<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-8-58</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Phylogenetic position of the langur genera <it>Semnopithecus </it>and <it>Trachypithecus </it>among Asian colobines, and genus affiliations of their species groups</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Osterholz</snm>
               <fnm>Martin</fnm>
               <insr iid="I1"/>
               <email>mosterh@gwdg.de</email>
            </au>
            <au id="A2">
               <snm>Walter</snm>
               <fnm>Lutz</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>lwalter@gwdg.de</email>
            </au>
            <au id="A3" ca="yes">
               <snm>Roos</snm>
               <fnm>Christian</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>croos@dpz.eu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Primate Genetics, German Primate Center, Kellnerweg 4, 37077 Goettingen, Germany</p>
            </ins>
            <ins id="I2">
               <p>Gene Bank of Primates, German Primate Center, Kellnerweg 4, 37077 Goettingen, Germany</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>58</fpage>
         <url>http://www.biomedcentral.com/1471-2148/8/58</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18298809</pubid>
               <pubid idtype="doi">10.1186/1471-2148-8-58</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>18</day>
               <month>9</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>25</day>
               <month>2</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>25</day>
               <month>2</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Osterholz et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The evolutionary history of the Asian colobines is less understood. Although monophyly of the odd-nosed monkeys was recently confirmed, the relationships among the langur genera <it>Presbytis</it>, <it>Semnopithecus </it>and <it>Trachypithecus </it>and their position among Asian colobines remained unclear. Moreover, in <it>Trachypithecus </it>various species groups are recognized, but their affiliations are still disputed. To address these issues, mitochondrial and Y chromosomal sequence data were phylogenetically related and combined with presence/absence analyses of retroposon integrations.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>The analysed 5 kb fragment of the mitochondrial genome allows no resolution of the phylogenetic relationships among langur genera, but five retroposon integrations were detected which link <it>Trachypithecus </it>and <it>Semnopithecus</it>. According to Y chromosomal data and a 573 bp fragment of the mitochondrial cytochrome b gene, a common origin of the species groups <it>T</it>. [<it>cristatus</it>], <it>T</it>. [<it>obscurus</it>] and <it>T</it>. [<it>francoisi</it>] and their reciprocal monophyly is supported, which is also underpinned by an orthologous retroposon insertion. <it>T</it>. [<it>vetulus</it>] clusters within <it>Semnopithecus</it>, which is confirmed by two retroposon integrations. Moreover, this species group is paraphyletic, with <it>T. vetulus </it>forming a clade with the Sri Lankan, and <it>T. johnii </it>with the South Indian form of <it>S. entellus</it>. Incongruence between gene trees was detected for <it>T</it>. [<it>pileatus</it>], in that Y chromosomal data link it with <it>T</it>. [<it>cristatus</it>], <it>T</it>. [<it>obscurus</it>] and <it>T</it>. [<it>francoisi</it>], whereas mitochondrial data affiliates it with the <it>Semnopithecus </it>clade.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Neither relationships among the three langur genera nor their position within Asian colobines can be settled with 5 kb mitochondrial sequence data, but retroposon integrations confirm at least a common origin of <it>Semnopithecus </it>and <it>Trachypithecus</it>. According to Y chromosomal and 573 bp mitochondrial sequence data, <it>T</it>. [<it>cristatus</it>], <it>T</it>. [<it>obscurus</it>] and <it>T</it>. [<it>francoisi</it>] represent true members of the genus <it>Trachypithecus</it>, whereas <it>T</it>. [<it>vetulus</it>] clusters within <it>Semnopithecus</it>. Due to paraphyly of <it>T</it>. [<it>vetulus</it>] and polyphyly of <it>Semnopithecus</it>, a split of the genus into three species groups (<it>S. entellus </it>- North India, <it>S. entellus </it>- South India + <it>T. johnii</it>, <it>S. entellus </it>- Sri Lanka + <it>T. vetulus</it>) seems to be appropriate. T. [<it>pileatus</it>] posses an intermediate position between both genera, indicating that the species group might be the result of ancestral hybridization.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The Old World monkeys are traditionally divided into the two subfamilies Cercopithecinae and Colobinae, which differ from each other by numerous morphological, behavioural and ecological characteristics <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>. While detailed information on the evolutionary history of cercopithecines (baboons, mangabeys, macaques and guenons) is at hand, knowledge on colobines is still scarce. Although some molecular studies <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp> exist, they mainly focus on relationships within genera or species groups and not on the general phylogeny of the subfamily. Recently, a first mitochondrial phylogeny of colobine genera was established <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, which confirmed some previous assumptions, but also led to confusions, calling for further research to definitively elucidate their evolutionary history.</p>
         <p>Based on distribution and morphology, the colobines are traditionally divided into an African and an Asian clade <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>, while Asian colobines are more diverse than their African relatives. Hence, the Asian forms are further split into the odd-nosed monkey (<it>Pygathrix, Rhinopithecus, Nasalis, Simias</it>) and langur (<it>Presbytis, Trachypithecus, Semnopithecus</it>) groups, which are both believed to be monophyletic. Accordingly, langurs were originally combined in the single genus <it>Presbytis </it><abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr></abbrgrp> or <it>Semnopithecus </it><abbrgrp><abbr bid="B18">18</abbr></abbrgrp>, but based on neonatal colouration and cranial morphology, they were split into the three genera <it>Semnopithecus, Trachypithecus </it>and <it>Presbytis </it><abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, and a fourth genus (<it>Kasi</it>) was added <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Alternatively, <it>Semnopithecus </it>was separated from <it>Presbytis</it>, with <it>Trachypithecus </it>forming a subgenus of the former <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>, but recent classifications use a subdivision of langurs into the three genera <it>Presbytis, Trachypithecus </it>and <it>Semnopithecus </it><abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>.</p>
         <p>Within the different langur genera, several species are recognized, which are lumped into species groups due to similar fur colouration, behaviour, ecology or distribution. With five species groups (<it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>francoisi</it>], <it>T</it>. [<it>cristatus</it>], <it>T</it>. [<it>pileatus</it>] and <it>T</it>. [<it>vetulus</it>]) <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, the genus <it>Trachypithecus </it>is the most diverse of all langurs and posses also the widest distribution, ranging from South India and Sri Lanka through mainland Southeast Asia to the Sundaland (Fig. <figr fid="F1">1</figr>, Fig. <figr fid="F2">2</figr>). Although all of them are morphologically similar, <it>T</it>. [<it>vetulus</it>] was sometimes separated in its own genus <it>Kasi </it><abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, and recent mitochondrial sequence data indicate a closer affiliation of <it>T</it>. [<it>vetulus</it>] and <it>T</it>. [<it>pileatus</it>] to <it>Semnopithecus </it>than to <it>Trachypithecus </it><abbrgrp><abbr bid="B7">7</abbr><abbr bid="B9">9</abbr></abbrgrp>. Accordingly, the two <it>T</it>. [<it>vetulus</it>] members were recognized as species of <it>Semnopithecus </it><abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. In contrast to <it>Trachypithecus</it>, the genus <it>Semnopithecus </it>is restricted to the Indian subcontinent (Fig. <figr fid="F1">1</figr>) and traditionally regarded as monotypic with the only species <it>S. entellus </it><abbrgrp><abbr bid="B3">3</abbr><abbr bid="B27">27</abbr></abbrgrp>, although recently several subspecies were elevated to species status <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The third langur genus, <it>Presbytis</it>, includes several species, which occur solely in the Sundaland, but are not lumped into distinct species groups <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Distribution of the genus <it>Semnopithecus </it>and <it>Trachypithecus </it>[<it>obscurus</it>]</p>
            </caption>
            <text>
               <p><b>Distribution of the genus <it>Semnopithecus </it>and <it>Trachypithecus </it>[<it>obscurus</it>]</b>. Genus affiliations and species groups after Groves [4].</p>
            </text>
            <graphic file="1471-2148-8-58-1"/>
         </fig>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Distribution of the <it>Trachypithecus </it>species groups <it>T</it>. [<it>vetulus</it>], <it>T</it>. [<it>pileatus</it>], <it>T</it>. [<it>francoisi</it>] and <it>T</it>. [<it>cristatus</it>]</p>
            </caption>
            <text>
               <p><b>Distribution of the <it>Trachypithecus </it>species groups <it>T</it>. [<it>vetulus</it>], <it>T</it>. [<it>pileatus</it>], <it>T</it>. [<it>francoisi</it>] and <it>T</it>. [<it>cristatus</it>]</b>. Genus affiliations and species groups after Groves [4].</p>
            </text>
            <graphic file="1471-2148-8-58-2"/>
         </fig>
         <p>The phylogenetic relationships among the different Asian colobine genera are disputed. Although a common origin of the odd-nosed monkeys was recently confirmed <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, evidence for monophyly of its putative sister clade, the langur group, is still lacking. Moreover, available data depict <it>Trachypithecus </it>and <it>Presbytis </it>as sister taxa to the exclusion of <it>Semnopithecus </it><abbrgrp><abbr bid="B14">14</abbr></abbrgrp>, which contradicts with traditional classifications, in which <it>Trachypithecus </it>and <it>Semnopithecus </it>are believed to form a clade to the exclusion of <it>Presbytis </it><abbrgrp><abbr bid="B4">4</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. These findings raise the question of what positions the langur genera occupy among Asian colobines and whether the langurs form a monophyletic clade in general. Moreover, the affiliations of different <it>Trachypithecus </it>species groups, especially <it>T</it>. [<it>vetulus</it>] and <it>T</it>. [<it>pileatus</it>], are disputed, and hence, led to different classifications. Currently, only few genetic data are available <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B9">9</abbr><abbr bid="B28">28</abbr></abbrgrp>, so that further information from other markers is required to definitively establish their relationships.</p>
         <p>To address all these issues, mitochondrial and Y chromosomal sequence data were phylogenetically related and combined with presence/absence analysis of retroposon integrations. This approach was used to simultaneously analyse paternal-, maternal- and biparental-inherited markers, which allow the detection of incongruence between different gene trees indicating possible hybridization or introgression events between different lineages <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. To determine the phylogenetic position of the langur genera among Asian colobines, a 5 kb fragment of the mitochondrial genome was sequenced from eight colobine genera, and combined with presence/absence analysis of retroposon integrations. Retroposon insertion events are nearly homoplasy-free and precise excision of elements is highly unlikely <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. Accordingly, retroposon insertions are powerful informative markers, which were already successfully applied to elucidate phylogenetic relationships in various primate lineages <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr></abbrgrp>. To study relationships among different langur species groups and their genus affiliations, a 573 bp fragment of the mitochondrial cytochrome b gene and a 777 bp portion of the SRY (sex-determining region, Y chromosome) gene was sequenced from at least one representative per species group, and complemented with retroposon analysis.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Genus level phylogeny</p>
            </st>
            <p>To elucidate the phylogenetic relationships among the different langur genera and their position among Asian colobines, mitochondrial sequence studies were combined with presence/absence analysis of retroposon insertions.</p>
            <p>The herein analysed 5 kb fragment of the mitochondrial genome was assembled from sequences derived from 1&#8211;2 kb long and partly overlapping PCR products, whereby no inconsistencies in overlapping sequence fragments were detected. As template material, mainly DNA extracted from feces was used, which minimizes the amplification of nuclear pseudogenes <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>, and comparisons of the data with sequences already deposited at GenBank revealed only intra-species or -generic variation, indicating that no nuclear pseudogenes were amplified.</p>
            <p>To determine the phylogenetic relationships among analysed genera, tree reconstructions were conducted with different algorithms, which all led to the same tree topology (Fig. <figr fid="F3">3</figr>). Moreover, most relationships are significantly supported and congruent with previous classifications <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>, indicating the reliability of the data set. In detail, the reconstructions confirm relationships among cercopithecine genera (<it>Macaca, Papio, Chlorocebus</it>), and reciprocal monophyly of cercopithecines and colobines, as well as of African and Asian colobines. Within the Asian clade, relationships are not resolved, although at least a common origin of the odd-nosed monkeys is depicted. Neither the assumed monophyly of the langur genera, nor the expected close affinity of <it>Trachypithecus </it>and <it>Semnopithecus </it>or the recently indicated sister grouping of <it>Trachypithecus </it>and <it>Presbytis </it><abbrgrp><abbr bid="B14">14</abbr></abbrgrp> can be verified with significance. Moreover, all alternative tree topologies, in which the three langur genera were regarded as monophyletic, or variously recognized as sister clades to each other, to the odd-nosed monkey clade, or even as basal among Asian colobines, were not rejected (P = 0.097 &#8211; 0.776). Accordingly, an unresolved polytomy among the three langur genera and the odd-nosed monkey clade may best reflect the relationships among Asian colobines based on the mitochondrial data.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Phylogenetic relationships among colobines and related genera based on mitochondrial data</p>
               </caption>
               <text>
                  <p><b>Phylogenetic relationships among colobines and related genera based on mitochondrial data</b>. Numbers on nodes indicate support values >80% (first: ML, second: NJ, third: MP).</p>
               </text>
               <graphic file="1471-2148-8-58-3"/>
            </fig>
            <p>Several retroposon insertions were detected, which provide insights into the branching pattern of colobines (Fig. <figr fid="F4">4</figr>). Together with seven already published integrations <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, now 14 loci confirm monophyly of the Asian colobines to the exclusion of the African genus <it>Colobus</it>. Among Asian colobines, one insertion indicates a common origin of the odd-nosed monkeys, which is verified by three further loci <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. Most prominent are the five retroposon integrations, which confirm a sister grouping of <it>Trachypithecus </it>and <it>Semnopithecus</it>. No loci were detected, which link <it>Presbytis </it>either with the other two langur genera or the odd-nosed monkeys.</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Phylogenetic relationships among Asian colobine genera based on retroposon integrations</p>
               </caption>
               <text>
                  <p><b>Phylogenetic relationships among Asian colobine genera based on retroposon integrations</b>. Dark dots represent new generated data, whereas light dots refer to already published data [37]. Numbers in dots indicate single integration events.</p>
               </text>
               <graphic file="1471-2148-8-58-4"/>
            </fig>
            <p>Although in general the mitochondrial data are suitable to elucidate relationships among the different genera, as indicated by the correct and significantly supported branching patterns among all other studied genera, the relationships among the langurs are unresolved, which is concordant with previous results <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. In contrast, the presence/absence analysis of retroposon integrations provides evidence for a monophyletic odd-nosed monkey clade and a common origin of <it>Trachypithecus </it>and <it>Semnopithecus</it>, which is in agreement with morphological hypotheses <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. Regardless which markers were used, the phylogenetic position of <it>Presbytis </it>among Asian colobines and accordingly the unity of the langurs remains unclear and needs further investigations.</p>
         </sec>
         <sec>
            <st>
               <p>Species group phylogeny</p>
            </st>
            <p>In order to settle affiliations among the different <it>Trachypithecus </it>species groups and their members, mitochondrial and Y chromosomal sequence data were combined with information on retroposon integrations.</p>
            <p>The mitochondrial phylogeny was established on the basis of 573 bp long cytochrome b gene sequences, generated from most species recognized in the genus and its sister genus <it>Semnopithecus</it>. In all tree reconstructions, identical relationships were obtained, with most branches being significantly supported (Fig. <figr fid="F5">5a</figr>). Accordingly, the different species groups are divided into two major groups, with one including solely groups of the genus <it>Trachypithecus</it>, whereas the second one includes representatives of <it>Trachypithecus </it>and <it>Semnopithecus</it>. In the mixed clade, <it>T</it>. [<it>vetulus</it>] and <it>T</it>. [<it>pileatus</it>] members are lumped together with <it>S. entellus</it>. Whereby <it>T</it>. [<it>pileatus</it>] is monophyletic, the members of <it>T</it>. [<it>vetulus</it>] are paraphyletic, with <it>T. vetulus </it>forming a sister clade to <it>S. entellus </it>from Sri Lanka, and <it>T. johnii </it>with <it>S. entellus </it>from South India. Furthermore, a fourth lineage in the mixed clade was detected, which is represented by <it>S. entellus </it>from North India. In contrast, the three species groups (<it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>francoisi</it>], <it>T</it>. [<it>cristatus</it>]) in the clade comprising solely <it>Trachypithecus </it>groups are all monophyletic. Alternative relationships, in which <it>T</it>. [<it>vetulus</it>] is recognized as monophyletic, either <it>T</it>. [<it>vetulus</it>] or <it>T</it>. [<it>pileatus</it>] belongs to <it>Trachypithecus </it>or even both are members of <it>Trachypithecus</it>, were tested, but all of them were rejected (P &lt; 0.05).</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Phylogenetic relationships among <it>Semnopithecus </it>and <it>Trachypithecus </it>species groups based on a) mitochondrial data, b) Y chromosomal data, and c) retroposon integrations</p>
               </caption>
               <text>
                  <p><b>Phylogenetic relationships among <it>Semnopithecus </it>and <it>Trachypithecus </it>species groups based on a) mitochondrial data, b) Y chromosomal data, and c) retroposon integrations</b>. Numbers on nodes indicate support values (first: ML, second: NJ, third: MP), and boxed species belong to a species group, with species in bold giving the name of the group.</p>
               </text>
               <graphic file="1471-2148-8-58-5"/>
            </fig>
            <p>With some exceptions, the Y chromosomal data provide a similar picture (Fig. <figr fid="F5">5b</figr>), but due to the low number of polymorphic sites, support values are in general not as high as in the mitochondrial tree. According to the reconstructions, the species groups are divided into two major clades, with one comprising <it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>cristatus</it>], <it>T</it>. [<it>francoisi</it>] and <it>T</it>. [<it>pileatus</it>], and the other, <it>T</it>. [<it>vetulus</it>] and <it>Semnopithecus</it>. Relationships among the latter are not resolved. All alternative tree topologies, in which either <it>T</it>. [<it>vetulus</it>] belongs to <it>Trachypithecus </it>or <it>T. pileatus </it>groups with <it>Semnopithecus</it>, were rejected (P &lt; 0.05).</p>
            <p>Retroposon insertions further deepened our knowledge on the species group relationships. Altogether, three informative integrations were analysed (Fig. <figr fid="F5">5c</figr>), with one occurring in <it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>cristatus</it>] and <it>T</it>. [<it>francoisi</it>], and the other two in <it>T</it>. [<it>vetulus</it>] and <it>Semnopithecus</it>. Interestingly, all three integrations are absent in <it>T. pileatus</it>.</p>
            <p>With the exception of the varying position of <it>T</it>. [<it>pileatus</it>], the affiliations of the remaining species groups are congruent among different gene trees. Accordingly, all analysed markers relate <it>T</it>. [<it>vetulus</it>] with <it>Semnopithecus</it>, indicating that this species group is a real member of the genus <it>Semnopithecus </it>and not of <it>Trachypithecus </it>as assumed by morphological similarities <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. These similarities may be the results of adaptations to similar ecological conditions (<it>Semnopithecus </it>is semi-terrestrial and lives in deciduous forest, whereas <it>Trachypithecus </it>including <it>T</it>. [<it>vetulus</it>] is arboreal and occurs in wet evergreen forests). Although the Y chromosomal data allow no resolution within the <it>Semnopithecus </it>&#8211; <it>T</it>. [<it>vetulus</it>] clade, the mitochondrial data indicate paraphyly of the two <it>T</it>. [<it>vetulus</it>] species, with <it>T. vetulus </it>clustering with <it>S. entellus </it>from Sri Lanka and <it>T. johnii </it>with <it>S. entellus </it>from South India, which is concordant with their geographical distribution. These findings indicate paraphyly of <it>S. entellus</it>, whereby North Indian representatives form a further distinct lineage. Accordingly, the langurs of the Indian subcontinent should be split into three species groups, with one occurring solely on Sri Lanka, one in Southern India and a third one in Northern India, whereas the Gondavari river seems to be barrier between the latter two.</p>
            <p>Monophyly of each of <it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>cristatus</it>] and <it>T</it>. [<it>francoisi</it>] and their close affiliation is depicted in all gene trees, so that all of them can be regarded as true members of <it>Trachypithecus</it>. These findings confirm previous molecular studies <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B13">13</abbr></abbrgrp> and are in general agreement with recent classifications <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B26">26</abbr></abbrgrp>.</p>
            <p>The only discrepancies between different gene trees were obtained for <it>T</it>. [<it>pileatus</it>]. Whereas the mitochondrial data link the species group with <it>Semnopithecus </it>and <it>T</it>. [<it>vetulus</it>], the Y chromosomal data affiliates it with <it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>cristatus</it>] and <it>T</it>. [<it>francoisi</it>]. These findings might be explained by incomplete lineage sorting of ancestral mitochondrial or Y chromosomal haplotypes. Accordingly, the ancestor of <it>Trachypithecus, Semnopithecus </it>and <it>T</it>. [<it>pileatus</it>] carried multiple DNA lineages with one lineage being randomly fixed in two taxa, but not in the third. Alternatively, the varying position of <it>T</it>. [<it>pileatus</it>] in different gene trees might be explained by past hybridization between <it>Semnopithecus </it>and <it>Trachypithecus</it>. As depicted by the three retroposon insertions, this putative hybridization event would have occurred between ancestral forms of <it>Semnopithecus </it>and <it>Trachypithecus</it>, before both genera diverged into distinct species groups. The hybridization hypothesis is also supported by some intermediate morphological characteristics <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> and the distribution of <it>T</it>. [<it>pileatus</it>], which is sandwiched between those of <it>Semnopithecus </it>and other <it>Trachypithecus </it>species groups (Fig. <figr fid="F1">1</figr>, Fig. <figr fid="F2">2</figr>).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>The present study provides detailed insights into the evolutionary history of Asian colobines and underpins the tremendous power of retroposon integrations as cladistic markers. Although mitochondrial data proved to be useful to elucidate and confirm several relationships among studied taxa, the data set failed to resolve the affiliations among the langur genera and to settle their position among Asian colobines. In contrast, retroposon insertions provided clear evidence for a sister grouping of <it>Semnopithecus </it>and <it>Trachypithecus</it>, but no integrations were detected, which link <it>Presbytis </it>either with the other two langur genera or with the odd-nosed monkeys, so that further research is required to solve this issue. Moreover, to definitively explain the evolutionary history of colobines, further molecular markers should be analysed, especially regarding possible discrepancies among gene trees due to hybridization or introgression, as such events are important speciation mechanisms in primates <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, and as it was possibly detected in the present study in the case of <it>T</it>. [<it>pileatus</it>].</p>
         <p>Although further investigations are necessary to fully understand the evolution of colobines, the present study provides sufficient data to revise the current classification of the genera <it>Trachypithecus </it>and <it>Semnopithecus </it>(Table <tblr tid="T1">1</tblr>). Accordingly, within <it>Trachypithecus</it>, three reciprocal monophyletic species groups (<it>T</it>. [<it>obscurus</it>], <it>T</it>. [<it>cristatus</it>] and <it>T</it>. [<it>francoisi</it>]) should be recognized, whereas <it>T</it>. [<it>vetulus</it>] should be included in <it>Semnopithecus</it>. Moreover, due to their paraphyletic origin, <it>T. vetulus </it>and <it>T. johnii </it>should not be lumped into a single species group, and <it>S. entellus </it>should not be regarded as monotypic. A classification into three species groups with one occurring in Northern India, one in Southern India and one on Sri Lanka may best reflect the evolutionary relationships among the langurs of the Indian subcontinent. However, this arrangement is tentative, because further research is required to confirm their distinctiveness not only on mitochondrial, but also on nuclear DNA level. <it>T</it>. [<it>pileatus</it>] might be the result of an ancient hybridization event between <it>Semnopithecus </it>and <it>Trachypithecus</it>, and hence, its classification is difficult. While a separation in its own distinct genus may be appropriate, we provisionally accept its traditional recognition as member of <it>Trachypithecus</it>.</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Proposed classification of <it>Semnopithecus </it>and <it>Trachypithecus </it>species based on the herein presented data.</p>
            </caption>
            <tblbdy cols="3">
               <r>
                  <c ca="left">
                     <p>
                        <b>Species group</b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>
                           <it>Semnopithecus</it>
                        </b>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <b>
                           <it>Trachypithecus</it>
                        </b>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p><it>S. entellus</it>* (North India)</p>
                  </c>
                  <c ca="left">
                     <p><it>S. entellus</it>*</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p><it>S. entellus</it>* (South India)</p>
                  </c>
                  <c ca="left">
                     <p><it>S. entellus</it>*</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>S. johnii</it>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p><it>S. entellus</it>* (Sri Lanka)</p>
                  </c>
                  <c ca="left">
                     <p><it>S. entellus</it>*</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>S. vetulus</it>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>T. pileatus**</it>
                     </p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>
                        <it>T. pileatus</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c cspan="2" ca="center">
                     <p>
                        <it>T. geei</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>T. francoisi</it>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. francoisi</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. poliocephalus</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. delacouri</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. laotum</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>T. obscurus</it>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. obscurus</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. barbei</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. phayrei</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>T. cristatus</it>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. cristatus</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. germaini</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. margarita</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>
                        <it>T. auratus</it>
                     </p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>* species/subspecies designation has to be assessed.</p>
               <p>** provisionally classified as member of <it>Trachypithecus</it>.</p>
            </tblfn>
         </tbl>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Sample collection, DNA extraction and preventing contaminations</p>
            </st>
            <p>The species analysed in this study are presented in Table <tblr tid="T2">2</tblr>. All study specimens were identified by fur colouration and other external characteristics. Hanuman langur (<it>S. entellus</it>) samples were collected only from founder animals, of which the area of capture was at least roughly known. Total genomic DNA was extracted from blood, tissue or feces using the DNeasy or Stool Mini Kits from Qiagen. When hair follicle cells were used, 1&#8211;3 hairs were directly implemented into the PCR reaction after they were washed with sterile water and 95% ethanol. To prevent contaminations, sample collection and laboratory procedures followed described standard protocols <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp>. In detail, all fecal and hair samples were collected with gloves and stored in sterile tubes or plastic bags before further processing. DNA extraction, PCR, gel extraction and sequencing was performed in separate laboratories and repeated after several months, while always only one individual per species was tested. Moreover, from most specimens two different sample types were available, which both were used as template material. Sequences from independent analyses were identical. Finally, all PCR reactions were performed with negative (distilled water) controls.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Species analysed, their origin, material type and GenBank accession numbers.</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Species</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Origin</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Material type</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>mtDNA (5 kb)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>mtDNA (573 bp)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SRY (777 bp)</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Cebus albifrons</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_002763</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Homo sapiens</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>X93334</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Pan troglodytes</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_001643</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Chlorocebus aethiops</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_007009</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Papio hamadryas</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_001992</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Macaca mulatta</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_005943</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>M. sylvanus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>NC_002764</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Colobus guereza</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Cologne Zoo</p>
                     </c>
                     <c ca="center">
                        <p>tissue, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004483</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Piliocolobus badius</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>MPI Leipzig</p>
                     </c>
                     <c ca="center">
                        <p>tissue, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004482</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Pygathrix </it>nemaeus</p>
                     </c>
                     <c ca="center">
                        <p>Cologne Zoo</p>
                     </c>
                     <c ca="center">
                        <p>tissue, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004481</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Rhinopithecus avunculus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>EPRC</p>
                     </c>
                     <c ca="center">
                        <p>tissue</p>
                     </c>
                     <c ca="center">
                        <p>EU004480</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Nasalis larvatus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Wilhelma Stuttgart</p>
                     </c>
                     <c ca="center">
                        <p>blood</p>
                     </c>
                     <c ca="center">
                        <p>EU004476</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Presbytis melalophos</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Howletts Zoo</p>
                     </c>
                     <c ca="center">
                        <p>tissue, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004479</p>
                     </c>
                     <c ca="center">
                        <p>part of 5 kb</p>
                     </c>
                     <c ca="center">
                        <p>EU004456</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>Semnopithecus entellus </it>(North India)</p>
                     </c>
                     <c ca="center">
                        <p>Dresden Zoo</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004478</p>
                     </c>
                     <c ca="center">
                        <p>part of 5 kb</p>
                     </c>
                     <c ca="center">
                        <p>EU004457</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>S. entellus </it>(South India)</p>
                     </c>
                     <c ca="center">
                        <p>Hannover Zoo</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EU004471</p>
                     </c>
                     <c ca="center">
                        <p>EU004458</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p><it>S. entellus </it>(Sri Lanka)</p>
                     </c>
                     <c ca="center">
                        <p>Krefeld Zoo</p>
                     </c>
                     <c ca="center">
                        <p>hairs</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519452</p>
                     </c>
                     <c ca="center">
                        <p>EU004459</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Trachypithecus vetulus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Bristol Zoo</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519454</p>
                     </c>
                     <c ca="center">
                        <p>EU004461</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. johnii</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Erfurt Zoo</p>
                     </c>
                     <c ca="center">
                        <p>hairs, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519453</p>
                     </c>
                     <c ca="center">
                        <p>EU004460</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. pileatus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ZMB</p>
                     </c>
                     <c ca="center">
                        <p>tissue</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EU004472</p>
                     </c>
                     <c ca="center">
                        <p>EU004462</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. geei</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AF294618</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. obscurus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Wuppertal Zoo</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>EU004477</p>
                     </c>
                     <c ca="center">
                        <p>part of 5 kb</p>
                     </c>
                     <c ca="center">
                        <p>EU004463</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. phayrei</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ZMB</p>
                     </c>
                     <c ca="center">
                        <p>tissue</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519460</p>
                     </c>
                     <c ca="center">
                        <p>EU004464</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. barbei</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519462</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. auratus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Wilhelma Stuttgart</p>
                     </c>
                     <c ca="center">
                        <p>blood</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519455</p>
                     </c>
                     <c ca="center">
                        <p>EU004468</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. cristatus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Singapore Zoo</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EF465128</p>
                     </c>
                     <c ca="center">
                        <p>EU004470</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. germaini</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>ACCB</p>
                     </c>
                     <c ca="center">
                        <p>feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519457</p>
                     </c>
                     <c ca="center">
                        <p>EU004469</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. margarita</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>GenBank</p>
                     </c>
                     <c ca="center">
                        <p>sequence</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EF465147</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. francoisi</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>Bristol Zoo</p>
                     </c>
                     <c ca="center">
                        <p>hairs, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>AY519458</p>
                     </c>
                     <c ca="center">
                        <p>EU004467</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. poliocephalus</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>EPRC</p>
                     </c>
                     <c ca="center">
                        <p>feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EU004473</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. delacouri</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>EPRC</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EU004474</p>
                     </c>
                     <c ca="center">
                        <p>EU004465</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>T. laotum</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>EPRC</p>
                     </c>
                     <c ca="center">
                        <p>blood, feces</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>EU004475</p>
                     </c>
                     <c ca="center">
                        <p>EU004466</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: ACCB &#8211; Angkor Center for Conservation of Biodiversity, Cambodia; EPRC &#8211; Endangered Primate Rescue Center, Vietnam; MPI Leipzig &#8211; Max-Planck-Institute for Evolutionary Anthropology, Leipzig, Germany; ZMB &#8211; Zoologisches Museum Berlin, Germany</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Mitochondrial sequence analysis</p>
            </st>
            <p>To determine the phylogenetic position of langur genera among Asian colobines, a ~5 kb fragment of the mitochondrial genome was sequenced from all colobine genera with the exception of <it>Simias </it>and <it>Procolobus</it>. This region spans the cytochrome b gene, the control region, the 12S rDNA and 16S rDNA, and the intermediate tRNAs. To exclude contaminations of the dataset with nuclear pseudogenes, mainly DNA extracted from feces was used as template material, and ~1&#8211;2 kb long and ~200&#8211;400 bp overlapping fragments were amplified. PCR products were generated via hot-start technique using a set of 24 primers (Table <tblr tid="T3">3</tblr>) and PCR conditions comprising a pre-denaturation step at 94&#176;C for 2 min, followed by 40 cycles at 94&#176;C for 1 min, 60&#176;C for 1 min and 72&#176;C for 1&#8211;2 min, and a final extension step at 72&#176;C for 5 min. The results of the PCR amplifications were checked on agarose gels. PCR products were cleaned with the Qiagen PCR Purification Kit and subsequently sequenced on an ABI 3100-Avant sequencer using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). To obtain a comprehensive overview on the phylogeny of colobines, the dataset was expanded with further sequences from related taxa deposited at GenBank (Table <tblr tid="T2">2</tblr>). Accordingly, the final dataset comprised 15 taxa, including eight colobines, four cercopithecines, two hominoides and a New World monkey, which was used as outgroup taxon. Sequences were aligned with ClustalW <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> and subsequently checked by eye. Gaps and poorly aligned positions were removed with the G-blocks software <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, which reduced the final dataset to 4336 bp. Based on this alignment, phylogenetic trees were constructed with the maximum-parsimony (MP), neighbor-joining (NJ) and maximum-likelihood (ML) algorithms as implemented in PAUP 4.0b10 <abbrgrp><abbr bid="B46">46</abbr></abbrgrp> and TREEPUZZLE 5.0 <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>. For MP analyses, all characters were treated as unordered and equally weighted throughout. A heuristic search was performed with the tree-bisection-reconnection (TBR) algorithm with random addition of sequences. The maximum number of trees was set to 100. NJ and ML trees were constructed with the GTR + I (= 0.2526) + &#915; (= 0.4816) model of sequence evolution as it was selected as best-fitting model under the Akaike information criterion with MODELTEST 3.06 <abbrgrp><abbr bid="B48">48</abbr></abbrgrp>. Relative support of internal nodes was performed by bootstrap analyses with 1,000 replications (MP, NJ), or by the quartet puzzling support values on the basis of 1,000 puzzling steps (ML). Finally, to evaluate the reliability of the depicted phylogenetic position of the langur genera among Asian colobines, alternative tree topologies were evaluated with the Kishino-Hasegawa <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> and Shimodaira-Hasegawa <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> tests in PAUP, both performed with full optimization and 1,000 bootstrap replications. Therefore, all three langur genera were regarded as monophyletic or variously recognized as sister clade to each other, to the odd-nosed monkey clade or even as sister clade to all other Asian colobines.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Primers for amplifying and sequencing the 5 kb mitochondrial fragment.</p>
               </caption>
               <tblbdy cols="2">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Primer*</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Sequence (5'-3')</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="2">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L14182</p>
                     </c>
                     <c ca="left">
                        <p>AAACCATCGTTGTATTTCAACTA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L14621</p>
                     </c>
                     <c ca="left">
                        <p>GAGGACAAATATCATTTTGAGG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H14886</p>
                     </c>
                     <c ca="left">
                        <p>GTAGGGGTGGAAGGGAATTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15139</p>
                     </c>
                     <c ca="left">
                        <p>CACAAATCCAAACAACAAAGCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H15246</p>
                     </c>
                     <c ca="left">
                        <p>ACCGGTTGGCTTCCAATTCA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15322</p>
                     </c>
                     <c ca="left">
                        <p>CTCCTCAAATGAACTTGCCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H15556</p>
                     </c>
                     <c ca="left">
                        <p>GCAGTAATGCACGAATTACATA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L15873</p>
                     </c>
                     <c ca="left">
                        <p>CCATCCTCCGTGAAATCAATA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H16117</p>
                     </c>
                     <c ca="left">
                        <p>TGCAGACCAGAGATAAAAGATA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L16248</p>
                     </c>
                     <c ca="left">
                        <p>GGTGTTATTTAATCCATGCTTG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H16402</p>
                     </c>
                     <c ca="left">
                        <p>TGTTTTTGGGGTTTGGCAAAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L104</p>
                     </c>
                     <c ca="left">
                        <p>TTAGCAAGATTACACATGCAAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H284</p>
                     </c>
                     <c ca="left">
                        <p>CATAGCTTAGTTAAACTTTCGTT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L501</p>
                     </c>
                     <c ca="left">
                        <p>CACTATGCTTAGCCCTAAACT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H572</p>
                     </c>
                     <c ca="left">
                        <p>AAGCTGTTGCTTGTAGTGTTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L827</p>
                     </c>
                     <c ca="left">
                        <p>AAGAGTCCAAGGAGGATTTAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H999</p>
                     </c>
                     <c ca="left">
                        <p>CCAGTACACTTACCATGTTAC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L1331</p>
                     </c>
                     <c ca="left">
                        <p>ACGAGCTACCCAAAAACAGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H1535</p>
                     </c>
                     <c ca="left">
                        <p>TAAAGAGCTGTCCCTCTTTAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L1608</p>
                     </c>
                     <c ca="left">
                        <p>TTAAGAAAGCGTTCAGCTCAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H1883</p>
                     </c>
                     <c ca="left">
                        <p>TCCTTTTACTTTTTTTAACCTTTC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>L2090</p>
                     </c>
                     <c ca="left">
                        <p>CCTGACCGTGCAAAGGTAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H2342</p>
                     </c>
                     <c ca="left">
                        <p>TCCGAGGTCACCCCAACC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H2670</p>
                     </c>
                     <c ca="left">
                        <p>ATTACCGGGCTCTGCCATC</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>*Numbers refer to positions in the <it>Macaca sylvanus </it>mitochondrial genome, and H and L refer to the heavy and light strands, respectively.</p>
               </tblfn>
            </tbl>
            <p>To determine phylogenetic affiliations of species groups, a 573 bp long fragment of the mitochondrial cytochrome b gene was analysed from all species of the different groups (Table <tblr tid="T2">2</tblr>). The generation of sequences followed laboratory methods as described <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B11">11</abbr><abbr bid="B13">13</abbr></abbrgrp>. The final alignment, which was easily generated by eye due to the absence of insertions or deletions, comprised 19 individuals including the outgroup taxon <it>Presbytis melalophos</it>. Phylogenetic trees were constructed as described above. As best-fitting model, MODELTEST selected the TIM + I (= 0.5977) + &#915; (= 2.3137) model, which was applied for NJ and ML reconstructions. As for the 5 kb fragment, several alternative tree topologies, in which <it>T</it>. [<it>vetulus</it>] is recognized as monophyletic, either <it>T</it>. [<it>vetulus</it>] or <it>T</it>. [<it>pileatus</it>] belongs to <it>Trachypithecus</it>, or even both are members of <it>Trachypithecus</it>, were tested.</p>
         </sec>
         <sec>
            <st>
               <p>Y chromosomal sequence analysis</p>
            </st>
            <p>The SRY gene was selected as it represents a single-copy gene and as it is proved to be informative in reconstructing the Y chromosomal evolutionary history of macaques <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. PCR conditions and primers were applied as described <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. To amplify the SRY gene from fecal material, two overlapping fragments were generated with published primers <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> and the newly generated internal primers 5'-TGGGCGGAGTTGAGAGGGGT-3' and 5'-TAGCGGTCCCGTTGCTGCGG-3'. The final alignment of 777 bp comprised 15 taxa representing all species groups of the genera <it>Semnopithecus </it>and <it>Trachypithecus </it>as well as <it>Presbytis melalophos</it>, which was used as outgroup. To reconstruct NJ and ML trees, the K80 model of sequence evolution, determined with MODELTEST, was used. MP trees were generated as described above. The reliability of the depicted position of <it>T</it>. [<it>vetulus</it>] and <it>T</it>. [<it>pileatus</it>] was tested in PAUP by using alternative tree topologies, in which either <it>T</it>. [<it>vetulus</it>] belongs to <it>Trachypithecus </it>or <it>T. pileatus </it>groups with <it>Semnopithecus</it>.</p>
         </sec>
         <sec>
            <st>
               <p>Retroposon analysis</p>
            </st>
            <p>Due to their high copy number and relative small size (~300 bp), the primate specific Alu elements were selected as cladistic markers. The presence or absence of Alu elements in different colobines at specific loci was tested via PCR using primers occupying the flanking region of the insertion site. Details on analysed loci, primers and studied species are listed in Table <tblr tid="T4">4</tblr>.</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Presence/absence analysis of retroposon insertions.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Locus</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Primer (5'-3')</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Presence</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Absence</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia1</p>
                     </c>
                     <c ca="left">
                        <p>AAGAATCCCAGGGAAGAACACT TTGCTGGCAAAGTGACTCCT</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia2</p>
                     </c>
                     <c ca="left">
                        <p>CCTGCCACTTCTGTCCATCT AGAACAAACACCAAGACAACAGC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia3</p>
                     </c>
                     <c ca="left">
                        <p>GCTTTGCCACATAAAGAGCTG GGTTAGGTGCAAATGGGAAAC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia4</p>
                     </c>
                     <c ca="left">
                        <p>TCAATCTTCCAGGGAAAATAAAG GAATATTAGTTGAAATATTTAGGC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia5</p>
                     </c>
                     <c ca="left">
                        <p>GACCATGGTAAGACAAATGTG GACTCAGGCTTAATTTTAAGTC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia6</p>
                     </c>
                     <c ca="left">
                        <p>CACCAAGCACAACTGTGAGG, TCTGCCATAGCCATCAGTCA</p>
                     </c>
                     <c ca="left">
                        <p>TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Asia7</p>
                     </c>
                     <c ca="left">
                        <p>CTCTTGGTTGGGGTGAAGC GATGGTTGAACAGTGAGACTTGA</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, PNEM, NLAR</p>
                     </c>
                     <c ca="left">
                        <p>CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ST1</p>
                     </c>
                     <c ca="left">
                        <p>TGATTAAAGTCAGATGAACACC GTGTAATGGGATGAAGAACAC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TVET, TDEL, TOBS, TAUR</p>
                     </c>
                     <c ca="left">
                        <p>PMEL, PNEM, NLAR</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ST2</p>
                     </c>
                     <c ca="left">
                        <p>ATACATAGCATTGACTTAACTCT GATCCTGAGCCCACTATTCT</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS</p>
                     </c>
                     <c ca="left">
                        <p>PMEL, PNEM, NLAR</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ST3</p>
                     </c>
                     <c ca="left">
                        <p>ACATCAGTGACATCAAATAAGG GAGGAAAAGATACTTTCTCATG</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS</p>
                     </c>
                     <c ca="left">
                        <p>PMEL, PNEM, NLAR</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ST4</p>
                     </c>
                     <c ca="left">
                        <p>GGATTGAGAGCAATTTTAAAAGGA GTTCACTCCCAAATCATACTTC</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS</p>
                     </c>
                     <c ca="left">
                        <p>PMEL, PNEM, NLAR, CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ST5</p>
                     </c>
                     <c ca="left">
                        <p>TGTAGCCAGGGAAGCCTCT TGGGATTTCTAATACTATGCCTTTG</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS</p>
                     </c>
                     <c ca="left">
                        <p>PMEL, PNEM, NLAR, CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>odd1</p>
                     </c>
                     <c ca="left">
                        <p>AGAAAGTCCCTCCCCAACAC AAGTTGGCAAAGTGGATTGC</p>
                     </c>
                     <c ca="left">
                        <p>PNEM, NLAR, RAVU</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TOBS, PMEL, CGUE</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>T1</p>
                     </c>
                     <c ca="left">
                        <p>GAAGATTAATACTAGAAGAATCC TTGAACTTTGATCCATGGTGC</p>
                     </c>
                     <c ca="left">
                        <p>TDEL, TOBS, TAUR</p>
                     </c>
                     <c ca="left">
                        <p>TPIL, SENT, TVET, PMEL, PNEM</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S1</p>
                     </c>
                     <c ca="left">
                        <p>CAAATTGTGGCTCCTTCAGTTA GGCAATGTACAGCTAACTCTGCT</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TVET, TJOH</p>
                     </c>
                     <c ca="left">
                        <p>TPIL, TDEL, TOBS, TAUR, PMEL, NLAR</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S2</p>
                     </c>
                     <c ca="left">
                        <p>CCCATGTGCCTTGGTTTAG GGAAGAAAGTTTGGAATGTGTG</p>
                     </c>
                     <c ca="left">
                        <p>SENT, TVET, TJOH</p>
                     </c>
                     <c ca="left">
                        <p>TPIL, TDEL, TOBS, TAUR, PMEL, NLAR</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Abbreviations: CGUE &#8211; <it>Colobus guereza</it>, NLAR &#8211; <it>Nasalis larvatus</it>, PMEL &#8211; <it>Presbytis melalophos</it>, PNEM &#8211; <it>Pygathrix nemaeus</it>, RAVU &#8211; <it>Rhinopithecus avunculus</it>, SENT &#8211; <it>Semnopithecus entellus</it>, TAUR &#8211; <it>Trachypithecus auratus</it>, TDEL &#8211; <it>T. delacouri</it>, TJOH &#8211; <it>T. johnii</it>, TOBS &#8211; <it>T. obscurus</it>, TPIL &#8211; <it>T. pileatus</it>, TVET &#8211; <it>T. vetulus</it>.</p>
               </tblfn>
            </tbl>
            <p>To detect new loci, a subtractive hybridization approach <abbrgrp><abbr bid="B52">52</abbr></abbrgrp> was performed with some modifications. As tracer and driver, different colobine genera were selected. Genomic DNA of tracer and driver was digested with RSAI (Fermentas), and subsequently, the adapters AdapA1/AdapAA1 (5'-TGTAGCGTGAAGACGACAGAAAGGGCGTGGTGCGGAGGGCGGT-3'/5'-ACCGCCCTCCG-3') and AdapA2/AdapAA2 (5'-TGTAGCGTGAAGACCTGTCTTAGGGCGTGGTGGCCAGGGCCGT-3'/5'-ACGGCCCTGGC-3') were ligated to the tracer fragments. Each of ~15 ng tracerA1 and tracerA2 were hybridized with ~1,500 ng driver for 20 h at 60&#176;C. 2 &#956;l of the hybridization result was used as template to amplify solely tracer fragments using the adapter primers A1 (5'-TGTAGCGTGAAGACGACAGAA-3') and A2 (5'-TGTAGCGTGAAGACCTGTCTT-3'). The PCR program consisted of a pre-extension step at 72&#176;C for 6 min to fill in adaptor ends, followed by 25 cycles, each with a denaturation step at 95&#176;C for 1 min, annealing at 60&#176;C for 1 min and extension at 72&#176;C for 2 min. To enrich fragments with Alu insertions, a semi-nested PCR was added using either primer A1 or A2 and the Alu-specific AluY (5'-GGAGAATGGCGTGAACCCGGGA-3') oligonueclotide. The PCR products were separated on agarose gels and fragments over 500 bp were excised from the gel. After purification, the fragments were cloned into the pGEMTeasy vector (Promega) and transformed into electro-competent TOP10 cells (Invitrogen). Bacterial clones were collected in 96-well microtiter plates and re-screened via PCR with the primers A1 or A2 and AluY. Positive clones were sequenced and analysed with REPEATMASKER and BLAST as implemented in NCBI and EMBL. Based on the generated alignments, locus-specific primers were constructed, with the forward primer occupying a region 5'-end upstream of the insertion site, which is conserved among the colobine and human or chimp sequences. Due to the absence of the 3'-end downstream sequence of the tested colobine species, reverse primers were constructed solely on the basis of human or chimp sequences. Subsequently, the presence or absence of respective Alu insertions in different colobine species was tested via PCR. The orthology of insertions was confirmed by sequencing of at least one species per genus or species group. Sequences were deposited at GenBank and are available under the accession numbers <ext-link ext-link-type="gen" ext-link-id="EU004484">EU004484</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU004537">EU004537</ext-link> and <ext-link ext-link-type="gen" ext-link-id="EU006662">EU006662</ext-link>&#8211;<ext-link ext-link-type="gen" ext-link-id="EU006692">EU006692</ext-link>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>Species names in square brackets ([]) indicate species groups.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>MO designed primers, performed parts of the laboratory work and wrote parts of the manuscript. LW wrote parts of the manuscript and performed parts of the statistical analysis. CR collected samples, designed primers, performed parts of the laboratory and statistical work and wrote parts of the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are grateful to the staff of the zoos in Cologne, Dresden, Hannover, Krefeld, Erfurt, Stuttgart, Wuppertal, Howletts, Bristol and Singapore, and to Manfred Ade (Naturhistorisches Museum Berlin, Germany), Linda Vigilant (Max-Planck-Institute of Evolutionary Anthropology, Leipzig, Germany), Kai-Olaf Kr&#252;ger (Angkor Centre for Conservation of Biodiversity, Cambodia) and Tilo Nadler (Endangered Primate Rescue Center, Vietnam) for samples. Finally, we thank Christiane Schwarz for her excellent technical assistance in the laboratory. The work was financially supported by the German Primate Center (DPZ).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <aug>
               <au>
                  <snm>Napier</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Napier</snm>
                  <fnm>PH</fnm>
               </au>
            </aug>
            <source>Old World monkeys</source>
            <publisher>New York: Academic Press</publisher>
            <pubdate>1970</pubdate>
         </bibl>
         <bibl id="B2">
            <aug>
               <au>
                  <snm>Szalay</snm>
                  <fnm>FS</fnm>
               </au>
               <au>
                  <snm>Delson</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Evolutionary history of the primates</source>
            <publisher>New York: Academic Press</publisher>
            <pubdate>1979</pubdate>
         </bibl>
         <bibl id="B3">
            <aug>
               <au>
                  <snm>Davies</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Oates</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Colobine monkeys: their ecology, behaviour, and evolution</source>
            <publisher>Cambridge: Cambridge University Press</publisher>
            <pubdate>1994</pubdate>
         </bibl>
         <bibl id="B4">
            <aug>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
            </aug>
            <source>Primate Taxonomy</source>
            <publisher>Washington: Smithsonian Institution Press</publisher>
            <pubdate>2001</pubdate>
         </bibl>
         <bibl id="B5">
            <title>
               <p>High mitochondrial DNA diversity with little structure within and among leaf monkey populations (<it>Trachypithecus cristatus </it>and <it>Trachypithecus auratus</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>Rosenblum</snm>
                  <fnm>LL</fnm>
               </au>
               <au>
                  <snm>Supriatna</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hasan</snm>
                  <fnm>MN</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Int J Primatol</source>
            <pubdate>1997</pubdate>
            <volume>18</volume>
            <fpage>1005</fpage>
            <lpage>1028</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/A:1026304415648</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Phylogeny of Chinese leaf monkeys using mitochondrial ND3&#8211;ND4 gene sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Forstner</snm>
                  <fnm>MRJ</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>ZM</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>HQ</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Xie</snm>
                  <fnm>YX</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Int J Primatol</source>
            <pubdate>1997</pubdate>
            <volume>18</volume>
            <fpage>305</fpage>
            <lpage>320</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/A:1026378215222</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Mitochondrial cytochrome b gene sequences of Old World monkeys: with special reference on evolution of Asian colobines</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Ryder</snm>
                  <fnm>OA</fnm>
               </au>
            </aug>
            <source>Primates</source>
            <pubdate>1998</pubdate>
            <volume>39</volume>
            <fpage>39</fpage>
            <lpage>49</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF02557742</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>2.3 Molecular phylogeny and systematics of Vietnamese leaf monkeys</p>
            </title>
            <aug>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Vietnam Primate Conservation Status Review 2002-Part 2: Leaf Monkeys</source>
            <publisher>Hanoi: Fauna &amp; Flora International and Frankfurt Zoological Society</publisher>
            <editor>Nadler T, Momberg F, Nguyen Xuan Dang, Lormee N</editor>
            <pubdate>2003</pubdate>
            <fpage>19</fpage>
            <lpage>23</lpage>
         </bibl>
         <bibl id="B9">
            <title>
               <p>The Tenasserim Lutung, <it>Trachypithecus barbei </it>(Blyth, 1847) (Primates: Cercopithecidae): Description, of a live specimen, and a reassessment of phylogenetic affinities, taxonomic history, and distribution</p>
            </title>
            <aug>
               <au>
                  <snm>Geissmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Contrib Zool</source>
            <pubdate>2004</pubdate>
            <volume>73</volume>
            <fpage>271</fpage>
            <lpage>282</lpage>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Molecular Evolution and Systematics of Vietnamese Primates</p>
            </title>
            <aug>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Conservation of Primates in Vietnam</source>
            <publisher>Hanoi: Haki Publishing</publisher>
            <editor>Nadler T, Streicher U, Ha Thang Long</editor>
            <pubdate>2004</pubdate>
            <fpage>23</fpage>
            <lpage>28</lpage>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Molecular evolution, systematics and distribution of the taxa within the silvered langur species group (<it>Trachypithecus </it>[<it>cristatus</it>]) in Southeast Asia</p>
            </title>
            <aug>
               <au>
                  <snm>Nadler</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Zool Garten (NF)</source>
            <pubdate>2005</pubdate>
            <volume>75</volume>
            <fpage>238</fpage>
            <lpage>247</lpage>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Molecular phylogenetic affinities of the simakobu monkey <it>Simias concolor</it></p>
            </title>
            <aug>
               <au>
                  <snm>Whittaker</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Ting</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2006</pubdate>
            <volume>39</volume>
            <fpage>887</fpage>
            <lpage>892</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2005.12.013</pubid>
                  <pubid idtype="pmpid" link="fulltext">16516500</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Molecular systematics of Indochinese primates</p>
            </title>
            <aug>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Thanh</snm>
                  <fnm>VN</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nadler</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Vietn J Primatol</source>
            <pubdate>2007</pubdate>
            <volume>1</volume>
            <fpage>41</fpage>
            <lpage>53</lpage>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Mitochondrial data support an odd-nosed colobine clade</p>
            </title>
            <aug>
               <au>
                  <snm>Sterner</snm>
                  <fnm>KN</fnm>
               </au>
               <au>
                  <snm>Raaum</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Disotell</snm>
                  <fnm>TR</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2006</pubdate>
            <volume>40</volume>
            <fpage>1</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2006.01.017</pubid>
                  <pubid idtype="pmpid" link="fulltext">16500120</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <aug>
               <au>
                  <snm>Napier</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Napier</snm>
                  <fnm>PH</fnm>
               </au>
            </aug>
            <source>A handbook of living primates</source>
            <publisher>London: Academic Press</publisher>
            <pubdate>1967</pubdate>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Evolutionary history of the Cercopithecidae</p>
            </title>
            <aug>
               <au>
                  <snm>Delson</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Contrib Primatol</source>
            <pubdate>1975</pubdate>
            <volume>5</volume>
            <fpage>167</fpage>
            <lpage>217</lpage>
            <xrefbib>
               <pubid idtype="pmpid">803423</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>The forgotten leaf-eaters and the phylogeny of Colobinae</p>
            </title>
            <aug>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
            </aug>
            <source>Old World monkeys</source>
            <publisher>New York: Academic Press</publisher>
            <editor>Napier JR, Napier PH</editor>
            <pubdate>1970</pubdate>
            <fpage>555</fpage>
            <lpage>586</lpage>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Die vollst&#228;ndige Naturgeschichte der Affen</p>
            </title>
            <aug>
               <au>
                  <snm>Reichenbach</snm>
                  <fnm>HGL</fnm>
               </au>
            </aug>
            <source>Die vollst&#228;ndige Naturgeschichte des In- und Auslandes</source>
            <publisher>Dresden: Central-Atlas f&#252;r Zoologische G&#228;rten</publisher>
            <pubdate>1862</pubdate>
         </bibl>
         <bibl id="B19">
            <title>
               <p>The monkeys of the genera <it>Pithecus </it>(or <it>Presbytis</it>) and <it>Pygathrix </it>found to the east of the Bay of Bengal</p>
            </title>
            <aug>
               <au>
                  <snm>Pocock</snm>
                  <fnm>RI</fnm>
               </au>
            </aug>
            <source>Proc Zool Sci London</source>
            <pubdate>1935</pubdate>
            <volume>1934</volume>
            <fpage>895</fpage>
            <lpage>961</lpage>
         </bibl>
         <bibl id="B20">
            <title>
               <p>A monography on the purple-faced leaf-monkeys (<it>Pithecus vetulus</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>Hill</snm>
                  <fnm>WCO</fnm>
               </au>
            </aug>
            <source>Ceylon J Sci</source>
            <pubdate>1934</pubdate>
            <volume>9</volume>
            <fpage>23</fpage>
            <lpage>88</lpage>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Colobus and leaf monkeys</p>
            </title>
            <aug>
               <au>
                  <snm>Brandon-Jones</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Encylopedia of Mammals</source>
            <publisher>London: George Allen and Unwin</publisher>
            <editor>MacDonald ID</editor>
            <pubdate>1984</pubdate>
            <fpage>398</fpage>
            <lpage>408</lpage>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Cladistic analysis of cercopithecid relationship</p>
            </title>
            <aug>
               <au>
                  <snm>Strasser</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Delson</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Hum Evol</source>
            <pubdate>1987</pubdate>
            <volume>16</volume>
            <fpage>81</fpage>
            <lpage>99</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/0047-2484(87)90061-3</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>A revision of the Asian pied leaf monkeys (Mammalia: Cercopithecidae: Superspecies <it>Semnopithecus auratus</it>), with a description of a new subspecies</p>
            </title>
            <aug>
               <au>
                  <snm>Brandon-Jones</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>The Raffles Bulletin of Zoology</source>
            <pubdate>1995</pubdate>
            <volume>43</volume>
            <fpage>3</fpage>
            <lpage>43</lpage>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A catalogue of primates in the Singapore Zoological Reference Collection</p>
            </title>
            <aug>
               <au>
                  <snm>Weitzel</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
            </aug>
            <source>The Raffles Bulletin of Zoology</source>
            <pubdate>1988</pubdate>
            <volume>36</volume>
            <fpage>1</fpage>
            <lpage>166</lpage>
         </bibl>
         <bibl id="B25">
            <aug>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
            </aug>
            <source>A theory of human and primate evolution</source>
            <publisher>Oxford: Oxford University Press</publisher>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Asian Primate Classification</p>
            </title>
            <aug>
               <au>
                  <snm>Brandon-Jones</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Eudey</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Geissmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Groves</snm>
                  <fnm>CP</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Morales</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Shekelle</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>CB</fnm>
               </au>
            </aug>
            <source>Int J Primatol</source>
            <pubdate>2004</pubdate>
            <volume>25</volume>
            <fpage>97</fpage>
            <lpage>164</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/B:IJOP.0000014647.18720.32</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <aug>
               <au>
                  <snm>Rowe</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>The pictorial guide to the living primates</source>
            <publisher>New York: Pogonias Press</publisher>
            <pubdate>1996</pubdate>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Chromosome painting shows that the proboscis monkey (<it>Nasalis larvatus</it>) has a derived karyotype and is phylogenetically nested within Asian colobines</p>
            </title>
            <aug>
               <au>
                  <snm>Bigoni</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Stanyon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wimmer</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schempp</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Am J Primatol</source>
            <pubdate>2003</pubdate>
            <volume>60</volume>
            <fpage>85</fpage>
            <lpage>93</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ajp.10095</pubid>
                  <pubid idtype="pmpid" link="fulltext">12874840</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Diversification of Sulawesi macaque monkeys: decoupled evolution of mitochondrial and autosomal DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Evans</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Supriatna</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Andayani</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Evol</source>
            <pubdate>1999</pubdate>
            <volume>57</volume>
            <issue>8</issue>
            <fpage>1931</fpage>
            <lpage>1946</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">14503633</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Y-chromosome and mitochondrial markers in <it>Macaca fascicularis </it>indicate introgression with Indochinese <it>M. mulatta </it>and a biogeographic barrier in the Isthmus of Kra</p>
            </title>
            <aug>
               <au>
                  <snm>Tosi</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Morales</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Int J Primatol</source>
            <pubdate>2002</pubdate>
            <volume>23</volume>
            <fpage>161</fpage>
            <lpage>178</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/A:1013258109954</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Natural hybridization in primates: one evolutionary mechanism</p>
            </title>
            <aug>
               <au>
                  <snm>Arnold</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Zoology</source>
            <pubdate>2006</pubdate>
            <volume>109</volume>
            <issue>4</issue>
            <fpage>261</fpage>
            <lpage>276</lpage>
            <note>Epub 2006 Aug 30.</note>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.zool.2006.03.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">16945512 </pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Alu repeats and human genomic diversity</p>
            </title>
            <aug>
               <au>
                  <snm>Batzer</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Deininger</snm>
                  <fnm>PL</fnm>
               </au>
            </aug>
            <source>Nat Rev Genet</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <fpage>370</fpage>
            <lpage>379</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrg798</pubid>
                  <pubid idtype="pmpid" link="fulltext">11988762</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>SINE insertions: powerful tools for molecular systematics</p>
            </title>
            <aug>
               <au>
                  <snm>Shedlock</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Okada</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Bioessays</source>
            <pubdate>2000</pubdate>
            <volume>22</volume>
            <fpage>148</fpage>
            <lpage>160</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1521-1878(200002)22:2&lt;148::AID-BIES6>3.0.CO;2-Z</pubid>
                  <pubid idtype="pmpid" link="fulltext">10655034</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>SINE insertions in cladistic analyses and the phylogenetic affiliations of <it>Tarsius bancanus </it>to other primates</p>
            </title>
            <aug>
               <au>
                  <snm>Schmitz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ohme</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zischler</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2001</pubdate>
            <volume>157</volume>
            <fpage>777</fpage>
            <lpage>784</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1461532</pubid>
                  <pubid idtype="pmpid" link="fulltext">11156996</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Primate jumping genes elucidate strepsirrhine phylogeny</p>
            </title>
            <aug>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Schmitz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zischler</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>10650</fpage>
            <lpage>10654</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">489989</pubid>
                  <pubid idtype="pmpid" link="fulltext">15249661</pubid>
                  <pubid idtype="doi">10.1073/pnas.0403852101</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Alu insertion loci and platyrrhine primate phylogeny</p>
            </title>
            <aug>
               <au>
                  <snm>Ray</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Xing</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Hedges</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Hall</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Laborde</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Anders</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Stoilova</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fowlkes</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Landry</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Chemnick</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Ryder</snm>
                  <fnm>OA</fnm>
               </au>
               <au>
                  <snm>Batzer</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2005</pubdate>
            <volume>35</volume>
            <fpage>117</fpage>
            <lpage>126</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2004.10.023</pubid>
                  <pubid idtype="pmpid" link="fulltext">15737586</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Primate phylogeny: molecular evidence from retroposons</p>
            </title>
            <aug>
               <au>
                  <snm>Schmitz</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Roos</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Zischler</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Cytogenet Genome Res</source>
            <pubdate>2005</pubdate>
            <volume>108</volume>
            <fpage>26</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1159/000080799</pubid>
                  <pubid idtype="pmpid" link="fulltext">15545713</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>A mobile element based phylogeny of Old World monkeys</p>
            </title>
            <aug>
               <au>
                  <snm>Xing</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ray</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Chemnick</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Stewart</snm>
                  <fnm>CB</fnm>
               </au>
               <au>
                  <snm>Disotell</snm>
                  <fnm>TR</fnm>
               </au>
               <au>
                  <snm>Ryder</snm>
                  <fnm>OA</fnm>
               </au>
               <au>
                  <snm>Batzer</snm>
                  <fnm>MA</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>872</fpage>
            <lpage>880</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2005.04.015</pubid>
                  <pubid idtype="pmpid" link="fulltext">15936216</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Unreliable mtDNA data due to nuclear insertions: a cautionary tale from analysis of humans and great apes</p>
            </title>
            <aug>
               <au>
                  <snm>Thalmann</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Hebler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Poinar</snm>
                  <fnm>HN</fnm>
               </au>
               <au>
                  <snm>P&#228;&#228;bo</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Vigilant</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2004</pubdate>
            <volume>13</volume>
            <fpage>321</fpage>
            <lpage>335</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-294X.2003.02070.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14717890</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Factors affecting the amount of genomic DNA extracted from ape faeces and the identification of an improved sample storage method</p>
            </title>
            <aug>
               <au>
                  <snm>Nsubuga</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Robbins</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Roeder</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Morin</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Boesch</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Vigilant</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2004</pubdate>
            <volume>13</volume>
            <fpage>2089</fpage>
            <lpage>2094</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-294X.2004.02207.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15189228</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>A multi-samples, multi-extracts approach for microsatellite analysis of faecel samples in an arboreal ape</p>
            </title>
            <aug>
               <au>
                  <snm>Goossens</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chikhi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Utami</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>De Ruiter</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Bruford</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Conserv Genetics</source>
            <pubdate>2000</pubdate>
            <volume>1</volume>
            <fpage>157</fpage>
            <lpage>162</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/A:1026535006318</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Noninvasive genetic sampling: look before you leap</p>
            </title>
            <aug>
               <au>
                  <snm>Taberlet</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Waits</snm>
                  <fnm>LP</fnm>
               </au>
               <au>
                  <snm>Luikart</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Trends Ecol Evol</source>
            <pubdate>1999</pubdate>
            <volume>14</volume>
            <fpage>323</fpage>
            <lpage>327</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0169-5347(99)01637-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">10407432</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Ancient DNA from giant extinct lemurs confirms single origin of Malagasy primates</p>
            </title>
            <aug>
               <au>
                  <snm>Karanth</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Delefosse</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Rakotosamimanana</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Parsons</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Yoder</snm>
                  <fnm>AD</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2005</pubdate>
            <volume>102</volume>
            <fpage>5090</fpage>
            <lpage>5095</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">555979</pubid>
                  <pubid idtype="pmpid" link="fulltext">15784742</pubid>
                  <pubid idtype="doi">10.1073/pnas.0408354102</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Castresana</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2000</pubdate>
            <volume>17</volume>
            <fpage>540</fpage>
            <lpage>552</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10742046</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>PAUP*: Phylogenetic analysis using parsimony (*and other methods), Version 4.0b10</source>
            <publisher>Sunderland: Sinauer Associates</publisher>
            <pubdate>2002</pubdate>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Quartet puzzling: a maximum likelihood method for reconstructing tree topologies</p>
            </title>
            <aug>
               <au>
                  <snm>Strimmer</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>von Haeseler</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1996</pubdate>
            <volume>13</volume>
            <fpage>964</fpage>
            <lpage>969</lpage>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Modeltest: testing the model of DNA substitutions</p>
            </title>
            <aug>
               <au>
                  <snm>Posada</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Crandall</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <fpage>817</fpage>
            <lpage>818</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/14.9.817</pubid>
                  <pubid idtype="pmpid" link="fulltext">9918953</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and their branching order of Hominoidea</p>
            </title>
            <aug>
               <au>
                  <snm>Kishino</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1989</pubdate>
            <volume>29</volume>
            <fpage>170</fpage>
            <lpage>179</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/BF02100115</pubid>
                  <pubid idtype="pmpid">2509717</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Multiple comparisons of log-likelihood with applications to phylogeneitc reference</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>1114</fpage>
            <lpage>1116</lpage>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Comparison of Y chromosome and mtDNA phylogenies leads to unique inferences of macaque evolutionary history</p>
            </title>
            <aug>
               <au>
                  <snm>Tosi</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Morales</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2000</pubdate>
            <volume>17</volume>
            <fpage>133</fpage>
            <lpage>144</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/mpev.2000.0834</pubid>
                  <pubid idtype="pmpid" link="fulltext">11083929</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Whole-genome experimental identification of insertion/deletion polymorphisms of interspersed repeats by a new general approach</p>
            </title>
            <aug>
               <au>
                  <snm>Mamedov</snm>
                  <fnm>IZ</fnm>
               </au>
               <au>
                  <snm>Arzumanyan</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Amosova</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Lebedev</snm>
                  <fnm>YB</fnm>
               </au>
               <au>
                  <snm>Sverdlov</snm>
                  <fnm>ED</fnm>
               </au>
            </aug>
            <source>Nucleic Acid Res</source>
            <pubdate>2005</pubdate>
            <volume>33</volume>
            <fpage>e16</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">548376</pubid>
                  <pubid idtype="pmpid" link="fulltext">15673711</pubid>
                  <pubid idtype="doi">10.1093/nar/gni018</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
