Methanopyrus kandleri </it>[Genbank:<ext-link ext-link-id="AAM01350" ext-link-type="gen">AAM01350</ext-link>] as the outgroups. To analyze the monophyletic status of orders Desulfurococcales + Sulfolobales (analysis 1), categories 8 to 11 were treated as a single category. To analyze the interrelationship within Desulfurococcales (analysis 2), categories 1 to 5 were treated as a single category. Posterior probability (PP) for Bayesian Inference and bootstrap probability (BP; %) for the maximum likelihood method are shown at the nodes. Bold lines show lineages with the (putative) <it>cbf5 </it>intron.</p>
               </text>
               <graphic file="1471-2148-9-198-2"/>
            </fig>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p><b>Alignment of archaeal Cbf5 sequences used in the analysis for Additional file </b><supplr sid="S4">4</supplr>. #; selected positions for the analysis.</p>
               </text>
               <file name="1471-2148-9-198-S3.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S4">
               <title>
                  <p>Additional file 4</p>
               </title>
               <text>
                  <p><b>Bayesian phylogenetic tree of crenarchaeal Cbf5 protein</b>. Crenarchaeal Cbf5 sequences, which are not included in Figure <figr fid="F2">2</figr>, are included.</p>
               </text>
               <file name="1471-2148-9-198-S4.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S5">
               <title>
                  <p>Additional file 5</p>
               </title>
               <text>
                  <p><b>The results of statistical tests of analysis 1</b>. Comparisons of statistical supports of each grouping concerning the phylogeny of the outgroups of Sulfolobales and Desulfurococcales.</p>
               </text>
               <file name="1471-2148-9-198-S5.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <suppl id="S6">
               <title>
                  <p>Additional file 6</p>
               </title>
               <text>
                  <p><b>Alignment of archaeal Cbf5 sequences used in the analysis for Figure </b><figr fid="F2">2</figr>. #; selected positions for the analysis.</p>
               </text>
               <file name="1471-2148-9-198-S6.pdf">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results and discussion</p>
         </st>
         <p>Our previous analysis of crenarchaeal <it>cbf5 </it>genes showed that only orders Desulfurococcales and Sulfolobales have the (putative) intron in their <it>cbf5 </it>genes, although some species in the order Desulfurococcales do not have the intron. However, phylogenetic analysis with the previous dataset did not strongly support the sister grouping of orders Desulfurococcales and Sulfolobales without species from other orders, and the phylogenetic positions of the species in Desulfurococcales, which do not have the intron, were unclear <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>.</p>
         <p>To improve the phylogenetic analysis of the <it>cbf5 </it>gene, we extended the analyzed region of the genes from 27 species to include an additional area in the 3' region (from about 70 to 220 amino acid residues), and we added new sequences from an additional 16 crenarchaeal species. We also added the recent information from the newly determined crenarchaeal and korarchaeal genomes. The species and the intron size information are summarized in [Additional file <supplr sid="S1">1</supplr>]. When the presence of the intron was expected, the new putative exon-intron borders from seven species among the additional 16 species were subjected to a prediction of their secondary structures (Figure <figr fid="F1">1</figr>. For 18 species which have the (putative) intron among the previously characterized 27 species, see reference <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>). Except for the cases of <it>'Caldococcus noboribetus' </it>and <it>Acidianus brierleyi</it>, the predicted structures in the pre-mRNAs have an unconventional BHB structure <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, which should be recognized and cleaved by the hetero-oligomeric splicing endonuclease, as demonstrated previously <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. Recent X-ray crystallography has revealed that hetero-oligomeric splicing endonuclease is a dimer of hetero-dimers <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. The predicted cleavage sites between the second and the third residues in the bulges of the BHB motif were consistent with the expected exon-intron borders, suggesting that the predicted exon-intron borders were convincing. In fact, partial cDNA sequences of spliced <it>cbf5 </it>mRNA from <it>Desulfurococcus amylolyticus</it>, <it>Desulfurococcus mucosus</it>, <it>Staphylothermus hellenicus, Acidianus brierleyi </it>and <it>Ignisphaera aggregans </it>were consistent with the predictions (Watanabe, Y. and Itoh, T. unpublished results), although the definite identification of the borders of the remaining species requires a cDNA sequencing and cleavage study using splicing endonuclease. Results from our present study, together with the previous study <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>, indicate that among the order Desulfurococcales, <it>Ignicoccus </it>spp. and all species from family Pyrodictiaceae do not have the <it>cbf5 </it>intron.</p>
         <p>Using a new dataset, we reconstructed phylogenetic trees of the cbf5 protein sequence by using maximum likelihood (not shown) and Bayesian methods [Additional file <supplr sid="S4">4</supplr>]. These trees suggested the monophyly of the cbf5 protein sequences from orders Desulfurococcales and Sulfolobales. We verified this monophyly with several statistical tests (analysis 1, [Additional file <supplr sid="S5">5</supplr>]). To finish the computation within a reasonable time (approximately 1 week) using the available computational environment with a reduced number of trees to be considered, we first reduced the number of sequences in the dataset and reconstructed the phylogenetic tree (Figure <figr fid="F2">2</figr>). There was no significant difference in the tree topology before and after the reduction of the sequence (compare [Additional file <supplr sid="S4">4</supplr>] and Figure <figr fid="F2">2</figr>). Then, we fixed the relationships within each of the eight groups (Figure <figr fid="F2">2</figr>) and examined the relationships between the groups (analysis 1, Additional file <supplr sid="S5">5</supplr>). The results of the tests supported the monophyly of the sequences from orders Desulfurococcales and Sulfolobales (AU; P = 0.938, NP; P = 0.799, KH; P = 0.907) and also suggested the inclusion of the sequence of 'Korarchaeum' into the crenarchaeal sequences. The result is consistent with the phylogenetic association of rRNA and protein sequences from 'Korarchaeum' and Crenarchaea <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>.</p>
         <p>The sequences from the species of family Pyrodictiaceae and <it>Ignicoccus </it>spp. are grouped independently, and these monophylies were strongly supported with high statistical values in the trees (Figure <figr fid="F2">2</figr>, see also [Additional files <supplr sid="S5">5</supplr> and <supplr sid="S6">6</supplr>]). Although among orders Desulfurococcales and Sulfolobales, these groups are not likely to be the earliest branching (Figure <figr fid="F2">2</figr>, see also [Additional file <supplr sid="S4">4</supplr>]), the branching order among order Desulfurococcales, particularly of <it>Ignisphaera aggregans</it>, was uncertain. Thus, we examined whether the sequences of family Pyrodictiaceae and/or <it>Ignicoccus </it>spp. branched earliest among the order Desulfurococcales, except for <it>Ignisphaera aggregans</it>, by using AU, NP, and KH tests of an alternative grouping set (analysis 2, Figure <figr fid="F2">2</figr>, [Additional file <supplr sid="S7">7</supplr>]). The monophyly of the Desulfurococcaceae (i.e., the earliest branching of the Pyrodictiaceae sequence) was rejected by the AU test (P = 0.029) and NP test (P = 0.001) (95% significance level) but not by the KH test (P = 0.075). If <it>Ignisphaera aggregans </it>was not considered, the monophyly of the Desulfurococcaceae (excluding <it>Ignisphaera aggregans </it>and Pyrodictiacean species) would be supported by only small probabilities by the AU test and KH test (P = 0.062, and 0.071, respectively) and rejected by the NP test (P &lt; 0.001). The monophyletic grouping of the Desulfurococcaceae (group d in Figure <figr fid="F2">2</figr>) with the intron and the Pyrodictiaceae was supported by the AU, NP, and KH tests (P = 0.831, 0.697, and 0.829, respectively). These results suggest that the sequences of the Pyrodictiaceae (as seen in the Bayesian tree of Figure <figr fid="F2">2</figr>) are unlikely to be the earliest branching. The monophyletic grouping of Desulfurococcaceae (c) with the intron and <it>Ignicoccus </it>spp. (as seen in the tree of Figure <figr fid="F2">2</figr>) was also supported by the AU, NP, and KH tests (P = 0.82, 0.605, and 0.78, respectively). These results also suggest that the sequence of <it>Ignicoccus </it>spp. is not likely to be the earliest branching as seen in the Bayesian tree of Figure <figr fid="F2">2</figr>. The monophyly of Desulfurococcaceae (b) + Desulfurococcaceae (c) (appeared in the Bayesian tree of Figure <figr fid="F2">2</figr>) could not be rejected by the AU and KH tests because of their medium probabilities (P = 0.155 and 0.187, respectively), but this monophyly was rejected by the NP test (P = 0.02). The monophyly of <it>Ignisphaera aggregans </it>+ Pyrodictiaceae also cannot be rejected by the AU, NP, and KH tests because of their medium probabilities (P = 0.313, 0.212, and 0.219, respectively). The monophyly of Desulfurococcaceae (c and d) + Pyrodictiaceae was not rejected by the tests (AU; P = 0.287, NP; P = 0.078, KH; P = 0.163). Finally, the monophyly of species with the intron was not rejected by the tests (AU; P = 0.329, NP; P = 0.058, KH; P = 0.194). Therefore, the sequence of both <it>Ignicoccus </it>spp. and the Pyrodictiaceae was unlikely to be the earliest simultaneous branching, as seen in the tree presented in Figure <figr fid="F2">2</figr>. These results suggest that the sequences of these groups are not likely to be the earliest branching, although the possibility was not completely excluded. As a reference, we constructed a phylogenetic tree of 16S rRNA of the corresponding species by using the Bayesian method [Additional file <supplr sid="S8">8</supplr>]. The 16S rRNA tree also supported the monophyletic groupings of orders Desulfurococcales and Sulfolobales, <it>Ignicoccus </it>spp. and Desulfurococcaceae (c), and Pyrodictiaceae and Desulfurococcaceae (d), suggesting that there was no obvious gene transfer of <it>cbf5 </it>from outside of orders Desulfurococcales and Sulfolobales. About 6% of protein-coding genes in <it>Ignicoccus hospitalis </it>are thought to be transferred from its symbiont <it>'Nanoarchaea' </it><abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. However, in our analysis, the monophyletic grouping of <it>cbf5 </it>genes in <it>Ignicoccus spp</it>. with the nanoarchaeal sequence was not supported. Thus, the <it>cbf5 </it>gene in <it>Ignicoccus spp</it>. is not likely due to gene transfer of the intron-less nanoarchaeal <it>cbf5 </it>gene.</p>
         <suppl id="S7">
            <title>
               <p>Additional file 7</p>
            </title>
            <text>
               <p><b>The results of statistical tests of analysis 2</b>. Comparisons of statistical supports of each grouping concerning the phylogeny within Sulfolobales and Desulfurococcales.</p>
            </text>
            <file name="1471-2148-9-198-S7.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <suppl id="S8">
            <title>
               <p>Additional file 8</p>
            </title>
            <text>
               <p><b>Bayesian phylogenetic tree of the crenarchaeal 16S rRNA</b>. This is for comparison with cbf5 tree.</p>
            </text>
            <file name="1471-2148-9-198-S8.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <p>We also aligned the (putative) <it>cbf5 </it>introns with the flanking sequences using the program R-coffee with the RNA secondary structure prediction option (Figure <figr fid="F3">3</figr>). The alignment showed some conservation in the intron region beyond base-pairing with the exon regions to maintain the motif required for cleavage by the splicing endonuclease, suggesting a common origin for these introns. Note that the internal region of the introns was highly variable likely due to the independence of recognition by the splicing endonuclease during the cleavage at the exon-intron borders.</p>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Alignment of <it>cbf5 </it>introns with their flanking sequences</p>
            </caption>
            <text>
               <p><b>Alignment of <it>cbf5 </it>introns with their flanking sequences</b>. The data was shaded by using the Boxshade server <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. Residues conserved among more than 50% of the sequences are shown on black background. Residues similar to the conserved residue, or conserved among purines (or pyrimidines), are shown on gray background. The intron region and the region corresponding to the BHB motif (bulge as B, helix as H) are also shown.</p>
            </text>
            <graphic file="1471-2148-9-198-3"/>
         </fig>
         <p>The origin of the archaeal <it>cbf5 </it>intron is still unclear. We previously proposed that relaxed substrate specificity <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp> of the hetero-oligomeric splicing endonuclease <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B35">35</abbr></abbrgrp> led to the birth of the pre-mRNA intron, which frequently contains the relaxed cleavage motif (<abbrgrp><abbr bid="B2">2</abbr></abbrgrp> and this study). In particular, the recognition of the relaxed cleavage motif within a non-tRNA context has been shown to be characteristic of crenarchaeal hetero-tetrameric splicing endonuclease <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B29">29</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. Although the intron sizes in cbf5 and rRNA are different from one another, as discussed below, archaeal rRNA introns are observed mainly in crenarchaeal species, which are expected to have the crenarchaeal hetero-tetrameric splicing endonuclease <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. In some cases, archaeal rRNA introns also have the relaxed cleavage motifs <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. The size of archaeal tRNA introns (11 to 175 nucleotides) are more similar to those in crenarchaeal <it>cbf5</it>, and accumulation of tRNA introns in crenarchaeal species is observed <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. The unconventional cleavage motif at the exon-intron borders and the intron location at the position rather than the usual position "37/38" of tRNA intron are also observed more frequently in crenarchaeal species <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B36">36</abbr></abbrgrp>. The contribution of the hetero-tetrameric splicing endonuclease is suggested for the cleavage of the unconventional motif, and has been demonstrated by the crenarchaeal hetero-tetrameric splicing endonuclease (reviewed in <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>).</p>
         <p>Numerous archaeal rRNA introns contain the open reading frame for DNA endonuclease, which functions as a homing endonuclease to make the intron as a mobile element (reviewed in <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>). Apparently, the archaeal <it>cbf5 </it>intron is too short (from 16 to 44 bp, see [Additional file <supplr sid="S1">1</supplr>]) to encode such a nuclease. Nomura et al. found that <it>A. pernix </it>isolates have variations in the number, sequence, and positions of rRNA introns <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> (see also Table <tblr tid="T2">2</tblr>). In the present study, we determined partial <it>cbf5 </it>sequences of these <it>A. pernix </it>isolates. Together with the results of the previous studies for type strain K1 <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, we found that at the corresponding positions, all of the analyzed <it>cbf5 </it>genes have a putative intron, classified as type 1 or type 2 (Figure <figr fid="F4">4</figr>, the distribution is mentioned in Table <tblr tid="T2">2</tblr>), which contains only two base substitutions. There was no correlation between the variation of <it>cbf5 </it>and rRNA introns (Table <tblr tid="T2">2</tblr>). Although sequence variation of rRNA introns between <it>A. pernix </it>isolates (one to two substitutions in I beta or one substitution in I epsilon) were observed, this was not correlated with the variation of the <it>cbf5 </it>intron. However, a correlation between the <it>cbf5 </it>intron and <it>radA </it>phylogeny shown by Nomura et al. <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> was observed (not shown). Our results show that, as for the large-scale in-del event, the <it>cbf5 </it>intron was more conserved than the rRNA introns with the homing DNA endonuclease gene. However, Nomura et al. <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> also found that some of the rRNA introns are deletion derivatives of the introns with an open reading frame. For example, <it>A. perinix </it>introns I delta and I zeta are deletion derivatives of I alpha and I gamma, respectively <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The contemporary <it>cbf5 </it>introns may be examples of such deletion derivatives. Proof of this possibility requires further taxonomic sampling of <it>cbf5 </it>genes to find the intron that includes the protein-coding sequence.</p>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>Two types of exon-intron boundaries of <it>Aeropyrum pernix cbf5</it></p>
            </caption>
            <text>
               <p><b>Two types of exon-intron boundaries of <it>Aeropyrum pernix cbf5</it></b>. The exons and introns are shown as in Figure 1. Residues substituted between each type are circled.</p>
            </text>
            <graphic file="1471-2148-9-198-4"/>
         </fig>
         <p>Peng et al. showed that during the generation of infection, putative 12-bp introns were inserted into protein-coding genes in an archaeal virus genome, although splicing was not demonstrated and the mechanism of insertion of the 12-bp sequence is unknown <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. Interestingly, the sizes of the <it>cbf5 </it>introns from <it>Staphylothermus hellenicus </it>and <it>S. marinus </it>are 36 bp (3 times 12); thus, mechanisms of insertion of archaeal <it>cbf5 </it>introns and the putative introns in the archaeal virus genome may be related. Furthermore, the <it>cbf5 </it>introns of <it>Stetteria hydrogenophila </it>(33 bp) and <it>Ignisphaera aggregans </it>(39 bp), as well as <it>S. hellenicus </it>and <it>S. marinus</it>, do not change the reading frame. The putative introns in the virus genome may not be spliced out and the coding region with such insertions may produce functional proteins. However, in the case of <it>cbf5 </it>introns, the insertion disrupts the codon of the catalytic residue of the protein <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B40">40</abbr></abbrgrp>, and thus these must be spliced out if the organism needs the functional protein.</p>
         <p>One possible explanation of the putative secondary loss of the <it>cbf5 </it>intron in certain lineages is that the intron-containing gene is replaced with a sequence without the intron, possibly produced by reverse transcription of the spliced mRNA <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>, or the spliced mRNA itself. Although reverse transcriptase activity has not been observed in crenarchaeal cells, the presence of a putative reverse transcriptase gene in some archaeal genomes has been suggested <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. In fact, in the sequenced genomes of <it>Ignicoccus hospitalis </it>and <it>Hyperthermus butylicus </it>(family Pyrodictiaceae) with the putative secondary loss of the <it>cbf5 </it>intron, candidate reverse transcriptase genes were identified [Additional files <supplr sid="S9">9</supplr> and <supplr sid="S10">10</supplr>]. An alternative possibility could be the requirement of higher activity of pseudouridine synthase in a certain environment. Previously, we proposed that the <it>cbf5 </it>intron functions as a negative regulator of the expression of pseudouridine synthase <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Archaeal Cbf5 catalyzes pseudouridine formation in rRNA and tRNA together with other associated proteins using a guide RNA <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B43">43</abbr></abbrgrp> or without a guide RNA <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Incorporation of pseudouridine in RNA increases the thermodynamic stability of RNA <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Furthermore, pseudouridylation of tRNA at position 55 by TruB in mesophilic bacteria <it>Escherichia coli </it>supports the resistance to higher temperature <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. Archaeal Cbf5, a member of truB family <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>, also forms a pseudouridine in tRNA at position 55 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Thus, at extremely high temperatures, the organisms might not prefer the down-regulation system of the pseudouridine synthase and lose it.</p>
         <suppl id="S9">
            <title>
               <p>Additional file 9</p>
            </title>
            <text>
               <p><b>Alignment of COG1353 proteins</b>. <it>Sulfolobus solfataricus </it>SSO1991, a representative of COG1353 which was predicted as a putative reverse transcriptase, and the homologs from <it>Hyperthermus butylicus</it>, and <it>Ignicoccus hospitalis </it>are included.</p>
            </text>
            <file name="1471-2148-9-198-S9.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <suppl id="S10">
            <title>
               <p>Additional file 10</p>
            </title>
            <text>
               <p><b>Figure legends for Additional files</b>. Legends for Additional files <supplr sid="S3">3</supplr>, <supplr sid="S4">4</supplr>, <supplr sid="S6">6</supplr>, <supplr sid="S8">8</supplr> and <supplr sid="S9">9</supplr> are shown.</p>
            </text>
            <file name="1471-2148-9-198-S10.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The results of the present study suggest that <it>cbf5 </it>gained the intron in the common ancestor of orders Desulfurococcales and Sulfolobales, and that <it>cbf5 </it>lost the intron independently in the ancestors of the family Pyrodictiaceae and <it>Ignicoccus </it>spp. Since we found the first examples of <it>cbf5 </it>introns, sequences of three crenarchaeal genomes with the <it>cbf5 </it>intron have been determined. However, the <it>cbf5 </it>intron in these genomes was misidentified (<it>S. acidocaldarius</it>; <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>, see <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>) or ignored (<it>Staphylothermus marinus </it><abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, <it>Metallosphaera sedula</it>, [Genbank:<ext-link ext-link-id="CP000682" ext-link-type="gen">CP000682</ext-link>]). Even for the first three examples in <it>A. pernix</it>, <it>S. solfataricus</it>, and <it>S. tokodaii</it>, the gene prediction of these examples was still confused with cases of translational frame-shifting by other researchers <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. Although there was no confirmation of archaeal pre-mRNA splicing for genes other than <it>cbf5</it>, the presence of the putative intron in other protein-coding genes was predicted <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B50">50</abbr></abbrgrp>. To completely understand protein-coding genes in archaeal genomes, tools for effective prediction of introns in archaeal protein-coding genes must be developed with comparative or computational methods <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B51">51</abbr></abbrgrp>. Experimental confirmation of the predictions, including the putative <it>cbf5 </it>introns predicted in our studies, is indispensable.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>YW conceived the study and participated in its design, carried out the molecular genetic studies, participated in the sequence alignment, and drafted the manuscript. S. Yokobori participated in the design of the study, the sequence alignment, performed the statistical analysis, and helped draft the manuscript. TI, S. Yoshinari, and NN carried out the molecular genetic studies and helped draft the manuscript. YS, AY, TO, and KK participated in the design and coordination of the study and helped draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank Dr. M. Aoshima for the gift of DNA from '<it>Caldococcus noboribetus</it>'.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Introns in protein-coding genes in Archaea</p>
            </title>
            <aug>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yokobori</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Inaba</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yamagishi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oshima</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kawarabayasi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kikuchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kita</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>2002</pubdate>
            <volume>510</volume>
            <fpage>27</fpage>
            <lpage>30</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0014-5793(01)03219-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">11755525</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Archaeal pre-mRNA splicing: a connection to hetero-oligomeric splicing endonuclease</p>
            </title>
            <aug>
               <au>
                  <snm>Yoshinari</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Itoh</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hallam</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>DeLong</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Yokobori</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamagishi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oshima</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2006</pubdate>
            <volume>346</volume>
            <fpage>1024</fpage>
            <lpage>1032</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2006.06.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">16781672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Functional reconstitution of a crenarchaeal splicing endonuclease <it>in vitro</it></p>
            </title>
            <aug>
               <au>
                  <snm>Yoshinari</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fujita</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Masui</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kuramitsu</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yokobori</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2005</pubdate>
            <volume>334</volume>
            <fpage>1254</fpage>
            <lpage>1259</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2005.07.023</pubid>
                  <pubid idtype="pmpid" link="fulltext">16039609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Transcription and excision of a large intron in the tRNA<sup>Trp </sup>gene of an archaebacterium, <it>Halobacterium volcanii</it></p>
            </title>
            <aug>
               <au>
                  <snm>Daniels</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Gupta</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Doolittle</snm>
                  <fnm>WF</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1985</pubdate>
            <volume>260</volume>
            <fpage>3132</fpage>
            <lpage>3134</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3844407</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>An intron in the 23S ribosomal RNA gene of the archaebacterium <it>Desulfurococcus mobilis</it></p>
            </title>
            <aug>
               <au>
                  <snm>Kjems</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1985</pubdate>
            <volume>318</volume>
            <fpage>675</fpage>
            <lpage>677</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/318675a0</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Heterogeneous yet similar introns reside in identical positions of the rRNA genes in natural isolates of the archaeon <it>Aeropyrum pernix</it></p>
            </title>
            <aug>
               <au>
                  <snm>Nomura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Morinaga</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kogishi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Sako</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Uchida</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>2002</pubdate>
            <volume>295</volume>
            <fpage>43</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1119(02)00802-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12242010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>The complete genome sequence of <it>Staphylothermus marinus </it>reveals differences in sulfur metabolism among heterotrophic Crenarchaeota</p>
            </title>
            <aug>
               <au>
                  <snm>Anderson</snm>
                  <fnm>IJ</fnm>
               </au>
               <au>
                  <snm>Dharmarajan</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Rodriguez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hooper</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Porat</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Ulrich</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Elkins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Mavromatis</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Land</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lapidus</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lucas</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Barry</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Huber</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhulin</snm>
                  <fnm>IB</fnm>
               </au>
               <au>
                  <snm>Whitman</snm>
                  <fnm>WB</fnm>
               </au>
               <au>
                  <snm>Mukhopadhyay</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Woese</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bristow</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kyrpides</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>BMC Genomics</source>
            <pubdate>2009</pubdate>
            <volume>10</volume>
            <fpage>145</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2164-10-145</pubid>
                  <pubid idtype="pmcid">2678158</pubid>
                  <pubid idtype="pmpid" link="fulltext">19341479</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>The genome of <it>Hyperthermus butylicus</it>: a sulfur-reducing, peptide fermenting, neutrophilic Crenarchaeote growing up to 108 degrees C</p>
            </title>
            <aug>
               <au>
                  <snm>Br&#252;gger</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Stark</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zibat</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Redder</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Ruepp</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Awayez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>She</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Klenk</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>Archaea</source>
            <pubdate>2007</pubdate>
            <volume>2</volume>
            <fpage>127</fpage>
            <lpage>135</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1155/2007/745987</pubid>
                  <pubid idtype="pmcid">2686385</pubid>
                  <pubid idtype="pmpid" link="fulltext">17350933</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Genome sequence of <it>Thermofilum pendens </it>reveals an exceptional loss of biosynthetic pathways without genome reduction</p>
            </title>
            <aug>
               <au>
                  <snm>Anderson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Rodriguez</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Susanti</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Porat</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Reich</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ulrich</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Elkins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Mavromatis</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lykidis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Nolan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Land</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Copeland</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lapidus</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lucas</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Detter</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Zhulin</snm>
                  <fnm>IB</fnm>
               </au>
               <au>
                  <snm>Olsen</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>Whitman</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Mukhopadhyay</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bristow</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kyrpides</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2008</pubdate>
            <volume>190</volume>
            <fpage>2957</fpage>
            <lpage>2965</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/JB.01949-07</pubid>
                  <pubid idtype="pmcid">2293246</pubid>
                  <pubid idtype="pmpid" link="fulltext">18263724</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure</p>
            </title>
            <aug>
               <au>
                  <snm>Mathews</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Sabina</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zuker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Turner</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>1999</pubdate>
            <volume>288</volume>
            <fpage>911</fpage>
            <lpage>940</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.1999.2700</pubid>
                  <pubid idtype="pmpid" link="fulltext">10329189</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Mfold web server for nucleic acid folding and hybridization prediction</p>
            </title>
            <aug>
               <au>
                  <snm>Zuker</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2003</pubdate>
            <volume>31</volume>
            <fpage>3406</fpage>
            <lpage>3415</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/gkg595</pubid>
                  <pubid idtype="pmcid">169194</pubid>
                  <pubid idtype="pmpid" link="fulltext">12824337</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Castresana</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2000</pubdate>
            <volume>17</volume>
            <fpage>540</fpage>
            <lpage>552</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10742046</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Jobb</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>von Haeseler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Strimmer</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>BMC Evol Biol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>18</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1471-2148-4-18</pubid>
                  <pubid idtype="pmcid">459214</pubid>
                  <pubid idtype="pmpid" link="fulltext">15222900</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach</p>
            </title>
            <aug>
               <au>
                  <snm>Whelan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <fpage>691</fpage>
            <lpage>699</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11319253</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Maximum-likelihood phylogenetic estimation from DNA sequences with variable rates over sites: Approximate methods</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>Z</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1994</pubdate>
            <volume>39</volume>
            <fpage>306</fpage>
            <lpage>314</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF00160154</pubid>
                  <pubid idtype="pmpid">7932792</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>MrBayes 3: Bayesian phylogenetic inference under mixed models</p>
            </title>
            <aug>
               <au>
                  <snm>Ronquist</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Huelsenbeck</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>1572</fpage>
            <lpage>1574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg180</pubid>
                  <pubid idtype="pmpid" link="fulltext">12912839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>An approximately unbiased test of phylogenetic tree selection</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2002</pubdate>
            <volume>51</volume>
            <fpage>492</fpage>
            <lpage>508</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1080/10635150290069913</pubid>
                  <pubid idtype="pmpid" link="fulltext">12079646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Confidence limits on phylogenies: An approach using the bootstrap</p>
            </title>
            <aug>
               <au>
                  <snm>Felsenstein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1985</pubdate>
            <volume>39</volume>
            <fpage>783</fpage>
            <lpage>791</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2408678</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea</p>
            </title>
            <aug>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1989</pubdate>
            <volume>29</volume>
            <fpage>170</fpage>
            <lpage>179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02100115</pubid>
                  <pubid idtype="pmpid">2509717</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>CONSEL: for assessing the confidence of phylogenetic tree selection</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2001</pubdate>
            <volume>17</volume>
            <fpage>1246</fpage>
            <lpage>1247</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/17.12.1246</pubid>
                  <pubid idtype="pmpid" link="fulltext">11751242</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>PAML: a program package for phylogenetic analysis by maximum likelihood</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>Z</fnm>
               </au>
            </aug>
            <source>Comput Appl Biosci</source>
            <pubdate>1997</pubdate>
            <volume>13</volume>
            <fpage>555</fpage>
            <lpage>556</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9367129</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing</p>
            </title>
            <aug>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>HA</fnm>
               </au>
               <au>
                  <snm>Strimmer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Vingron</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>von Haeseler</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>502</fpage>
            <lpage>504</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/18.3.502</pubid>
                  <pubid idtype="pmpid" link="fulltext">11934758</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Plewniak</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jeanmougin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <fpage>4876</fpage>
            <lpage>4882</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/25.24.4876</pubid>
                  <pubid idtype="pmcid">147148</pubid>
                  <pubid idtype="pmpid" link="fulltext">9396791</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Modeltest: testing the model of DNA sustitution</p>
            </title>
            <aug>
               <au>
                  <snm>Posada</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Crandall</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>Bioinfomatics</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <fpage>817</fpage>
            <lpage>818</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1093/bioinformatics/14.9.817</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods)</p>
            </title>
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Version 4</source>
            <publisher>Sinauer Associates, Sunderland, Massachusetts</publisher>
            <pubdate>2003</pubdate>
         </bibl>
         <bibl id="B27">
            <title>
               <p>R-Coffee: a web server for accurately aligning noncoding RNA sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Moretti</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wilm</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Xenarios</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Notredame</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2008</pubdate>
            <volume>36</volume>
            <fpage>W10</fpage>
            <lpage>3</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/gkn278</pubid>
                  <pubid idtype="pmcid">2447777</pubid>
                  <pubid idtype="pmpid" link="fulltext">18483080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Identification of BHB splicing motifs in intron-containing tRNAs from 18 archaea: evolutionary implications</p>
            </title>
            <aug>
               <au>
                  <snm>Marck</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Grosjean</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>RNA</source>
            <pubdate>2003</pubdate>
            <volume>9</volume>
            <fpage>1516</fpage>
            <lpage>1531</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1261/rna.5132503</pubid>
                  <pubid idtype="pmcid">1370505</pubid>
                  <pubid idtype="pmpid" link="fulltext">14624007</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Functional importance of Crenarchaea-specific extra-loop revealed by an X-ray structure of a heterotetrameric crenarchaeal splicing endonuclease</p>
            </title>
            <aug>
               <au>
                  <snm>Yoshinari</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shiba</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Inaoka</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Itoh</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kurisu</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Harada</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2009</pubdate>
            <volume>37</volume>
            <fpage>4787</fpage>
            <lpage>4798</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/gkp506</pubid>
                  <pubid idtype="pmpid" link="fulltext">19515941</pubid>
                  <pubid idtype="pmcid">2724299</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>A korarchaeal genome reveals insights into the evolution of the Archaea</p>
            </title>
            <aug>
               <au>
                  <snm>Elkins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Podar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Makarova</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Wolf</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Randau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Hedlund</snm>
                  <fnm>BP</fnm>
               </au>
               <au>
                  <snm>Brochier-Armanet</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kunin</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lapidus</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Goltsman</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Barry</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Hugenholtz</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kyrpides</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wanner</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Keller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stetter</snm>
                  <fnm>KO</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2008</pubdate>
            <volume>105</volume>
            <fpage>8102</fpage>
            <lpage>8107</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0801980105</pubid>
                  <pubid idtype="pmcid">2430366</pubid>
                  <pubid idtype="pmpid" link="fulltext">18535141</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>A genomic analysis of the archaeal system <it>Ignicoccus hospitalis </it>&#8211; <it>Nanoarchaeum equitans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Podar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Makarova</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Elkins</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Ivanova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wall</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Lykidis</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mavromatis</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hudson</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Deciu</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hutchison</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Eads</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fernandes</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Szeto</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Lapidus</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kyrpides</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Saier</snm>
                  <fnm>MH</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Rachel</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Huber</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Eisen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Keller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stetter</snm>
                  <fnm>KO</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>R158</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/gb-2008-9-11-r158</pubid>
                  <pubid idtype="pmcid">2614490</pubid>
                  <pubid idtype="pmpid" link="fulltext">19000309</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Structural characterization of the catalytic subunit of a novel RNA splicing endonuclease</p>
            </title>
            <aug>
               <au>
                  <snm>Calvin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2005</pubdate>
            <volume>353</volume>
            <fpage>952</fpage>
            <lpage>960</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jmb.2005.09.035</pubid>
                  <pubid idtype="pmpid" link="fulltext">16219321</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Coevolution of tRNA intron motifs and tRNA endonuclease architecture in Archaea</p>
            </title>
            <aug>
               <au>
                  <snm>Tocchini-Valentini</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Fruscoloni</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tocchini-Valentini</snm>
                  <fnm>GP</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <fpage>15418</fpage>
            <lpage>15422</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0506750102</pubid>
                  <pubid idtype="pmcid">1266117</pubid>
                  <pubid idtype="pmpid" link="fulltext">16221764</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>The heteromeric Nanoarchaeum equitans splicing endonuclease cleaves noncanonical bulge-helix-bulge motifs of joined tRNA halves</p>
            </title>
            <aug>
               <au>
                  <snm>Randau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Calvin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yuan</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Podar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>S&#246;ll</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <fpage>17934</fpage>
            <lpage>17939</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0509197102</pubid>
                  <pubid idtype="pmcid">1312423</pubid>
                  <pubid idtype="pmpid" link="fulltext">16330750</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Structure, function, and evolution of the tRNA endonucleases of Archaea: an example of subfunctionalization</p>
            </title>
            <aug>
               <au>
                  <snm>Tocchini-Valentini</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>Fruscoloni</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tocchini-Valentini</snm>
                  <fnm>GP</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <fpage>8933</fpage>
            <lpage>8938</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0502350102</pubid>
                  <pubid idtype="pmcid">1157037</pubid>
                  <pubid idtype="pmpid" link="fulltext">15937113</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Comprehensive analysis of archaeal tRNA genes reveals rapid increase of tRNA introns in the order thermoproteales</p>
            </title>
            <aug>
               <au>
                  <snm>Sugahara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kikuta</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Fujishima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yachie</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kanai</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2008</pubdate>
            <volume>25</volume>
            <fpage>2709</fpage>
            <lpage>2716</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msn216</pubid>
                  <pubid idtype="pmpid" link="fulltext">18832079</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Ribosomal RNA introns in archaea and evidence for RNA conformational changes associated with splicing</p>
            </title>
            <aug>
               <au>
                  <snm>Kjems</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1991</pubdate>
            <volume>88</volume>
            <fpage>439</fpage>
            <lpage>443</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.88.2.439</pubid>
                  <pubid idtype="pmcid">50826</pubid>
                  <pubid idtype="pmpid">1899138</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Distribution of 16S rRNA introns among the family Thermoproteaceae and their evolutionary implications</p>
            </title>
            <aug>
               <au>
                  <snm>Itoh</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nomura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sako</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Extremophiles</source>
            <pubdate>2003</pubdate>
            <volume>7</volume>
            <fpage>229</fpage>
            <lpage>233</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12768454</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Multiple variants of the archaeal DNA rudivirus SIRV1 in a single host and a novel mechanism of genomic variation</p>
            </title>
            <aug>
               <au>
                  <snm>Peng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Kessler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Phan</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Prangishvili</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Microbiol</source>
            <pubdate>2004</pubdate>
            <volume>54</volume>
            <fpage>366</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-2958.2004.04287.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15469509</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Reconstitution of archaeal H/ACA small ribonucleoprotein complexes active in pseudouridylation</p>
            </title>
            <aug>
               <au>
                  <snm>Charpentier</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Branlant</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <fpage>3133</fpage>
            <lpage>3144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/gki630</pubid>
                  <pubid idtype="pmcid">1142404</pubid>
                  <pubid idtype="pmpid" link="fulltext">15933208</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Evidence of mRNA-mediated intron loss in the human-pathogenic fungus <it>Cryptococcus neoformans</it></p>
            </title>
            <aug>
               <au>
                  <snm>Stajich</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Dietrich</snm>
                  <fnm>FS</fnm>
               </au>
            </aug>
            <source>Eukaryot Cell</source>
            <pubdate>2006</pubdate>
            <volume>5</volume>
            <fpage>789</fpage>
            <lpage>793</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/EC.5.5.789-793.2006</pubid>
                  <pubid idtype="pmcid">1459680</pubid>
                  <pubid idtype="pmpid" link="fulltext">16682456</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action</p>
            </title>
            <aug>
               <au>
                  <snm>Makarova</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Grishin</snm>
                  <fnm>NV</fnm>
               </au>
               <au>
                  <snm>Shabalina</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Wolf</snm>
                  <fnm>YI</fnm>
               </au>
               <au>
                  <snm>Koonin</snm>
                  <fnm>EV</fnm>
               </au>
            </aug>
            <source>Biol Direct</source>
            <pubdate>2006</pubdate>
            <volume>1</volume>
            <fpage>7</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1186/1745-6150-1-7</pubid>
                  <pubid idtype="pmcid">1462988</pubid>
                  <pubid idtype="pmpid" link="fulltext">16545108</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>RNA-guided RNA modification: functional organization of the archaeal H/ACA RNP</p>
            </title>
            <aug>
               <au>
                  <snm>Baker</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Youssef</snm>
                  <fnm>OA</fnm>
               </au>
               <au>
                  <snm>Chastkofsky</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Dy</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Terns</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Terns</snm>
                  <fnm>MP</fnm>
               </au>
            </aug>
            <source>Genes Dev</source>
            <pubdate>2005</pubdate>
            <volume>19</volume>
            <fpage>1238</fpage>
            <lpage>1248</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1101/gad.1309605</pubid>
                  <pubid idtype="pmcid">1132009</pubid>
                  <pubid idtype="pmpid" link="fulltext">15870259</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Formation of the conserved pseudouridine at position 55 in archaeal tRNA</p>
            </title>
            <aug>
               <au>
                  <snm>Roovers</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hale</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tricot</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Terns</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Terns</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Grosjean</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Droogmans</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2006</pubdate>
            <volume>34</volume>
            <fpage>4293</fpage>
            <lpage>4301</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/gkl530</pubid>
                  <pubid idtype="pmcid">1616971</pubid>
                  <pubid idtype="pmpid" link="fulltext">16920741</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>An RNA model system for investigation of pseudouridine stabilization of the codon-anticodon interaction in tRNA<sup>Lys</sup>, tRNA<sup>His </sup>and tRNA<sup>Tyr</sup></p>
            </title>
            <aug>
               <au>
                  <snm>Davis</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Veltri</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Nielsen</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Biomol Struct Dyn</source>
            <pubdate>1998</pubdate>
            <volume>15</volume>
            <fpage>1121</fpage>
            <lpage>1132</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9669557</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Physiological analysis of the role of truB in Escherichia coli: a role for tRNA modification in extreme temperature resistance</p>
            </title>
            <aug>
               <au>
                  <snm>Kinghorn</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>O'Byrne</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Booth</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Stansfield</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Microbiology</source>
            <pubdate>2002</pubdate>
            <volume>148</volume>
            <fpage>3511</fpage>
            <lpage>3520</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12427942</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Evolutionary appearance of genes encoding proteins associated with box H/ACA snoRNAs: cbf5p in <it>Euglena gracilis</it>, an early diverging eukaryote, and candidate Gar1p and Nop10p homologs in archaebacteria</p>
            </title>
            <aug>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gray</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2000</pubdate>
            <volume>28</volume>
            <fpage>2342</fpage>
            <lpage>2352</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/nar/28.12.2342</pubid>
                  <pubid idtype="pmcid">102724</pubid>
                  <pubid idtype="pmpid" link="fulltext">10871366</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>The genome of <it>Sulfolobus acidocaldarius</it>, a model organism of the Crenarchaeota</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Br&#252;gger</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Skovgaard</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Redder</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>She</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Torarinsson</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Greve</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Awayez</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zibat</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Klenk</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>2005</pubdate>
            <volume>187</volume>
            <fpage>4992</fpage>
            <lpage>4999</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/JB.187.14.4992-4999.2005</pubid>
                  <pubid idtype="pmcid">1169522</pubid>
                  <pubid idtype="pmpid" link="fulltext">15995215</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Gene decay in archaea</p>
            </title>
            <aug>
               <au>
                  <snm>van Passel</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Smillie</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Ochman</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Archaea</source>
            <pubdate>2007</pubdate>
            <volume>2</volume>
            <fpage>137</fpage>
            <lpage>143</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1155/2007/165723</pubid>
                  <pubid idtype="pmcid">2686384</pubid>
                  <pubid idtype="pmpid" link="fulltext">17350934</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p><it>Sulfolobus </it>genomes: mechanisms of rearrangement and change</p>
            </title>
            <aug>
               <au>
                  <snm>Br&#252;gger</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Peng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
            </aug>
            <source>Archaea. Evolution, physiology and molecular biology</source>
            <publisher>Blackwell Publishing, Oxford</publisher>
            <pubdate>2006</pubdate>
            <fpage>95</fpage>
            <lpage>104</lpage>
         </bibl>
         <bibl id="B51">
            <title>
               <p>SPLITS: a new program for predicting split and intron-containing tRNA genes at the genome level</p>
            </title>
            <aug>
               <au>
                  <snm>Sugahara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yachie</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sekine</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Soma</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Matsui</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Tomita</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kanai</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>In Silico Biol</source>
            <pubdate>2006</pubdate>
            <volume>6</volume>
            <fpage>411</fpage>
            <lpage>418</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">17274770</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Complete genome sequence of an aerobic hyper-thermophilic crenarchaeon, <it>Aeropyrum pernix </it>K1</p>
            </title>
            <aug>
               <au>
                  <snm>Kawarabayasi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Horikawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Haikawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Jin-no</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takahashi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sekine</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ankai</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kosugi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hosoyama</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fukui</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nagai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nishijima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakazawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Takamiya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Masuda</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Funahashi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kudoh</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kushida</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Oguchi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Aoki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kubota</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nomura</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sako</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kikuchi</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>DNA Res</source>
            <pubdate>1999</pubdate>
            <volume>6</volume>
            <fpage>83</fpage>
            <lpage>101</lpage>
            <note>145&#8211;152</note>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/dnares/6.2.83</pubid>
                  <pubid idtype="pmpid" link="fulltext">10382966</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>The complete genome of the crenarchaeon <it>Sulfolobus solfataricus </it>P2</p>
            </title>
            <aug>
               <au>
                  <snm>She</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Singh</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Confalonieri</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zivanovic</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Allard</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Awayez</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Chan-Weiher</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Clausen</snm>
                  <fnm>IG</fnm>
               </au>
               <au>
                  <snm>Curtis</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>De Moors</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Erauso</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Fletcher</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gordon</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Heikamp-de Jong</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Jeffries</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Kozera</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Medina</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Peng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Thi-Ngoc</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Redder</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Schenk</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Theriault</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tolstrup</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Charlebois</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Doolittle</snm>
                  <fnm>WF</fnm>
               </au>
               <au>
                  <snm>Duguet</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gaasterland</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Garrett</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Ragan</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Sensen</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Oost</snm>
                  <mnm>Van der</mnm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>7835</fpage>
            <lpage>7840</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.141222098</pubid>
                  <pubid idtype="pmcid">35428</pubid>
                  <pubid idtype="pmpid" link="fulltext">11427726</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Complete genome sequence of an aerobic thermoacidophilic crenarchaeon, <it>Sulfolobus tokodaii </it>strain7</p>
            </title>
            <aug>
               <au>
                  <snm>Kawarabayasi</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Horikawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jin-no</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takahashi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sekine</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Baba</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ankai</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kosugi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hosoyama</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Fukui</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nagai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nishijima</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Otsuka</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nakazawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Takamiya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kato</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yoshizawa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kudoh</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamazaki</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kushida</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Oguchi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Aoki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Masuda</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yanagii</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yamagishi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Oshima</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kikuchi</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>DNA Res</source>
            <pubdate>2001</pubdate>
            <volume>8</volume>
            <fpage>123</fpage>
            <lpage>140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/dnares/8.4.123</pubid>
                  <pubid idtype="pmpid" link="fulltext">11572479</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Genome sequence of the hyperthermophilic crenarchaeon <it>Pyrobaculum aerophilum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Fitz-Gibbon</snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Ladner</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>UJ</fnm>
               </au>
               <au>
                  <snm>Stetter</snm>
                  <fnm>KO</fnm>
               </au>
               <au>
                  <snm>Simon</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Miller</snm>
                  <fnm>JH</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>984</fpage>
            <lpage>989</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.241636498</pubid>
                  <pubid idtype="pmcid">117417</pubid>
                  <pubid idtype="pmpid" link="fulltext">11792869</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Genomic analysis of the uncultivated marine crenarchaeote <it>Cenarchaeum symbiosum</it></p>
            </title>
            <aug>
               <au>
                  <snm>Hallam</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Konstantinidis</snm>
                  <fnm>KT</fnm>
               </au>
               <au>
                  <snm>Putnam</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Schleper</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sugahara</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Preston</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>de la Torre</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>DeLong</snm>
                  <fnm>EF</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2006</pubdate>
            <volume>103</volume>
            <fpage>18296</fpage>
            <lpage>18301</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1073/pnas.0608549103</pubid>
                  <pubid idtype="pmcid">1643844,1643844</pubid>
                  <pubid idtype="pmpid" link="fulltext">17114289</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Boxshade server</p>
            </title>
            <url>http://www.ch.embnet.org/software/BOX_form.html</url>
         </bibl>
      </refgrp>
   </bm>
</art>

