<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-7-44</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Methodology article</dochead>
      <bibl>
         <title>
            <p>A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>Li</snm>
               <fnm>Chenhong</fnm>
               <insr iid="I1"/>
               <email>cli@unlserve.unl.edu</email>
            </au>
            <au id="A2">
               <snm>Ort&#237;</snm>
               <fnm>Guillermo</fnm>
               <insr iid="I1"/>
               <email>gorti@unlserve.unl.edu</email>
            </au>
            <au id="A3">
               <snm>Zhang</snm>
               <fnm>Gong</fnm>
               <insr iid="I2"/>
               <email>gzhang@mail.unomaha.edu</email>
            </au>
            <au ca="yes" id="A4">
               <snm>Lu</snm>
               <fnm>Guoqing</fnm>
               <insr iid="I3"/>
               <email>glu3@mail.unomaha.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>School of Biological Sciences, University of Nebraska, Lincoln, NE 68588, USA</p>
            </ins>
            <ins id="I2">
               <p>Department of Mathematics, University of Nebraska, Omaha, NE 68182, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Biology, University of Nebraska, Omaha, NE 68182, USA</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2007</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>44</fpage>
         <url>http://www.biomedcentral.com/1471-2148/7/44</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">17374158</pubid>
               <pubid idtype="doi">10.1186/1471-2148-7-44</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>25</day>
               <month>9</month>
               <year>2006</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>20</day>
               <month>3</month>
               <year>2007</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>20</day>
               <month>3</month>
               <year>2007</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2007</year>
         <collab>Li et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Molecular systematics occupies one of the central stages in biology in the genomic era, ushered in by unprecedented progress in DNA technology. The inference of organismal phylogeny is now based on many independent genetic loci, a widely accepted approach to assemble the tree of life. Surprisingly, this approach is hindered by lack of appropriate nuclear gene markers for many taxonomic groups especially at high taxonomic level, partially due to the lack of tools for efficiently developing new phylogenetic makers. We report here a genome-comparison strategy to identifying nuclear gene markers for phylogenetic inference and apply it to the ray-finned fishes &#8211; the largest vertebrate clade in need of phylogenetic resolution.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>A total of 154 candidate molecular markers &#8211; relatively well conserved, putatively single-copy gene fragments with long, uninterrupted exons &#8211; were obtained by comparing whole genome sequences of two model organisms, <it>Danio rerio </it>and <it>Takifugu rubripes</it>. Experimental tests of 15 of these (randomly picked) markers on 36 taxa (representing two-thirds of the ray-finned fish orders) demonstrate the feasibility of amplifying by PCR and directly sequencing most of these candidates from whole genomic DNA in a vast diversity of fish species. Preliminary phylogenetic analyses of sequence data obtained for 14 taxa and 10 markers (total of 7,872 bp for each species) are encouraging, suggesting that the markers obtained will make significant contributions to future fish phylogenetic studies.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We present a practical approach that systematically compares whole genome sequences to identify single-copy nuclear gene markers for inferring phylogeny. Our method is an improvement over traditional approaches (e.g., manually picking genes for testing) because it uses genomic information and automates the process to identify large numbers of candidate makers. This approach is shown here to be successful for fishes, but also could be applied to other groups of organisms for which two or more complete genome sequences exist, which has important implications for assembling the tree of life.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The ultimate goal of obtaining a well-supported and accurate representation of the tree of life relies on the assembly of phylogenomic data sets for large numbers of taxa <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Molecular phylogenies based on DNA sequences of a single locus or a few loci often suffer from low resolution and marginal statistical support due to limited character sampling. Individual gene genealogies also may differ from each other and from the organismal phylogeny (the "gene-tree vs. species-tree" issue) <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>, in many cases due to systematic biases (i.e., compositional bias, long-branch attraction, heterotachy), leading to statistical inconsistency in phylogenetic reconstruction <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Phylogenomic data sets &#8211; using genome sequences to study evolutionary relationship &#8211; provide the best solution to these problems <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B8">8</abbr></abbrgrp>. This approach requires compilation of large data sets that include many independent nuclear loci for many species <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp>. Such data sets are less likely to succumb to sampling and systematic errors <abbrgrp><abbr bid="B13">13</abbr></abbrgrp> by offering the possibility of analyzing large numbers of phylogenetically informative characters from different genomic locations, and also of corroborating phylogenetic results by varying the species sampled. If any systematic bias may be present in a fraction of individual loci sampled, it is unlikely that all affected loci will be biased in the same direction. Powerful analytical approaches that accommodate model heterogeneity among data partitions are becoming available to efficiently analyze such complex phylogenomic data sets <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>.</p>
         <p>Constructing phylogenomic data sets for large number of taxa still is, however, quite challenging. Most attempts to use this approach have been based either on few available complete genomic sequence data <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>, or cDNA and ESTs sequences <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B12">12</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp> for relatively few taxa. Availability of complete genomes limits the number of taxa that can be analyzed <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B17">17</abbr></abbrgrp>, imposing known problems for phylogenetic inference associated with poor taxon sampling <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. On the other hand, methods based on ESTs or cDNA sequence data are not practical for many taxa because they require construction of cDNA libraries and fresh tissue samples. In addition, some genes may not be expressed in certain tissues or developmental stages, leading to cases with undesirable amounts of missing data <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. The most efficient way to collect nuclear gene sequences for many taxa is to directly amplify target sequences using "universal" PCR primers, an approach so far used for just a few widely-used nuclear genes <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>, or selected taxonomic groups (e.g., placental mammals and land plants). Widespread use of this strategy in most taxonomic groups has been hindered by the paucity of available PCR-targeted gene markers.</p>
         <p>Mining genomic data to obtain candidate phylogenetic markers requires stringent criteria, since not all loci are likely to carry the appropriate historical signal. The phylogenetic informativeness of characters has been extensively debated on theoretical grounds <abbrgrp><abbr bid="B26">26</abbr><abbr bid="B27">27</abbr></abbrgrp>, as well as in empirical cases <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr></abbrgrp>. Our study does not intend to contribute to this debate, but rather to focus on the practical issues involved in obtaining the raw data for analysis. What is the best strategy to select a few hundreds candidate loci from thousands of genes present in the genome? For practical purposes, a good phylogenetic nuclear gene marker must satisfy three criteria. First, orthologous genes should be easy to identify and amplify in all taxa of interest. One of the main problems associated with nuclear protein-coding genes used to infer phylogeny is uncertainty about their orthology <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. This is especially true when multiple copies of a target gene are amplified by PCR from whole genomic DNA. To minimize the chance of sampling paralogous genes among taxa (the trap of "mistaken paralogy" that will lead to gene-tree-species-tree discordance), our approach is initiated by searches for single-copy nuclear genes in genomic databases. Under this criterion, even if gene duplication events may have occurred during evolution of the taxa of interest (e.g., the fish-specific whole-genome duplication event) <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>, duplicated copies of a single-copy nuclear gene tend to be lost quickly, possibly due to dosage compensation <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. Some authors estimate that almost 80% of the paralogs have been secondarily lost following the genome-duplication event <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. Thus, if duplicated copies are lost before the relevant speciation events occur (Figure <figr fid="F1">1a, b</figr>), no paralogous gene copies would be sampled. If the alternative situation occurs (Figure <figr fid="F1">1c</figr>), paralogy will mislead phylogenetic inference resulting in topological discordance among genes. In the latter case, the topological distribution of this discordance may be used to reconstruct putative duplication/extinction events and clarify the putative mistaken paralogy <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. The second criterion used to facilitate efficient data collection is to identify protein-coding genes with long exons (longer than a practical threshold determined by current DNA sequencing technology, for example 800 bp). Most genes are fragmented into small exons and large introns. For high taxonomic-level phylogenetic inference (deep phylogeny), intron sequences evolve too fast and are usually not informative, becoming an obstacle for the amplification and sequencing of more informative exon-coding sequences. The third criterion used seeks to identify reasonably conserved genes. Genes with low rates of evolution are less prone to accumulate homoplasy, and also provide the practical advantage of facilitating the design of universal primers for PCR that will work on a diversity of taxa. Furthermore, conserved protein-coding genes also are easy to align for analysis, based on their amino acid sequence.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Single-copy genes are useful markers for phylogeny inference</p>
            </caption>
            <text>
               <p><b>Single-copy genes are useful markers for phylogeny inference</b>. Gene duplication and subsequent loss may not cause incongruence between gene tree and species tree if gene loss occurs before the first speciation event (a), or before the second speciation event (b). The only case that would cause incongruence is when the gene survived both speciation events and is asymmetrically lost in taxon 2 and taxon 3 (c).</p>
            </text>
            <graphic file="1471-2148-7-44-1"/>
         </fig>
         <p>Sequence conservatism and long exonic regions have been used as preferred criteria to select phylogenetic markers in the past <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. However, finding many preferred, easy-to-apply gene markers is unlikely when candidate genes are manually screened from data bases or taken from isolated studies of few individual genes. This complexity partially explains the scarcity of currently available nuclear gene markers in many taxonomic groups. To address the problem, we present a simple bioinformatic approach to obtain nuclear gene markers from complete genomic data, based on the three aforementioned criteria. Our method incorporates two improvements over the traditional way of manually picking genes and testing their phylogenetic utilities. These improvements include using full genomic information and automating the process of searching for candidate makers. We apply the method to Actinoptertygii (ray-finned fish), the largest vertebrate clade &#8211; they make up about half of all known vertebrate species &#8211; with a poorly known phylogeny <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr></abbrgrp>. We also present experimental tests to show that PCR primers designed for a subset of the candidate markers can efficiently amplify these markers for a highly diverse sample of ray-finned fishes. Comparative analyses of the sequences obtained show encouraging phylogenetic properties for future studies.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>The bioinformatic pipeline used is shown in Figure <figr fid="F2">2</figr>. Within-genome sequence comparisons resulted in 2,797 putative single-copy exons (> 800 bp) in zebrafish (<it>D. rerio</it>), and 1,822 in torafugu (<it>T. rubripes</it>), 2132 in stickleback (<it>G. aculeatus</it>), and 1809 in Japanese rice fish (<it>O. latipes</it>). Note that our operational definition of a "single-copy" gene only requires that the fragment is not present as a second copy in the genome with similarity higher than 50%. Some single-copy genes may, in fact, have duplicates in the genome that are less than 50% similar. Pairwise between-genome comparisons of the single-copy exon sequences resulted in a range of 113 to 281 putative orthologs shared among genomes, that have similarity greater than 70%. The lowest number of "conserved orthologs" was detected between zebrafish and rice fish, and the highest between torafugu and stickleback. The number of putative conserved orthologs shared among three or more genomes varied from case to case; for example, it peaked at 155 when comparing torafugu, Japanese rice fish, and stickleback, but only 61 for the comparison involving torafugu, Japanese ricefish, and zebrafish. All the information resulting from these analyses is publicly available in our website <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>, and a sample output of candidate markers is shown in Additional file <supplr sid="S1">1</supplr>.</p>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>The bioinformatic pipeline for phylogenetic markers development</p>
            </caption>
            <text>
               <p><b>The bioinformatic pipeline for phylogenetic markers development</b>. It involves within- and across-genome sequences comparison, <it>in silico </it>test with sequences in other species, and experimental validation. Numbers of genes and exons identified for <it>D. rerio </it>are indicated by the asterisk. Exon length (L), within-genome similarity (S), between-genome similarity (Sx), and coverage (C) are adjustable parameters (see methods).</p>
            </text>
            <graphic file="1471-2148-7-44-2"/>
         </fig>
         <suppl id="S1">
            <title>
               <p>Additional file 1</p>
            </title>
            <text>
               <p>Exon ID, exon length, GC content of predicted single nuclear gene markers in zebrafish and torafugu, as well the blast result between orthologous genes.</p>
            </text>
            <file name="1471-2148-7-44-S1.rtf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <p>To investigate the properties of candidate markers, we analyzed those found in the zebrafish and torafugu comparison, since their genome sequences are well annotated. Among them, 154 putative homologs were identified between zebrafish and torafugu by cross-genome comparison. Further comparison with EST sequences from other fish species reduced this number to 138 candidate markers (Supplementary Table 1). The 154 candidate markers shared between these two genomes according to our search criteria are distributed among 24 of the 25 chromosomes of zebrafish, and a Chi-square test did not reject a Poisson distribution of markers among chromosomes (&#967;<sup>2 </sup>= 16.99, df = 10, p = 0.0746). The size of candidate markers ranged from 802 to 5811 bp (in <it>D. rerio</it>). Their GC content ranged from 41.6% to 63.9% (in <it>D. rerio</it>), and the average similarity of the DNA sequence of these markers between <it>D. rerio </it>and <it>T. rubripes </it>varied from 77.3% to 93.2% (constrained by the search criteria).</p>
         <p>To test the practical value of potential phylogenetic markers, 15 gene fragments were randomly picked from the candidate list of 154 and tested experimentally on 36 taxa, chosen to represent two-thirds of all ray-finned fish orders (see Additional file <supplr sid="S2">2</supplr>). PCR primers were designed on conserved flanking regions for each fragment, based on the genomic sequences and tested on all taxa (Table <tblr tid="T1">1</tblr>). Ten out of the 15 markers examined successfully amplified a single product of the predicted size by a nested PCR approach in 31 taxa. For comparative sequence analyses, we took only 14 taxa (<it>Amia calva</it>, <it>D. rerio</it>, <it>Semotilus atromaculatus</it>, <it>Ictalurus punctatus</it>, <it>Oncorhynchus mykiss</it>, <it>Brotula multibarbata</it>, <it>Fundulus heteroclitus</it>, <it>Oryzias latipes</it>, <it>Oreochromis niloticus</it>, <it>Gasterosteus aculeatus</it>, <it>Lycodes atlanticus</it>, <it>T. rubripes</it>, <it>Morone chrysops</it>, <it>Lutjanus mahogoni</it>) that could be amplified and sequenced directly for the set of 10 markers [GenBank: <ext-link ext-link-type="gen" ext-link-id="EF032909">EF032909</ext-link> &#8211; <ext-link ext-link-type="gen" ext-link-id="EF033038">EF033038</ext-link>]. The size of the sequenced fragments ranged from 666 to 987 bp, and the average uncorrected genetic distances for DNA sequence of the 10 markers among the 14 taxa ranged from 13% to 21%. We present (Table <tblr tid="T2">2</tblr>) additional characteristics of the data set such as the substitution rate, consistency index (CI), gamma shape parameter (&#945;), relative composition variability (RCV), and treeness <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> resulting from phylogenetic analysis of the sequences of the 10 new markers. Values obtained are similar to those observed in a commonly used phylogenetic marker &#8211; recombination activating gene 1 (RAG-1, Table <tblr tid="T2">2</tblr>). For the newly characterized phylogenetic markers, the substitution rate is negatively correlated with CI (r = -0.84, P = 0.0026) and marginally correlated with &#945; (r = -0.56, P = 0.095). In contrast, base composition heterogeneity (RCV) and the phylogenetic signal to noise index (treeness index) are not correlated with substitution rate. Based on the treeness value, genes ENC1, plagl2, Ptr, Gylt and tbr1 seem well suited for phylogenetic studies at high taxonomic level among ray-finned fishes.</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>PCR primers and annealing temperatures used to amplify 10 new markers</p>
            </caption>
            <tblbdy cols="5">
               <r>
                  <c ca="left">
                     <p>Gene*</p>
                  </c>
                  <c ca="left">
                     <p>Primers</p>
                  </c>
                  <c ca="left">
                     <p>Sequences</p>
                  </c>
                  <c ca="left">
                     <p>Annealing temp</p>
                  </c>
                  <c ca="left">
                     <p>PCR steps</p>
                  </c>
               </r>
               <r>
                  <c cspan="5">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>zic1</p>
                  </c>
                  <c ca="left">
                     <p>zic1_F9</p>
                  </c>
                  <c ca="left">
                     <p>5' GGACGCAGGACCGCARTAYC 3'</p>
                  </c>
                  <c ca="left">
                     <p>57</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>zic1_R967</p>
                  </c>
                  <c ca="left">
                     <p>5' CTGTGTGTGTCCTTTTGTGRATYTT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>zic1_F16</p>
                  </c>
                  <c ca="left">
                     <p>5' GGACCGCAGTATCCCACYMT 3'</p>
                  </c>
                  <c ca="left">
                     <p>57</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>zic1_R963</p>
                  </c>
                  <c ca="left">
                     <p>5' GTGTGTCCTTTTGTGAATTTTYAGRT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>myh6</p>
                  </c>
                  <c ca="left">
                     <p>myh6_F459</p>
                  </c>
                  <c ca="left">
                     <p>5' CATMTTYTCCATCTCAGATAATGC 3'</p>
                  </c>
                  <c ca="left">
                     <p>53</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>myh6_R1325</p>
                  </c>
                  <c ca="left">
                     <p>5' ATTCTCACCACCATCCAGTTGAA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>myh6_F507</p>
                  </c>
                  <c ca="left">
                     <p>5' GGAGAATCARTCKGTGCTCATCA 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>myh6_R1322</p>
                  </c>
                  <c ca="left">
                     <p>5' CTCACCACCATCCAGTTGAACAT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RYR3</p>
                  </c>
                  <c ca="left">
                     <p>RYR3_F15</p>
                  </c>
                  <c ca="left">
                     <p>5' GGAACTATYGGTAAGCARATGG 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>RYR3_R968</p>
                  </c>
                  <c ca="left">
                     <p>5' TGGAAGAAKCCAAAKATGATGC 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>RYR3_F22</p>
                  </c>
                  <c ca="left">
                     <p>5' TCGGTAAGCARATGGTGGACA 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>RYR3_R931</p>
                  </c>
                  <c ca="left">
                     <p>5' AGAATCCRGTGAAGAGCATCCA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Ptr</p>
                  </c>
                  <c ca="left">
                     <p>Ptr_F458</p>
                  </c>
                  <c ca="left">
                     <p>5' AGAATGGATWACCAACACYTACG 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Ptr_R1248</p>
                  </c>
                  <c ca="left">
                     <p>5' TAAGGCACAGGATTGAGATGCT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Ptr_F463</p>
                  </c>
                  <c ca="left">
                     <p>5' GGATAACCAACACYTACGTCAA 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Ptr_R1242</p>
                  </c>
                  <c ca="left">
                     <p>5' ACAGGATTGAGATGCTGTCCA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>tbr1</p>
                  </c>
                  <c ca="left">
                     <p>tbr1_F1</p>
                  </c>
                  <c ca="left">
                     <p>5' TGTCTACACAGGCTGCGACAT 3'</p>
                  </c>
                  <c ca="left">
                     <p>57</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>tbr1_R820</p>
                  </c>
                  <c ca="left">
                     <p>5' GATGTCCTTRGWGCAGTTTTT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>tbr1_F86</p>
                  </c>
                  <c ca="left">
                     <p>5' GCCATGMCTGGYTCTTTCCT 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>tbr1_R811</p>
                  </c>
                  <c ca="left">
                     <p>5' GGAGCAGTTTTTCTCRCATTC 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ENC1</p>
                  </c>
                  <c ca="left">
                     <p>ENC1_F85</p>
                  </c>
                  <c ca="left">
                     <p>5' GACATGCTGGAGTTTCAGGA 3'</p>
                  </c>
                  <c ca="left">
                     <p>53</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>ENC1_R982</p>
                  </c>
                  <c ca="left">
                     <p>5' ACTTGTTRGCMACTGGGTCAAA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>ENC1_F88</p>
                  </c>
                  <c ca="left">
                     <p>5' ATGCTGGAGTTTCAGGACAT 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>ENC1_R975</p>
                  </c>
                  <c ca="left">
                     <p>5' AGCMACTGGGTCAAACTGCTC 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Gylt</p>
                  </c>
                  <c ca="left">
                     <p>Glyt_F559</p>
                  </c>
                  <c ca="left">
                     <p>5' GGACTGTCMAAGATGACCACMT 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Glyt_R1562</p>
                  </c>
                  <c ca="left">
                     <p>5' CCCAAGAGGTTCTTGTTRAAGAT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Glyt_F577</p>
                  </c>
                  <c ca="left">
                     <p>5' ACATGGTACCAGTATGGCTTTGT 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>Glyt_R1464</p>
                  </c>
                  <c ca="left">
                     <p>5' GTAAGGCATATASGTGTTCTCTCC 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>SH3PX3</p>
                  </c>
                  <c ca="left">
                     <p>SH3PX3_F461</p>
                  </c>
                  <c ca="left">
                     <p>5' GTATGGTSGGCAGGAACYTGAA 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>SH3PX3_R1303</p>
                  </c>
                  <c ca="left">
                     <p>5' CAAACAKCTCYCCGATGTTCTC 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>SH3PX3_F532</p>
                  </c>
                  <c ca="left">
                     <p>5' GACGTTCCCATGATGGCWAAAAT 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>SH3PX3_R1299</p>
                  </c>
                  <c ca="left">
                     <p>5' CATCTCYCCGATGTTCTCGTA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>plagl2</p>
                  </c>
                  <c ca="left">
                     <p>plagl2_F9</p>
                  </c>
                  <c ca="left">
                     <p>5' CCACACACTCYCCACAGAA 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>plagl2_R930</p>
                  </c>
                  <c ca="left">
                     <p>5' TTCTCAAGCAGGTATGAGGTAGA 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>plagl2_F51</p>
                  </c>
                  <c ca="left">
                     <p>5' AAAAGATGTTTCACCGMAAAGA 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>plagl2_R920</p>
                  </c>
                  <c ca="left">
                     <p>5' GGTATGAGGTAGATCCSAGCTG 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>sreb2</p>
                  </c>
                  <c ca="left">
                     <p>sreb2_F10</p>
                  </c>
                  <c ca="left">
                     <p>5' ATGGCGAACTAYAGCCATGC 3'</p>
                  </c>
                  <c ca="left">
                     <p>55</p>
                  </c>
                  <c ca="left">
                     <p>1st</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>sreb2_R1094</p>
                  </c>
                  <c ca="left">
                     <p>5' CTGGATTTTCTGCAGTASAGGAG 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>sreb2_F27</p>
                  </c>
                  <c ca="left">
                     <p>5' TGCAGGGGACCACAMCAT 3'</p>
                  </c>
                  <c ca="left">
                     <p>62</p>
                  </c>
                  <c ca="left">
                     <p>2nd</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>sreb2_R1082</p>
                  </c>
                  <c ca="left">
                     <p>5' CAGTASAGGAGCGTGGTGCT 3'</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>PCR</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>*Gene markers are named following annotations in ENSEMBLE. zic1, zic family member 1; myh6, myosin, heavy polypeptide 6; RYR3 (si:ch211-189g6.1), novel protein similar to vertebrate ryanodine receptor 3; Ptr (si:ch211-105n9.1), hypothetical protein LOC564097; tbr1, T-box brain 1; ENC1(559445 Entrezgene), similar to ectodermal-neural cortex 1; Glyt (zgc:112079), glycosyltransferase; SH3PX3, similar to SH3 and PX domain containing 3 gene; plagl2, pleiomorphic adenoma gene-like 2; sreb2, Super conserved receptor expressed in brain 2.</p>
            </tblfn>
         </tbl>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Summary information of the 10 gene markers amplified in 14 taxa</p>
            </caption>
            <tblbdy cols="11">
               <r>
                  <c ca="left">
                     <p>Gene</p>
                  </c>
                  <c ca="left">
                     <p>Exon ID</p>
                  </c>
                  <c ca="left">
                     <p>No. of bp</p>
                  </c>
                  <c ca="left">
                     <p>No. of var.</p>
                  </c>
                  <c ca="left">
                     <p>No. of PI</p>
                  </c>
                  <c ca="left">
                     <p>Genetic distance (%)</p>
                  </c>
                  <c ca="left">
                     <p>Sub. rate</p>
                  </c>
                  <c ca="left">
                     <p>CI-MP</p>
                  </c>
                  <c ca="left">
                     <p>&#945;</p>
                  </c>
                  <c ca="left">
                     <p>RCV</p>
                  </c>
                  <c ca="left">
                     <p>Treeness</p>
                  </c>
               </r>
               <r>
                  <c cspan="11">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>zic1</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000015655</p>
                  </c>
                  <c ca="left">
                     <p>894</p>
                  </c>
                  <c ca="left">
                     <p>296</p>
                  </c>
                  <c ca="left">
                     <p>210</p>
                  </c>
                  <c ca="left">
                     <p>13(2.3&#8211;22.6)</p>
                  </c>
                  <c ca="left">
                     <p>0.64</p>
                  </c>
                  <c ca="left">
                     <p>0.61</p>
                  </c>
                  <c ca="left">
                     <p>1.64</p>
                  </c>
                  <c ca="left">
                     <p>0.13</p>
                  </c>
                  <c ca="left">
                     <p>0.23</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>myh6</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000025410</p>
                  </c>
                  <c ca="left">
                     <p>735</p>
                  </c>
                  <c ca="left">
                     <p>323</p>
                  </c>
                  <c ca="left">
                     <p>235</p>
                  </c>
                  <c ca="left">
                     <p>18(7.8&#8211;23.2)</p>
                  </c>
                  <c ca="left">
                     <p>1.35</p>
                  </c>
                  <c ca="left">
                     <p>0.54</p>
                  </c>
                  <c ca="left">
                     <p>0.68</p>
                  </c>
                  <c ca="left">
                     <p>0.11</p>
                  </c>
                  <c ca="left">
                     <p>0.22</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RYR3</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000465292</p>
                  </c>
                  <c ca="left">
                     <p>825</p>
                  </c>
                  <c ca="left">
                     <p>389</p>
                  </c>
                  <c ca="left">
                     <p>258</p>
                  </c>
                  <c ca="left">
                     <p>18(8&#8211;23.6)</p>
                  </c>
                  <c ca="left">
                     <p>1.25</p>
                  </c>
                  <c ca="left">
                     <p>0.56</p>
                  </c>
                  <c ca="left">
                     <p>0.67</p>
                  </c>
                  <c ca="left">
                     <p>0.11</p>
                  </c>
                  <c ca="left">
                     <p>0.21</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Ptr</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000145053</p>
                  </c>
                  <c ca="left">
                     <p>705</p>
                  </c>
                  <c ca="left">
                     <p>304</p>
                  </c>
                  <c ca="left">
                     <p>234</p>
                  </c>
                  <c ca="left">
                     <p>18(5.3&#8211;28.1)</p>
                  </c>
                  <c ca="left">
                     <p>1.03</p>
                  </c>
                  <c ca="left">
                     <p>0.57</p>
                  </c>
                  <c ca="left">
                     <p>1.64</p>
                  </c>
                  <c ca="left">
                     <p>0.12</p>
                  </c>
                  <c ca="left">
                     <p>0.29</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>tbr1</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000055502</p>
                  </c>
                  <c ca="left">
                     <p>666</p>
                  </c>
                  <c ca="left">
                     <p>256</p>
                  </c>
                  <c ca="left">
                     <p>170</p>
                  </c>
                  <c ca="left">
                     <p>14(3&#8211;25.6)</p>
                  </c>
                  <c ca="left">
                     <p>0.65</p>
                  </c>
                  <c ca="left">
                     <p>0.67</p>
                  </c>
                  <c ca="left">
                     <p>2.91</p>
                  </c>
                  <c ca="left">
                     <p>0.10</p>
                  </c>
                  <c ca="left">
                     <p>0.28</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ENC1</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000367269</p>
                  </c>
                  <c ca="left">
                     <p>810</p>
                  </c>
                  <c ca="left">
                     <p>312</p>
                  </c>
                  <c ca="left">
                     <p>248</p>
                  </c>
                  <c ca="left">
                     <p>16(6.7&#8211;24.3)</p>
                  </c>
                  <c ca="left">
                     <p>1.13</p>
                  </c>
                  <c ca="left">
                     <p>0.55</p>
                  </c>
                  <c ca="left">
                     <p>1.10</p>
                  </c>
                  <c ca="left">
                     <p>0.16</p>
                  </c>
                  <c ca="left">
                     <p>0.33</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Gylt</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000039808</p>
                  </c>
                  <c ca="left">
                     <p>870</p>
                  </c>
                  <c ca="left">
                     <p>463</p>
                  </c>
                  <c ca="left">
                     <p>335</p>
                  </c>
                  <c ca="left">
                     <p>21(6.6&#8211;29.7)</p>
                  </c>
                  <c ca="left">
                     <p>1.18</p>
                  </c>
                  <c ca="left">
                     <p>0.60</p>
                  </c>
                  <c ca="left">
                     <p>1.70</p>
                  </c>
                  <c ca="left">
                     <p>0.12</p>
                  </c>
                  <c ca="left">
                     <p>0.27</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>SH3PX3</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000117872</p>
                  </c>
                  <c ca="left">
                     <p>705</p>
                  </c>
                  <c ca="left">
                     <p>290</p>
                  </c>
                  <c ca="left">
                     <p>226</p>
                  </c>
                  <c ca="left">
                     <p>16(6.2&#8211;24)</p>
                  </c>
                  <c ca="left">
                     <p>1.11</p>
                  </c>
                  <c ca="left">
                     <p>0.55</p>
                  </c>
                  <c ca="left">
                     <p>1.53</p>
                  </c>
                  <c ca="left">
                     <p>0.14</p>
                  </c>
                  <c ca="left">
                     <p>0.22</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>plagl2</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000136964</p>
                  </c>
                  <c ca="left">
                     <p>675</p>
                  </c>
                  <c ca="left">
                     <p>250</p>
                  </c>
                  <c ca="left">
                     <p>184</p>
                  </c>
                  <c ca="left">
                     <p>14.3(5.1&#8211;21.5)</p>
                  </c>
                  <c ca="left">
                     <p>0.81</p>
                  </c>
                  <c ca="left">
                     <p>0.61</p>
                  </c>
                  <c ca="left">
                     <p>0.92</p>
                  </c>
                  <c ca="left">
                     <p>0.10</p>
                  </c>
                  <c ca="left">
                     <p>0.33</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>sreb2</p>
                  </c>
                  <c ca="left">
                     <p>ENSDARE00000029022</p>
                  </c>
                  <c ca="left">
                     <p>987</p>
                  </c>
                  <c ca="left">
                     <p>344</p>
                  </c>
                  <c ca="left">
                     <p>225</p>
                  </c>
                  <c ca="left">
                     <p>13(4&#8211;21.6)</p>
                  </c>
                  <c ca="left">
                     <p>0.85</p>
                  </c>
                  <c ca="left">
                     <p>0.61</p>
                  </c>
                  <c ca="left">
                     <p>0.88</p>
                  </c>
                  <c ca="left">
                     <p>0.11</p>
                  </c>
                  <c ca="left">
                     <p>0.23</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>RAG1</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>1344</p>
                  </c>
                  <c ca="left">
                     <p>684</p>
                  </c>
                  <c ca="left">
                     <p>514</p>
                  </c>
                  <c ca="left">
                     <p>20(8.1&#8211;29)</p>
                  </c>
                  <c ca="left">
                     <p>1.28</p>
                  </c>
                  <c ca="left">
                     <p>0.57</p>
                  </c>
                  <c ca="left">
                     <p>1.68</p>
                  </c>
                  <c ca="left">
                     <p>0.05</p>
                  </c>
                  <c ca="left">
                     <p>0.23</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>bp, base pairs; var., variable sites; PI, parsimony informative sites; Genetic distance, average uncorrected distance, number in parenthesis are range of the distances; Sub. rate, relative substitution rate estimated using Bayesian approach; CI-MP, consistency index; &#945;, gamma distribution shape parameter; RCV, relative composition variability.</p>
            </tblfn>
         </tbl>
         <suppl id="S2">
            <title>
               <p>Additional file 2</p>
            </title>
            <text>
               <p>Results of PCR amplification of 10 new makers in 36 species of ray-finned fishes.</p>
            </text>
            <file name="1471-2148-7-44-S2.rtf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <p>A phylogeny of the 14 taxa using concatenated sequences of all 10 markers (total of 7,872 bp) was inferred on the basis of protein and DNA sequences. For the protein sequence data, a JTT model with gamma parameter accounting for rate heterogeneity was selected by ProtTest <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. The data were partitioned by gene, as this strategy was favoured by the Akaike information criterion (AIC) over treating the concatenated sequences as a single partition. Maximum likelihood (ML) and Bayesian analysis (BA) resulted in the same tree (Figure <figr fid="F3">3a</figr>). A similar topology to Figure <figr fid="F3">3a</figr> was obtained by ML analysis of nucleotide sequences with RY-coded nucleotides to address potential artefacts due to base compositional bias <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. The positions of <it>Brotula </it>and <it>Morone </it>remain somewhat unresolved, receiving low bootstrap support and conflicting resolution based on either protein or RY-coded nucleotide data. When analyzed separately, all individual gene trees display low support in many branches and none of them has the same topology as the "total evidence" tree based on all 10 genes (see Additional file <supplr sid="S3">3</supplr>). However, only 6 individual genes exhibit significant differences with the total evidence tree (based on one tailed SH tests with p &lt; 0.05), the exceptions being myh6 (p = 0.113), Gylt (p = 0.091), plagl2 (p = 0.056)), and sreb2 (p = 0.080).</p>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>A comparison of the maximum likelihood phylogram inferred in this study with the conventional phylogeny</p>
            </caption>
            <text>
               <p><b>A comparison of the maximum likelihood phylogram inferred in this study with the conventional phylogeny</b>. (a) Left panel &#8211; the phylogram of 14 taxa inferred from protein sequences of 10 genes; (b) right panel &#8211; a "consensus" phylogeny following Nelson [50]. The numbers on the branches are Bayesian posterior probability, ML bootstrap values estimated from protein sequences and ML bootstrap values estimated from RY-coded nucleotide sequence. Asterisks indicate bootstrap supports less than 50.</p>
            </text>
            <graphic file="1471-2148-7-44-3"/>
         </fig>
         <suppl id="S3">
            <title>
               <p>Additional file 3</p>
            </title>
            <text>
               <p>Maximum likelihood phylogeny based on protein sequences of individual genes, zic1, myh6, RYR3, Ptr, tbr1, ENC1, Gylt, SH3PX3, plagl2, and sreb2. Bootstrap value higher than 50% were mapped on branches.</p>
            </text>
            <file name="1471-2148-7-44-S3.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The bioinformatic approach implemented in this study resulted in a large set (154 loci for the zebrafish and torafugu comparison) of candidate genes to infer high-level phylogeny of ray-finned fishes. The actual number of candidate loci depended on the genomes being compared and the fixed search parameters. Experimental tests of a smaller subset (15 loci) demonstrate that a large fraction (2/3) of these candidates are easily amplified by PCR from whole genomic DNA extractions in a vast diversity of fish taxa. The assumption that these loci are represented by a single copy in the fish genomes could not be rejected by the PCR assays in the species tested (all amplifications resulted in a single product), increasing the likelihood that the genetic markers are orthologous and suitable to infer organismal phylogeny. Our method is based on searching, under specific criteria, the available complete genomic databases of organisms closely related to the taxa of interest. Therefore, the same approach that is shown to be successful for fishes could be applied to other groups of organisms for which two or more complete genome sequences exist. Parameter values (L, S, and C) used for the search (Figure <figr fid="F2">2</figr>) may be altered to obtain fragments of different size or with different levels of conservation (i.e., less conserved for phylogenies of more closely related organisms).</p>
         <p>An alternative way to develop nuclear gene markers for phylogenetic studies is to construct a cDNA library or sequence several ESTs for a small pilot group of taxa, and then to design specific PCR primers to amplify the orthologous gene copy in all the other taxa of interest <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B46">46</abbr></abbrgrp>. The major potential problem with this approach stems from the fact that the method starts with a cDNA library or a set of EST sequences, with no prior knowledge of how many copies a gene has in each genome. As discussed above, this condition may lead to mistaken paralogy. In our approach, we search the genomic database to find single-copy candidates so no duplicate gene copies, if present, would be missed (see below).</p>
         <p>Recent studies have proposed whole genome duplication events during vertebrate evolution and also genome duplications restricted to ray-finned fishes <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>. Our results indicate that many single-copy genes still exist in a wide diversity of fish taxa (representing 28 orders of actinopterygian fishes), in agreement with previous estimates that a vast majority of duplicated genes are secondarily lost <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr></abbrgrp>. All 154 candidates were identified as single-copy genes in <it>D. rerio </it>and <it>T. rubripes</it>, according to our search criteria. Our results also show the 154 candidate genes are randomly distributed in the fish genome (at least among chromosomes of <it>D. rerio</it>). In the experimental tests, 10 out of 15 markers were found in single-copy condition in all successful amplifications, including the tetraploid species, <it>O. mykiss</it>. However, relaxing the search criteria, and conserving targets less than 50% similar in a subsequent blast search against the zebrafish genome, 7 of the 10 genes were found to have "alignable paralogs" (the 3 exceptions were myh6, tbr1, and Gylt). Genomes of medaka, stickleback, and fugu were also checked for these 3 genes, and no "paralogs" were detected, suggesting the sequences of ray-finned fish collected for these 3 genes are unambiguously orthologous to each other. Phylogenetic analyses for each of the 7 genes that include the putative paralogs found by this procedure produced tree topologies that strongly suggest an ancient duplication event in the vertebrate lineage, before the divergence of tetrapods from ray-finned fishes. Paralogous sequences are placed at the base of the tetrapod-actinopteryigian divergence, or as part of a basal polytomy with the other tetrapod and ray-finned fish sequences. In the terminology proposed by Remm et al. <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> these would be considered out-paralogs. In no case are these sequences nested among ingroup actinopterygian sequences (see Additional file <supplr sid="S4">4</supplr>), as would be the case expected for in-paralogs <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>. Stringent search critera implemented in our approach followed by phylogenetic analysis can distinguish between orthologs and putative our-paralogs. Although the method will not guarantee that single copy genes amplified by PCR in several taxa are orthologs as opposed to in-paralogs, the existence and identification of genome-scale single-copy nuclear markers should facilitate the construction of the tree of life, even if the evolutionary mechanism responsible for maintaining single-copy genes is poorly known <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>.</p>
         <suppl id="S4">
            <title>
               <p>Additional file 4</p>
            </title>
            <text>
               <p>ML phylogenies based on protein sequences of individual genes and their out-paralogs found by relaxing our search criteria to include fragments with similarity &lt; 50%.</p>
            </text>
            <file name="1471-2148-7-44-S4.pdf">
               <p>Click here for file</p>
            </file>
         </suppl>
         <p>The molecular evolutionary profiles of the 10 newly developed markers are in the same range as RAG-1, a widely-used gene marker in vertebrates. The genes with high treeness values have intermediate substitution rate, suggesting that optimal rate and base composition stationarity are important factors that determine the suitability of a phylogenetic marker. The phylogeny based on individual markers revealed incongruent phylogenetic signal among 6 of the 10 individual genes. This incongruence suggests that significant biases in the data might obscure the true phylogenetic signal in some individual genes, but the direction of the bias is hardly shared among genes (Additional file <supplr sid="S3">3</supplr>), justifying the use of genome-scale gene makers to infer organismal phylogeny.</p>
         <p>Finally, with respect to the phylogenetic results <it>per se</it>, there are two significant areas of discrepancy between the phylogeny obtained in this study (Figure <figr fid="F3">3a</figr>) and a consensus view of fish phylogeny (Figure <figr fid="F3">3b</figr>) <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>. Although these differences could be due to poor taxonomic sampling, we discuss them briefly. First, the traditional tree groups cichlids with other perciforms, whereas our results showed the cichlid <it>O. niloticus </it>is more closely related to atherinomorphs (Cyprinodontiformes + Beloniformes) than to other perciforms. This result also was supported by two recent studies analysing multiple nuclear genes <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B51">51</abbr></abbrgrp>. The second difference is that the traditional tree groups <it>Lycodes </it>with other perciforms, while <it>Lycodes </it>was found closely related to <it>Gasterosteus </it>(Gasterosteiformes) in our results. Interestingly, the sister-taxa relationship between <it>Lycodes </it>and <it>Gasterosteus </it>also is supported by recent studies using mitochondrial genome data <abbrgrp><abbr bid="B38">38</abbr><abbr bid="B52">52</abbr></abbrgrp>. The difference between our "total evidence" tree and the classical hypothesis is significant based on the new data, as indicated by a one-tailed Shimodaira-Hasegawa (SH) test (p = 0.000) <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We developed a genome-based approach to identify nuclear gene markers for phylogeny inference that are single-copy, contain large exons, and are conserved across extensive taxonomic distances. We show that our approach has practical value through direct experimentation on a representative sample of ray-finned fish, the largest vertebrate clade in need of phylogenetic resolution. The same approach, however, could be applied to other groups of organisms as long as two or more complete genome sequences are available. This research may have important implications for assembling the tree of life.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Genome-scale mining for phylogenetic markers</p>
            </st>
            <p>Whole genomic sequences of <it>Danio rerio </it>and <it>Takifugu rubripes </it>were retrieved from the ENSEMBL database <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>. Exon sequences with length > 800 bp were then extracted from the genome databases. The exons extracted were compared in two steps: (1) within-genome sequence comparisons and (2) between genome comparisons. The first step is designed to generate a set of single-copy nuclear gene exons (length > 800 bp) within each genome, whereas the second step should identify single-copy, putatively orthologous exons between <it>D. rerio </it>and <it>T. rubripes </it>(Figure <figr fid="F2">2</figr>). The BLAST algorithm was used for sequence similarity comparison. In addition to the parameters available in the BLAST program, we applied another parameter, coverage (C), to identify global sequence similarity between exons. The coverage was defined as the ratio of total length of locally aligned sequences over the length of query sequence. The similarity (S) was set to S &lt; 50% for within-genome comparison, which means that only genes that have no counterpart more than 50% similar to themselves were kept. The similarity was set to S &#215; > 70% and the coverage was set to C > 30% in cross-genome comparison, which selected genes that are 70% similar and 30% aligned between <it>D. rerio </it>and <it>T. rubripes</it>. Subsequent comparisons were performed on the newly available genome of stickleback (<it>Gasterosteus aculeatus</it>) and Japanese rice fish (<it>Oryzias latipes</it>), as described above. We programmed this procedure using PERL programming language to automate the processes and made the source code publicly available on our website <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>. We are in progress to make it available for other genomic sequences and parameter values.</p>
         </sec>
         <sec>
            <st>
               <p>Experimental testing for candidate markers</p>
            </st>
            <p>PCR and sequencing primers were designed on aligned sequences of <it>D. rerio </it>and <it>T. rubripes </it>for 15 random selected genes. Primer3 was used to design the primers <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. Degenerate primers and a nested-PCR design were used to assure the amplification for each gene in most of the taxa. Ten of the 15 genes tested were amplified with single fragment in most of the 36 taxa examined. PCR primers for 10 gene markers are listed in Table <tblr tid="T1">1</tblr>. The amplified fragments were directly sequenced, without cloning, using the BigDye system (Applied Biosystems). Sequences of the frequently used RAG1 gene were retrieved for the same taxa from GenBank for comparison to the newly developed markers [GenBank: <ext-link ext-link-type="gen" ext-link-id="AY430199">AY430199</ext-link>, <ext-link ext-link-type="gen" ext-link-id="NM_131389">NM_131389</ext-link>, <ext-link ext-link-type="gen" ext-link-id="U15663">U15663</ext-link>, <ext-link ext-link-type="gen" ext-link-id="AB120889">AB120889</ext-link>, <ext-link ext-link-type="gen" ext-link-id="DQ492511">DQ492511</ext-link>, <ext-link ext-link-type="gen" ext-link-id="AY308767">AY308767</ext-link>, <ext-link ext-link-type="gen" ext-link-id="AF108420">AF108420</ext-link>, <ext-link ext-link-type="gen" ext-link-id="EF033039">EF033039</ext-link> &#8211; <ext-link ext-link-type="gen" ext-link-id="EF033043">EF033043</ext-link>]. When RAG1 sequences for the same taxa were not available, a taxon of the same family was used, <it>i.e. Nimbochromis </it>was used instead of <it>Oreochromis </it>and <it>Neobythites </it>was used instead of <it>Brotula</it>.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic analysis</p>
            </st>
            <p>Sequences of the 10 new markers in the 14 taxa were used in phylogenetic analysis to assess their performance. Sequences were aligned using ClustalX <abbrgrp><abbr bid="B56">56</abbr></abbrgrp> on the translated protein sequences. Uncorrected genetic distances were calculated using PAUP <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>. Relative substitution rate for each markers were estimated using a Bayesian approach <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. Relative composition variability (RCV) and treeness were calculated following Phillips and Penny <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Prottest <abbrgrp><abbr bid="B45">45</abbr></abbrgrp> was used to chose the best model for protein sequence data and the AIC criteria to determine the scheme of data partitioning. Bayesian analysis implemented in MrBayes v3.1.1 and maximum likelihood analysis implemented in TreeFinder <abbrgrp><abbr bid="B59">59</abbr></abbrgrp> were performed on the protein sequences. One million generation with 4 chains were run for Bayesian analysis and the trees sampled prior to reaching convergence were discarded (as burnin) before computing the consensus tree and posterior probabilities. Two independent runs were used to provide additional confirmation of convergence of posterior probability distribution. Given the biased base composition in the nucleotide data indicated by the RCV value (Table <tblr tid="T2">2</tblr>), we analyzed the nucleotide data under the RY-coding scheme (C and T = Y, A and G = R), partitioned by gene in TreeFinder, since RY-coded data are less sensitive to base compositional bias <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. Alternative hypotheses were tested by one-tailed Shimodaira and Hasegawa (SH) test <abbrgrp><abbr bid="B53">53</abbr></abbrgrp> with 1000 RELL bootstrap replicates implemented in TreeFinder.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>CL conceived of the study, designed the bioinformatic pipeline, carried out the experimental tests, and drafted the manuscript. GO conceived of the study and helped to draft the manuscript. GZ implemented the bioinformatics pipeline and developed the web pages. GL conceived of the study, designed the bioinformatics pipeline and the web pages, and helped to draft the manuscript. All authors have read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by the grants from University of Nebraska-Lincoln (to C. L.), National Science Foundation DEB-9985045 (to G. O.) and University of Nebraska-Omaha (to G. L.). We thank Fred J. Potmesil and Thaine W. Rowley for help in computer programming.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Phylogenomics and the reconstruction of the tree of life</p>
            </title>
            <aug>
               <au>
                  <snm>Delsuc</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Brinkmann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Philippe</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Nat Rev Genet</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>5</issue>
            <fpage>361</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15861208</pubid>
                  <pubid idtype="doi">10.1038/nrg1603</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Relationships Between Gene Trees and Species Trees</p>
            </title>
            <aug>
               <au>
                  <snm>Pamilo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1988</pubdate>
            <volume>5</volume>
            <issue>5</issue>
            <fpage>568</fpage>
            <lpage>583</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">3193878</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Distinguishing homologous from analogous proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Fitch</snm>
                  <fnm>WM</fnm>
               </au>
            </aug>
            <source>Syst Zool</source>
            <pubdate>1970</pubdate>
            <volume>19</volume>
            <issue>2</issue>
            <fpage>99</fpage>
            <lpage>113</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">5449325</pubid>
                  <pubid idtype="doi">10.2307/2412448</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Heterotachy, an important process of protein evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Lopez</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Casane</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Philippe</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2002</pubdate>
            <volume>19</volume>
            <issue>1</issue>
            <fpage>1</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11752184</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Case in which parsimony or compatibility methods will be positively misleading.</p>
            </title>
            <aug>
               <au>
                  <snm>Felsenstein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>1978</pubdate>
            <volume>27</volume>
            <fpage>401</fpage>
            <lpage>410</lpage>
         </bibl>
         <bibl id="B6">
            <title>
               <p>The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction</p>
            </title>
            <aug>
               <au>
                  <snm>Weisburg</snm>
                  <fnm>WG</fnm>
               </au>
               <au>
                  <snm>Giovannoni</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Woese</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>Syst Appl Microbiol</source>
            <pubdate>1989</pubdate>
            <volume>11</volume>
            <fpage>128</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11542160</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Compositional bias may affect both DNA-based and protein-based phylogenetic reconstructions</p>
            </title>
            <aug>
               <au>
                  <snm>Foster</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Hickey</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1999</pubdate>
            <volume>48</volume>
            <issue>3</issue>
            <fpage>284</fpage>
            <lpage>290</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10093217</pubid>
                  <pubid idtype="doi">10.1007/PL00006471</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Phylogenomics: intersection of evolution and genomics</p>
            </title>
            <aug>
               <au>
                  <snm>Eisen</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Fraser</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2003</pubdate>
            <volume>300</volume>
            <issue>5626</issue>
            <fpage>1706</fpage>
            <lpage>1707</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12805538</pubid>
                  <pubid idtype="doi">10.1126/science.1086292</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Phylogenomics of eukaryotes: impact of missing data on large alignments</p>
            </title>
            <aug>
               <au>
                  <snm>Philippe</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Snell</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Bapteste</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Lopez</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Holland</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Casane</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2004</pubdate>
            <volume>21</volume>
            <issue>9</issue>
            <fpage>1740</fpage>
            <lpage>1752</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15175415</pubid>
                  <pubid idtype="doi">10.1093/molbev/msh182</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Prospects for building the tree of life from large sequence databases</p>
            </title>
            <aug>
               <au>
                  <snm>Driskell</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Ane</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Burleigh</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>McMahon</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>O'Meara B</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sanderson</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2004</pubdate>
            <volume>306</volume>
            <issue>5699</issue>
            <fpage>1172</fpage>
            <lpage>1174</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15539599</pubid>
                  <pubid idtype="doi">10.1126/science.1102036</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Molecular phylogeny of early vertebrates: monophyly of the agnathans as revealed by sequences of 35 genes</p>
            </title>
            <aug>
               <au>
                  <snm>Takezaki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Figueroa</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zaleska-Rutczynska</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2003</pubdate>
            <volume>20</volume>
            <issue>2</issue>
            <fpage>287</fpage>
            <lpage>292</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12598696</pubid>
                  <pubid idtype="doi">10.1093/molbev/msg040</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>The analysis of 100 genes supports the grouping of three highly divergent amoebae: Dictyostelium, Entamoeba, and Mastigamoeba</p>
            </title>
            <aug>
               <au>
                  <snm>Bapteste</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Brinkmann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>DV</fnm>
               </au>
               <au>
                  <snm>Sensen</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Gordon</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Durufle</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gaasterland</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Lopez</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Muller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Philippe</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <issue>3</issue>
            <fpage>1414</fpage>
            <lpage>1419</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11830664</pubid>
                  <pubid idtype="doi">10.1073/pnas.032662799</pubid>
                  <pubid idtype="pmcid">122205</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Genome-scale approaches to resolving incongruence in molecular phylogenies</p>
            </title>
            <aug>
               <au>
                  <snm>Rokas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>King</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Carroll</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>425</volume>
            <issue>6960</issue>
            <fpage>798</fpage>
            <lpage>804</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">14574403</pubid>
                  <pubid idtype="doi">10.1038/nature02053</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Molecular phylogenetics and the origins of placental mammals</p>
            </title>
            <aug>
               <au>
                  <snm>Murphy</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Eizirik</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>WE</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Ryder</snm>
                  <fnm>OA</fnm>
               </au>
               <au>
                  <snm>O'Brien</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2001</pubdate>
            <volume>409</volume>
            <issue>6820</issue>
            <fpage>614</fpage>
            <lpage>618</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11214319</pubid>
                  <pubid idtype="doi">10.1038/35054550</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Partitioned Bayesian analyses, partition choice, and the phylogenetic relationships of scincid lizards</p>
            </title>
            <aug>
               <au>
                  <snm>Brandley</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Schmitz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Reeder</snm>
                  <fnm>TW</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <issue>3</issue>
            <fpage>373</fpage>
            <lpage>390</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16012105</pubid>
                  <pubid idtype="doi">10.1080/10635150590946808</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Data partitions and complex models in Bayesian analysis: the phylogeny of Gymnophthalmid lizards</p>
            </title>
            <aug>
               <au>
                  <snm>Castoe</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Doan</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Parkinson</snm>
                  <fnm>CL</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2004</pubdate>
            <volume>53</volume>
            <issue>3</issue>
            <fpage>448</fpage>
            <lpage>469</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">15503673</pubid>
                  <pubid idtype="doi">10.1080/10635150490445797</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Novel evolutionary relationship among four fish model systems</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Ort&#237;</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <issue>9</issue>
            <fpage>424</fpage>
            <lpage>431</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15313551</pubid>
                  <pubid idtype="doi">10.1016/j.tig.2004.07.005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Animal evolution and the molecular signature of radiations compressed in time</p>
            </title>
            <aug>
               <au>
                  <snm>Rokas</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kruger</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Carroll</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2005</pubdate>
            <volume>310</volume>
            <issue>5756</issue>
            <fpage>1933</fpage>
            <lpage>1938</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16373569</pubid>
                  <pubid idtype="doi">10.1126/science.1116759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Generating single-copy nuclear gene data for a recent adaptive radiation</p>
            </title>
            <aug>
               <au>
                  <snm>Whittall</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Medina-Marino</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Zimmer</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Hodges</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2006</pubdate>
            <volume>39</volume>
            <issue>1</issue>
            <fpage>124</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16314114</pubid>
                  <pubid idtype="doi">10.1016/j.ympev.2005.10.010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Is sparse taxon sampling a problem for phylogenetic inference?</p>
            </title>
            <aug>
               <au>
                  <snm>Hillis</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Pollock</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>McGuire</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Zwickl</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2003</pubdate>
            <volume>52</volume>
            <issue>1</issue>
            <fpage>124</fpage>
            <lpage>126</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">12554446</pubid>
                  <pubid idtype="doi">10.1080/10635150390132911</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Genome-scale data, angiosperm relationships, and "ending incongruence": a cautionary tale in phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Soltis</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Albert</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Savolainen</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Hilu</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Qiu</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Chase</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Farris</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Stefanovic</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rice</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Palmer</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Soltis</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>Trends Plant Sci</source>
            <pubdate>2004</pubdate>
            <volume>9</volume>
            <issue>10</issue>
            <fpage>477</fpage>
            <lpage>483</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15465682</pubid>
                  <pubid idtype="doi">10.1016/j.tplants.2004.08.008</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Phylogenetic relaionships of new world needlefishes (Teleostei: Belonidae) and the biogeography of transitions between marine and freshwater habitats</p>
            </title>
            <aug>
               <au>
                  <snm>Lovejoy</snm>
                  <fnm>NR</fnm>
               </au>
               <au>
                  <snm>Collette</snm>
                  <fnm>BB</fnm>
               </au>
            </aug>
            <source>Copeia</source>
            <pubdate>2001</pubdate>
            <volume>2001</volume>
            <issue>2</issue>
            <fpage>324</fpage>
            <lpage>338</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1643/0045-8511(2001)001[0324:PRONWN]2.0.CO;2</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>C-mos, a nuclear marker useful for squamate phylogenetic analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Saint</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Austin</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Donnellan</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Hutchinson</snm>
                  <fnm>MN</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>1998</pubdate>
            <volume>10</volume>
            <issue>2</issue>
            <fpage>259</fpage>
            <lpage>263</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9878236</pubid>
                  <pubid idtype="doi">10.1006/mpev.1998.0515</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Gorilla and orangutan c-myc nucleotide sequences: inference on hominoid phylogeny</p>
            </title>
            <aug>
               <au>
                  <snm>Mohammad-Ali</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Eladari</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Galibert</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1995</pubdate>
            <volume>41</volume>
            <issue>3</issue>
            <fpage>262</fpage>
            <lpage>276</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">7563112</pubid>
                  <pubid idtype="doi">10.1007/BF01215173</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Basal divergences in birds and the phylogenetic utility of the nuclear RAG-1 gene</p>
            </title>
            <aug>
               <au>
                  <snm>Groth</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Barrowclough</snm>
                  <fnm>GF</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>1999</pubdate>
            <volume>12</volume>
            <issue>2</issue>
            <fpage>115</fpage>
            <lpage>123</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10381315</pubid>
                  <pubid idtype="doi">10.1006/mpev.1998.0603</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Relative apparent synapomorphy analysis (RASA). I: The statistical measurement of phylogenetic signal</p>
            </title>
            <aug>
               <au>
                  <snm>Lyons-Weiler</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hoelzer</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Tausch</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1996</pubdate>
            <volume>13</volume>
            <issue>6</issue>
            <fpage>749</fpage>
            <lpage>757</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8754211</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Heterotachy and long-branch attraction in phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Philippe</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Brinkmann</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Rodrigue</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Delsuc</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>BMC Evol Biol</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>50</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16209710</pubid>
                  <pubid idtype="doi">10.1186/1471-2148-5-50</pubid>
                  <pubid idtype="pmcid">1274308</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Choosing the best genes for the job: the case for stationary genes in genome-scale phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Collins</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Fedrigo</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Naylor</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>2005</pubdate>
            <volume>54</volume>
            <issue>3</issue>
            <fpage>493</fpage>
            <lpage>500</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16012114</pubid>
                  <pubid idtype="doi">10.1080/10635150590947339</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Confidence in evolutionary trees from biological sequence data</p>
            </title>
            <aug>
               <au>
                  <snm>Steel</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Lockhart</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Penny</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1993</pubdate>
            <volume>364</volume>
            <issue>6436</issue>
            <fpage>440</fpage>
            <lpage>442</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">8332213</pubid>
                  <pubid idtype="doi">10.1038/364440a0</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Genome-scale phylogeny and the detection of systematic biases</p>
            </title>
            <aug>
               <au>
                  <snm>Phillips</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Delsuc</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Penny</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2004</pubdate>
            <volume>21</volume>
            <issue>7</issue>
            <fpage>1455</fpage>
            <lpage>1458</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15084674</pubid>
                  <pubid idtype="doi">10.1093/molbev/msh137</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Zebrafish hox clusters and vertebrate genome evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Amores</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Force</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yan</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Joly</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Amemiya</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fritz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Langeland</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Prince</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Westerfield</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ekker</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Postlethwait</snm>
                  <fnm>JH</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1998</pubdate>
            <volume>282</volume>
            <issue>5394</issue>
            <fpage>1711</fpage>
            <lpage>1714</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9831563</pubid>
                  <pubid idtype="doi">10.1126/science.282.5394.1711</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>From 2R to 3R: evidence for a fish-specific genome duplication (FSGD)</p>
            </title>
            <aug>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Van de Peer</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Bioessays</source>
            <pubdate>2005</pubdate>
            <volume>27</volume>
            <issue>9</issue>
            <fpage>937</fpage>
            <lpage>945</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16108068</pubid>
                  <pubid idtype="doi">10.1002/bies.20293</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Complex genomic rearrangements lead to novel primate gene function</p>
            </title>
            <aug>
               <au>
                  <snm>Ciccarelli</snm>
                  <fnm>FD</fnm>
               </au>
               <au>
                  <snm>von Mering</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Suyama</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Harrington</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Izaurralde</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bork</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <issue>3</issue>
            <fpage>343</fpage>
            <lpage>351</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15710750</pubid>
                  <pubid idtype="doi">10.1101/gr.3266405</pubid>
                  <pubid idtype="pmcid">551560</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>The zebrafish gene map defines ancestral vertebrate chromosomes</p>
            </title>
            <aug>
               <au>
                  <snm>Woods</snm>
                  <fnm>IG</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Friedlander</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Reyes</snm>
                  <fnm>DK</fnm>
               </au>
               <au>
                  <snm>Nix</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Kelly</snm>
                  <fnm>PD</fnm>
               </au>
               <au>
                  <snm>Chu</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Postlethwait</snm>
                  <fnm>JH</fnm>
               </au>
               <au>
                  <snm>Talbot</snm>
                  <fnm>WS</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <issue>9</issue>
            <fpage>1307</fpage>
            <lpage>1314</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16109975</pubid>
                  <pubid idtype="doi">10.1101/gr.4134305</pubid>
                  <pubid idtype="pmcid">1199546</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype</p>
            </title>
            <aug>
               <au>
                  <snm>Jaillon</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Aury</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Brunet</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Petit</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Stange-Thomann</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mauceli</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bouneau</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Ozouf-Costaz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Bernot</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nicaud</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Jaffe</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Fisher</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lutfalla</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Dossat</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Segurens</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Dasilva</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Salanoubat</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Levy</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Boudet</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Castellano</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Anthouard</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Jubin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Castelli</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Katinka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Vacherie</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Biemont</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Skalli</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Cattolico</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Poulain</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>De Berardinis</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Cruaud</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Duprat</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brottier</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Coutanceau</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Gouzy</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Parra</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lardier</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Chapple</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>McKernan</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>McEwan</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bosak</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kellis</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Volff</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Guigo</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Zody</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Mesirov</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lindblad-Toh</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Birren</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nusbaum</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kahn</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Robinson-Rechavi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Laudet</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Schachter</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Quetier</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Saurin</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Scarpelli</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Wincker</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lander</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Weissenbach</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Roest Crollius</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2004</pubdate>
            <volume>431</volume>
            <issue>7011</issue>
            <fpage>946</fpage>
            <lpage>957</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15496914</pubid>
                  <pubid idtype="doi">10.1038/nature03025</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Vertebrate phylogenomics: reconciled trees and gene duplications</p>
            </title>
            <aug>
               <au>
                  <snm>Page</snm>
                  <fnm>RD</fnm>
               </au>
               <au>
                  <snm>Cotton</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Pac Symp Biocomput</source>
            <pubdate>2002</pubdate>
            <fpage>536</fpage>
            <lpage>547</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11928506</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Nuclear gene sequences for higher level phylogenetic analysis: 14 promising candidates.</p>
            </title>
            <aug>
               <au>
                  <snm>Friedlander</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Regier</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Mitter</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Syst Biol</source>
            <pubdate>1992</pubdate>
            <volume>41</volume>
            <issue>4</issue>
            <fpage>483</fpage>
            <lpage>490</lpage>
            <xrefbib>
               <pubid idtype="doi">10.2307/2992589</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Miya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Takeshima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Endo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ishiguro</snm>
                  <fnm>NB</fnm>
               </au>
               <au>
                  <snm>Inoue</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Mukai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Satoh</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kawaguchi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mabuchi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shirai</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Nishida</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2003</pubdate>
            <volume>26</volume>
            <issue>1</issue>
            <fpage>121</fpage>
            <lpage>138</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12470944</pubid>
                  <pubid idtype="doi">10.1016/S1055-7903(02)00332-9</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Gnathostome fishes</p>
            </title>
            <aug>
               <au>
                  <snm>Stiassny</snm>
                  <fnm>MLJ</fnm>
               </au>
               <au>
                  <snm>Wiley</snm>
                  <fnm>EO</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>GD</fnm>
               </au>
               <au>
                  <snm>de Carvalho</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Assembling The Tree of Life</source>
            <publisher>New York , Oxford University Press</publisher>
            <editor>Cracraft J, Donoghue MJ</editor>
            <pubdate>2004</pubdate>
            <fpage>410</fpage>
            <lpage>429</lpage>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Interrelationships of fishes</p>
            </title>
            <aug>
               <au>
                  <snm>Stiassny</snm>
                  <fnm>MLJ</fnm>
               </au>
               <au>
                  <snm>Parenti</snm>
                  <fnm>LR</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>GD</fnm>
               </au>
            </aug>
            <publisher>San Diego , Academic Press</publisher>
            <pubdate>1996</pubdate>
            <fpage>xiii, 496 p.</fpage>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Phylogenetic relationships of teleostei: past and present</p>
            </title>
            <aug>
               <au>
                  <snm>Arratia</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Estud Oceanol</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>19</fpage>
            <lpage>51</lpage>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Interrelationships of fishes.</p>
            </title>
            <aug>
               <au>
                  <snm>Greenwood</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Miles</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Patterson</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <publisher>London , Academic Press</publisher>
            <pubdate>1973</pubdate>
            <fpage>536 p.</fpage>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Phylomarker - mining phylogenetic markers for assembling the Tree of Life [http://bioinfo-srv1.awh.unomaha.edu/phylomarker]</p>
            </title>
         </bibl>
         <bibl id="B44">
            <title>
               <p>The root of the mammalian tree inferred from whole mitochondrial genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Phillips</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Penny</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2003</pubdate>
            <volume>28</volume>
            <issue>2</issue>
            <fpage>171</fpage>
            <lpage>185</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12878457</pubid>
                  <pubid idtype="doi">10.1016/S1055-7903(03)00057-5</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>ProtTest: selection of best-fit models of protein evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Abascal</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Zardoya</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Posada</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <issue>9</issue>
            <fpage>2104</fpage>
            <lpage>2105</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15647292</pubid>
                  <pubid idtype="doi">10.1093/bioinformatics/bti263</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>L. A. S. Johnson Review No. 2. Use of nuclear genes for phylogeny reconstruction in plants</p>
            </title>
            <aug>
               <au>
                  <snm>Small</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Cronn</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Wendel</snm>
                  <fnm>JF</fnm>
               </au>
            </aug>
            <source>Australian Systematic Botany</source>
            <pubdate>2004</pubdate>
            <volume>17</volume>
            <fpage>145</fpage>
            <lpage>170</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1071/SB03015</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Genome duplication, a trait shared by 22000 species of ray-finned fish</p>
            </title>
            <aug>
               <au>
                  <snm>Taylor</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Braasch</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Frickey</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Van de Peer</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2003</pubdate>
            <volume>13</volume>
            <issue>3</issue>
            <fpage>382</fpage>
            <lpage>390</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12618368</pubid>
                  <pubid idtype="doi">10.1101/gr.640303</pubid>
                  <pubid idtype="pmcid">430266</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Are all fishes ancient polyploids?</p>
            </title>
            <aug>
               <au>
                  <snm>Van de Peer</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Taylor</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Struct Funct Genomics</source>
            <pubdate>2003</pubdate>
            <volume>3</volume>
            <issue>1-4</issue>
            <fpage>65</fpage>
            <lpage>73</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12836686</pubid>
                  <pubid idtype="doi">10.1023/A:1022652814749</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Automatic clustering of orthologs and in-paralogs from pairwise species comparisons</p>
            </title>
            <aug>
               <au>
                  <snm>Remm</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Storm</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Sonnhammer</snm>
                  <fnm>EL</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2001</pubdate>
            <volume>314</volume>
            <issue>5</issue>
            <fpage>1041</fpage>
            <lpage>1052</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">11743721</pubid>
                  <pubid idtype="doi">10.1006/jmbi.2000.5197</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Fishes of the world</p>
            </title>
            <aug>
               <au>
                  <snm>Nelson</snm>
                  <fnm>JS</fnm>
               </au>
            </aug>
            <publisher>New York , John Wiley and Sons, Inc.</publisher>
            <edition>4th</edition>
            <pubdate>2006</pubdate>
            <fpage>601 pp.</fpage>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Novel Relationships Among Ten Fish Model Species Revealed Based on a Phylogenomic Analysis Using ESTs</p>
            </title>
            <aug>
               <au>
                  <snm>Steinke</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Salzburger</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Meyer</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>2006</pubdate>
            <volume>62</volume>
            <issue>6</issue>
            <fpage>772</fpage>
            <lpage>784</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">16752215</pubid>
                  <pubid idtype="doi">10.1007/s00239-005-0170-8</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>The phylogenetic position of toadfishes (order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned Bayesian analysis of 102 whole mitochondrial genome sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Miya</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Satoh</snm>
                  <fnm>TP</fnm>
               </au>
               <au>
                  <snm>Nishida</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Biol J Linn Sco Lond</source>
            <pubdate>2005</pubdate>
            <volume>85</volume>
            <fpage>289</fpage>
            <lpage>306</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1111/j.1095-8312.2005.00483.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Multiple comparisons of log-likelihoods with applications to phylogenetic inference</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>1114</fpage>
            <lpage>1116</lpage>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Ensembl [www.ensembl.org/index.html]</p>
            </title>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Primer3 on the WWW for general users and for biologist programmers</p>
            </title>
            <aug>
               <au>
                  <snm>Rozen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Skaletsky</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Methods Mol Biol</source>
            <pubdate>2000</pubdate>
            <volume>132</volume>
            <fpage>365</fpage>
            <lpage>386</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10547847</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Plewniak</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jeanmougin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <issue>24</issue>
            <fpage>4876</fpage>
            <lpage>4882</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9396791</pubid>
                  <pubid idtype="doi">10.1093/nar/25.24.4876</pubid>
                  <pubid idtype="pmcid">147148</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. </p>
            </title>
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <publisher> Sinauer Associates, Sunderland, Massachusetts.</publisher>
            <pubdate>2003</pubdate>
         </bibl>
         <bibl id="B58">
            <title>
               <p>MrBayes 3: Bayesian phylogenetic inference under mixed models</p>
            </title>
            <aug>
               <au>
                  <snm>Ronquist</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Huelsenbeck</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <issue>12</issue>
            <fpage>1572</fpage>
            <lpage>1574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">12912839</pubid>
                  <pubid idtype="doi">10.1093/bioinformatics/btg180</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Jobb</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>von Haeseler</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Strimmer</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>BMC Evol Biol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>18</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">15222900</pubid>
                  <pubid idtype="doi">10.1186/1471-2148-4-18</pubid>
                  <pubid idtype="pmcid">459214</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
