<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-2148-6-10</ui>
   <ji>1471-2148</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Polyphyly of the hawk genera <it>Leucopternis </it>and <it>Buteogallus </it>(Aves, Accipitridae): multiple habitat shifts during the Neotropical buteonine diversification</p>
         </title>
         <aug>
            <au id="A1" ca="yes">
               <snm>do Amaral</snm>
               <mnm>S Raposo</mnm>
               <fnm>Fabio</fnm>
               <insr iid="I1"/>
               <email>fabioraposo@hotmail.com</email>
            </au>
            <au id="A2">
               <snm>Miller</snm>
               <mi>J</mi>
               <fnm>Matthew</fnm>
               <insr iid="I2"/>
               <email>millerma@si.edu</email>
            </au>
            <au id="A3">
               <snm>Silveira</snm>
               <mnm>F&#225;bio</mnm>
               <fnm>Lu&#237;s</fnm>
               <insr iid="I3"/>
               <email>lfsilvei@usp.br</email>
            </au>
            <au id="A4">
               <snm>Bermingham</snm>
               <fnm>Eldredge</fnm>
               <insr iid="I2"/>
               <email>bermingb@si.edu</email>
            </au>
            <au id="A5">
               <snm>Wajntal</snm>
               <fnm>Anita</fnm>
               <insr iid="I1"/>
               <email>aniwa@usp.br</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Departamento de Gen&#233;tica e Biologia Evolutiva, Universidade de S&#227;o Paulo, S&#227;o Paulo. Rua do Mat&#227;o, 277, Cidade Universit&#225;ria, S&#227;o Paulo, SP, CEP 05508-900, Brasil</p>
            </ins>
            <ins id="I2">
               <p>Smithsonian Tropical Research Institute, Apartado 2072, Balboa, Panam&#225;</p>
            </ins>
            <ins id="I3">
               <p>Departamento de Zoologia, Universidade de S&#227;o Paulo, S&#227;o Paulo. Rua do Mat&#227;o, Travessa 14, n&#176; 321, Cidade Universit&#225;ria, S&#227;o Paulo, SP, CEP 05508-900, Brasil</p>
            </ins>
         </insg>
         <source>BMC Evolutionary Biology</source>
         <issn>1471-2148</issn>
         <pubdate>2006</pubdate>
         <volume>6</volume>
         <issue>1</issue>
         <fpage>10</fpage>
         <url>http://www.biomedcentral.com/1471-2148/6/10</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">16464261</pubid>
               <pubid idtype="doi">10.1186/1471-2148-6-10</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>30</day>
               <month>8</month>
               <year>2005</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>07</day>
               <month>2</month>
               <year>2006</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>07</day>
               <month>2</month>
               <year>2006</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2006</year>
         <collab>do Amaral et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The family Accipitridae (hawks, eagles and Old World vultures) represents a large radiation of predatory birds with an almost global distribution, although most species of this family occur in the Neotropics. Despite great morphological and ecological diversity, the evolutionary relationships in the family have been poorly explored at all taxonomic levels. Using sequences from four mitochondrial genes (12S, ATP8, ATP6, and ND6), we reconstructed the phylogeny of the Neotropical forest hawk genus <it>Leucopternis </it>and most of the allied genera of Neotropical buteonines. Our goals were to infer the evolutionary relationships among species of <it>Leucopternis</it>, estimate their relationships to other buteonine genera, evaluate the phylogenetic significance of the white and black plumage patterns common to most <it>Leucopternis </it>species, and assess general patterns of diversification of the group with respect to species' affiliations with Neotropical regions and habitats.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Our molecular phylogeny for the genus <it>Leucopternis </it>and its allies disagrees sharply with traditional taxonomic arrangements for the group, and we present new hypotheses of relationships for a number of species. The mtDNA phylogenetic trees derived from analysis of the combined data posit a polyphyletic relationship among species of <it>Leucopternis</it>, <it>Buteogallus </it>and <it>Buteo</it>. Three highly supported clades containing <it>Leucopternis </it>species were recovered in our phylogenetic reconstructions. The first clade consisted of the sister pairs <it>L. lacernulatus </it>and <it>Buteogallus meridionalis</it>, and <it>Buteogallus urubitinga </it>and <it>Harpyhaliaetus coronatus</it>, in addition to <it>L. schistaceus </it>and <it>L. plumbeus</it>. The second clade included the sister pair <it>Leucopternis albicollis </it>and <it>L. occidentalis </it>as well as <it>L. polionotus</it>. The third lineage comprised the sister pair <it>L. melanops </it>and <it>L. kuhli</it>, in addition to <it>L. semiplumbeus </it>and <it>Buteo buteo</it>. According to our results, the white and black plumage patterns have evolved at least twice in the group. Furthermore, species found to the east and west of the Andes (<it>cis-</it>Andean and <it>trans-</it>Andean, respectively) are not reciprocally monophyletic, nor are forest and non-forest species.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The polyphyly of <it>Leucopternis</it>, <it>Buteogallus </it>and <it>Buteo </it>establishes a lack of concordance of current Accipitridae taxonomy with the mtDNA phylogeny for the group, and points to the need for further phylogenetic analysis at all taxonomic levels in the family as also suggested by other recent analyses. Habitat shifts, as well as <it>cis- </it>and <it>trans</it>-Andean disjunctions, took place more than once during buteonine diversification in the Neotropical region. Overemphasis of the black and white plumage patterns has led to questionable conclusions regarding the relationships of <it>Leucopternis </it>species, and suggests more generally that plumage characters should be used with considerable caution in the taxonomic evaluation of the Accipitridae.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The family Accipitridae comprises approximately 237 species of predatory birds distributed worldwide except Antarctica <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, with diversity concentrated in the Neotropics <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Despite numerous taxonomic revisions (e.g., <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>), the evolutionary history of the family has not been sufficiently explored using methods of phylogenetic inference, and current classifications are mainly based on plumage and ecological resemblance between taxa <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Current taxonomy is still highly provisional at all taxonomic levels <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B6">6</abbr></abbrgrp>, and does not appear to reflect phylogenetic relationships in several cases <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr></abbrgrp>, thus retarding biogeographic analysis, morphological trait mapping and the general understanding of the evolutionary history of the Accipitridae.</p>
         <p>The Accipitridae morphological diversity has been traditionally represented in sub-groups of similar or supposedly closely related species, such as "kites", "harriers", "booted eagles" and "buteonines" <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. The buteonine hawks are represented by the large cosmopolitan genus <it>Buteo </it>and several related genera, called "sub-buteonines" by Amadon <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, which includes the predominantly Neotropical genera <it>Buteogallus, Parabuteo, Asturina, Leucopternis, Busarellus, Geranoaetus, Geranospiza </it>and <it>Harpyhaliaetus</it>. Two old world genera, <it>Kaupifalco </it>and <it>Butastur</it>, were formerly included as part of the "sub-buteonines" group, but were subsequently removed from this division <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. Some authors consider the buteonine as a sub-family (Buteonineae, <it>e.g</it>. Friedman <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>, Grossman and Hamlet <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>), but formal sub-familial division of Accipitridae has been a contentious issue due to a lack of knowledge of the evolutionary history of the family (see <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B12">12</abbr></abbrgrp>).</p>
         <p>Evolutionary biologists have long sought to understand the processes responsible for the generation of the high species richness found in the Neotropics, and several models of biotic diversification have been invoked to explain such patterns, for example forest refuges resulting from climatic fluctuations <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>, rivers as barriers to gene flow <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, river dynamics <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, sea level oscillations <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>, geotectonic vicariance <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and ecological factors <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> (see Moritz <it>et al</it>. <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> for a revision). However, these models have only rarely been tested with organisms capable of long-distance dispersal (e.g., <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>), such as hawks and eagles capable of soaring and gliding flight. Numerous flocks of migrant hawk species as <it>Buteo platypterus </it>and <it>Buteo swainsoni</it>, for example, cross the Andes as part of their yearly migrations <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, and call into question the degree to which the geographical barriers to gene flow identified in many models of Neotropical diversification have been important in Accipitridae speciation.</p>
         <p>The genus <it>Leucopternis </it>is a morphologically heterogeneous group of 10 buteonine species distributed in forested habitats from southern Mexico to Paraguay and Uruguay <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, and offers an opportunity to explore the diversification of an Accipitridae group distributed throughout the Neotropical region. Species in the genus vary from the small <it>L. semiplumbeus </it>(250 g) to the large <it>L. princeps </it>(1 kg) <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, and are hawks with broad wings and medium to short tails. Two species, <it>L. schistaceus </it>and <it>L. plumbeus</it>, are entirely dark slate; however, most <it>Leucopternis </it>have primarily white plumage and vary in the amount of black, grey or slate black on the back, wings and/or head. Those which we here refer to as "black-and-white" <it>Leucopternis </it>species are <it>L. albicollis</it>, <it>L. polionotus, L. occidentalis, L. lacernulatus, L. melanops, L. kuhli</it>, <it>L. semiplumbeus</it>, and <it>L. princeps </it><abbrgrp><abbr bid="B1">1</abbr><abbr bid="B6">6</abbr></abbrgrp>. While <it>Leucopternis </it>are found exclusively in forest habitats, other Neotropical buteonine species occur in a variety of habitats, such as mangroves (<it>Buteogallus aequinoctialis</it>), savannahs (<it>Harpyhaliaetus coronatus, Buteogallus meridionalis</it>) and wetlands (<it>Busarellus nigricollis</it>) <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B6">6</abbr></abbrgrp>, which makes this group suitable to analysis of the evolutionary relationships of forest and non-forest species.</p>
         <p>The buteonine phylogeny has been partially explored recently using morphological and molecular data <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp>, but Neotropical species have not been well represented. Incomplete taxon sampling notwithstanding, these analyses have called into question the monophyly of <it>Leucopternis</it>, <it>Buteo </it>and <it>Buteogallus </it><abbrgrp><abbr bid="B7">7</abbr><abbr bid="B28">28</abbr></abbrgrp>. The present work constitutes an effort to clarify the relationships among all <it>Leucopternis </it>species, and their position relative to other Neotropical buteonine genera. We address the following questions: (1) Is <it>Leucopternis </it>as currently recognized monophyletic? (2) What are the relationships among species of <it>Leucopternis </it>to other genera of buteonine hawks? (3) Is the black and white plumage pattern a synapomorphic trait uniting the majority of species in the genus <it>Leucopternis</it>? (4) Are phylogenetic relationships among Neotropical buteonines predicted by biogeography or habitat?</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Datasets, molecular variation</p>
            </st>
            <p>Our final alignment of the total dataset (12S, ATP8 and 6 and ND6) without gaps totalled 2179 base pairs, with 651 variable and 505 parsimony informative sites. Uncorrected distances ranged from 0 to 7.1% for 12S (without gaps), 0 to 21.4% for ATP8, 0 to 11.9% for ATP6, and 0 to 13.9% for ND6. Deviations from linearity were found in third position plots of ATP8, ATP6 and ND6. We did not detect significant departures from homogeneity of base frequencies across taxa in any dataset (P > 0.05, data not shown). We are confident of mitochondrial origin of our sequences because: (1) most of our samples were represented by mitochondrial-rich tissues (feathers, muscle or liver); (2) most samples (comprising 12 of 20 species) had all regions sequenced using independent fragments amplified with different primer sets (with sequence overlap ranging from 67 to more than 400bp, in highly variable regions), and sequences were identical; (3) sequences were easily aligned to published sequences of other Accipitridae species; (4) electropherograms were carefully checked for double peaks; (5) coding regions did not show unexpected stop codons; and 6) gene specific phylogenetic analyses revealed similar relationships to those inferred from the combined data, indicating that a mitochondrial translocation to the nucleus would have to have been more than eight kilobases in length.</p>
            <p>A single nucleotide site in the 12S sequence of the muscle sample LGEMA F39 (<it>L. lacernulatus</it>) presented a strong "C" peak with a lower "A" peak at the position 593, and this same pattern persisted in sequences obtained from amplifications using three different primer combinations, with sizes ranging from approximately 800 to 2700 bp. The sequence can be easily aligned and has a base composition similar to other published sequences for the Accipitridae. We could not find any evidence of pseudogene amplification, and since it has been suggested that PCR amplifications larger than 1.5 kilobases are likely to represent true mitochondrial amplifications <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, this site was coded as "M" (IUPAC code representing C and A) in all analyses, and it may represent an example of mitochondrial heteroplasmy.</p>
         </sec>
         <sec>
            <st>
               <p>Phylogenetic analysis, single and combined datasets</p>
            </st>
            <p>None of the phylogenetic analyses supported the monophyly of the hawk genera <it>Leucopternis</it>, <it>Buteogallus </it>or <it>Buteo</it>. Phylogenies inferred from the subsets of mtDNA genes and combined data were largely congruent under all optimization criteria, and topologies differed mainly in resolution and nodal support. Although phylogenetic analysis of single gene subsets resulted in poorly resolved trees (data not shown), the nodes identified with high bootstrap support (> 75) or posterior probabilities (> 0.95) were entirely congruent with those identified in the combined analyses.</p>
            <p>The maximum likelihood (ML) inference of the total dataset resulted in one completely resolved tree with likelihood -ln 9813.2993 (figure <figr fid="F1">1</figr>), which was identical to the majority rule consensus topology of the Bayesian analysis (BA). Most nodes were highly supported by both bootstrap proportions and posterior probabilities. Maximum parsimony (MP) analyses of the total dataset resulted in two equally parsimonious trees (1531 steps, CI = 0.4899, RI= 0.6938) (trees not shown), which were also highly congruent with the ML and BA inferences. The main differences between the MP trees and the other combined analyses were the position of <it>L. princeps </it>basal to Clades 2 and 3 plus the remaining <it>Buteo </it>species and <it>Parabuteo unicinctus </it>(bootstrap support 68, data not shown), and the position of <it>L. schistaceus </it>basal to a poorly supported clade containing the sister pairs <it>Buteogallus meridionalis </it>and <it>L. lacernulatus</it>, and <it>H. coronatus </it>and <it>Buteogallus urubitinga </it>(bootstrap support &lt; 50, data not shown).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Maximum likelihood topology of <it>Leucopternis </it>species and other Neotropical buteonines obtained from the combined data</p>
               </caption>
               <text>
                  <p><b>Maximum likelihood topology of <it>Leucopternis </it>species and other Neotropical buteonines obtained from the combined data</b>. Numbers to the left of the node represent maximum likelihood bootstrap proportions (before slash) and Bayesian posterior probabilities (after slash). The branch leading to the outgroup was shortened for illustrative purposes.</p>
               </text>
               <graphic file="1471-2148-6-10-1"/>
            </fig>
            <p>Three major mtDNA clades containing <it>Leucopternis </it>species (figure <figr fid="F1">1</figr>) were recovered in all combined analysis, with high levels of statistical support in most cases. Clade 1 included <it>Buteogallus meridionalis, L. lacernulatus</it>, <it>Buteogallus urubitinga</it>, <it>H. coronatus</it>, <it>L. schistaceus and L. plumbeus</it>; <it>Leucopternis princeps </it>was basal to this Clade 1 in the ML and BA analyses, but with low support. The ML and BA analyses strongly supported a sister relationship between <it>L. lacernulatus </it>and <it>Buteogallus meridionalis</it>, and between <it>H. coronatus </it>and <it>B. urubitinga</it>; the latter sister pair was also highly supported by parsimony bootstrap (bootstrap support 98, data not shown). There was weaker support for a sister relationship between <it>L. schistaceus </it>and <it>Buteogallus meridionalis </it>plus <it>L. lacernulatus</it>, obtained in the ML and BA analyses. All phylogenetic trees inferred from the combined dataset establish an early split of <it>L. plumbeus </it>from the rest of the Clade 1.</p>
            <p>Clade 2 comprised the two sampled <it>L. albicollis </it>subspecies (which carried identical mtDNA sequences), <it>L. occidentalis </it>and <it>L. polionotus</it>. Clade 3 was sister to Clade 2 and included <it>L. semiplumbeus</it>, <it>L. melanops </it>and <it>L. kuhli </it>sister to <it>Buteo buteo</it>. <it>Buteo albicaudatus</it>, <it>Buteo magnirostris</it>, <it>Parabuteo unicinctus </it>and <it>Buteo leucorrhous </it>were outside the sister relationship of Clade 2 and Clade 3 in all analyses. There was strong support in the ML, MP and BA trees obtained from the combined dataset for a sister relationship between <it>Buteo leucorrhous </it>and <it>P. unicinctus</it>.</p>
            <p>Shimodaira-Hasegawa tests were conducted on topologies constrained by the monophyly of all species in the genus <it>Leucopternis</it>, monophyly of species with the black and white plumage pattern, monophyly of all forest species, and reciprocal monophyly of the <it>cis- </it>and <it>trans</it>-Andean species. In all tests the constraint trees had a significantly poorer fit to the data than the unconstrained ML tree (P &lt; 0.001). Ancestral state reconstructions of habitat and plumage traits onto the ML tree using unordered parsimony (Figure <figr fid="F2">2</figr>) showed that the black-and-white plumage characteristic to most <it>Leucopternis </it>species evolved at least twice in Neotropical buteonines, and shifts between forest and open habitats occurred at least four times.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Ancestral state reconstruction of habitat preferences and plumage characters of <it>Leucopternis </it>species and Neotropical buteonines</p>
               </caption>
               <text>
                  <p><b>Ancestral state reconstruction of habitat preferences and plumage characters of <it>Leucopternis </it>species and Neotropical buteonines. </b>Reconstructions determined by unordered parsimony using the ML topology obtained from the combined dataset. Species of <it>Leucopternis </it>and <it>Buteogallus </it>are indicated in red and blue. AF represents Atlantic Forest.</p>
               </text>
               <graphic file="1471-2148-6-10-2"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <sec>
            <st>
               <p>Phylogenetic relationships, novel groupings, and evolution of common plumage patterns</p>
            </st>
            <p>The mtDNA-based phylogenies for Neotropical buteonines reject the monophyly of the genera <it>Leucopternis</it>, <it>Buteogallus </it>and <it>Buteo</it>. Our analysis provides another example of the lack of correspondence between classic taxonomic groupings within the Accipitridae and molecular phylogenies <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B28">28</abbr></abbrgrp>. The genus <it>Leucopternis </it>is a composite of three independent lineages, and several <it>Leucopternis </it>species are more closely related to other buteonine taxa than to each other.</p>
            <p>One of the novel phylogenetic arrangements presented here is the sister relationship between <it>L. lacernulatu</it>s and <it>Buteogallus meridionalis</it>, rather than between <it>L. lacernulatus </it>and the sympatric Atlantic forest endemic <it>L. polionotus</it>, despite overall similarities in plumage pattern between the latter pair (see <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>). A proposed close relationship <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B4">4</abbr><abbr bid="B12">12</abbr><abbr bid="B30">30</abbr></abbrgrp> between <it>L. lacernulatus </it>and the <it>L. melanops/L. kuhli </it>complex was not supported in any of our analyses.</p>
            <p>Although close association of <it>L. lacernulatus </it>and <it>B. meridionalis </it>was unanticipated, the distinctiveness of the latter from other <it>Buteogallus </it>species has been recognized by its placement by some authors in the monotypic genus <it>Heterospizias </it>(e.g.,<abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>). A close relationship between <it>Buteogallus urubitinga</it>, and <it>Harpyhaliaetus </it>eagles has been previously suggested <abbrgrp><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>, and the retention of the former in <it>Buteogallus </it>has been justified only by the bigger size of the <it>Harpyhaliaetus </it>species <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. A recent higher-level molecular analysis of hawks and eagles <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> posited the paraphyly of the genus <it>Buteogallus</it>, and established a closer relationship of <it>Buteogallus urubitinga </it>and <it>Harpyhaliaetus </it>species than between the two <it>Buteogallus </it>species sampled (<it>B. urubitinga </it>and <it>B. anthracinus</it>). Given the polyphyletic relationships of <it>Buteogallus </it>as presented here it is clear that a complete re-assessment of the genus is required. It is worth noting that Amadon <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>, Grossman and Hamlet <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>, Brown and Amadon <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> and Ridgway <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> predicted the relatively close relationship of <it>L. schistaceus </it>and <it>L. plumbeus </it>to <it>Buteogallus </it>established in the mtDNA phylogeny presented here. However, we did not recover a sister relationship between the latter pair, sometimes considered subspecies <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> or members of a super-species complex (e.g., <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>).</p>
            <p>The proximity of <it>L. polionotus</it>, <it>L. albicollis </it>and <it>L. occidentalis </it>is fully supported by our data, and has been strongly suggested in taxonomic revisions (e.g., <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B6">6</abbr><abbr bid="B9">9</abbr><abbr bid="B12">12</abbr><abbr bid="B30">30</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>). Species limits in the <it>L. albicollis </it>complex have been a contentious taxonomic issue, and revision of this complex is needed. Similarly, a sister relationship between <it>L. melanops </it>and <it>L. kuhli </it>has been long suggested (e.g.,<abbrgrp><abbr bid="B1">1</abbr><abbr bid="B4">4</abbr><abbr bid="B6">6</abbr><abbr bid="B30">30</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>), as well as the close relationship of both to <it>L. semiplumbeus </it><abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, based on similarities of plumage and external morphology. However, their close relationship to <it>Buteo buteo </it>is novel (see also <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>). In our study, <it>Buteo buteo </it>represents a genus containing several species of North American and Old World hawks (see <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>), and the nested position of this species within the Neotropical buteonines corroborates Amadon's <abbrgrp><abbr bid="B4">4</abbr></abbrgrp> hypothesis of Neotropical origins for the entire buteonine lineage. The polyphyly of <it>Buteo </it>species in our study corroborates the results of Riesing <it>et al</it>. <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>.</p>
            <p>Our study includes all recognized <it>Leucopternis </it>species and represents the largest Neotropical buteonine taxonomic sample investigated to date. The polyphyly of <it>Leucopternis</it>, <it>Buteogallus </it>and <it>Buteo </it>indicates that current taxonomy does not reflect the phylogenetic history of the group. Only a complete buteonine phylogeny is likely to provide sufficient guidance regarding the nomenclatural issues concerning <it>Buteo</it>, <it>Leucopternis, Buteogallus </it>and <it>Harpyhaliaetus</it>, as well as fine scale biogeographic inferences. The predominantly black and white plumage pattern shared by several <it>Leucopternis </it>species (<it>L. polionotus, L. occidentalis, L. lacernulatus, L. melanops, L. kuhli, L. semiplumbeus, L. albicollis, L. princeps</it>) has evolved at least twice (figure <figr fid="F2">2</figr>), and the widespread occurrence of this pattern may result from plumage convergence in forested habitats. Similarly, <it>L. plumbeus </it>and <it>L. schistaceus </it>posses a slate plumage pattern very similar to that of <it>Rostrhamus </it>species, and all those species are associated with riparian habitats both within (<it>L. schistaceus, L. plumbeus, R. hamatus</it>) and outside forests (<it>R. sociabilis</it>). In order to test the hypothesis that the slate plumage results from selection in riparian habitats, additional analysis including <it>Rostrhamus </it>species is required. It has been shown that plumage characters under strong selection may evolve rapidly <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>, and in some cases may represent evolutionary convergence instead of reflecting shared phylogenetic or phylogeographic history <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>. An overemphasis on the black and white plumage pattern influenced the grouping of <it>Leucopternis </it>species, and more generally our results indicate that plumage patterns alone may not be reliable taxonomic markers among Accipitridae species.</p>
         </sec>
         <sec>
            <st>
               <p>Biogeography and habitat shifts</p>
            </st>
            <p>We can confidently reject the reciprocal monophyly of <it>cis- </it>and <it>trans-</it>Andean distributed buteonines (figure <figr fid="F2">2</figr>). At least three <it>cis-trans </it>(east-west) disjunctions were identified in all phylogenetic trees inferred from the combined dataset: (1) <it>L. semiplumbeus </it>(<it>trans-</it>) versus its Amazonian (<it>cis-</it>) sister clade, <it>L. melanops </it>plus <it>L. kuhli</it>, (2) <it>L. polionotus </it>(<it>cis-</it>) versus the two sampled subspecies of <it>L. albicollis </it>plus <it>L. occidentalis </it>(<it>trans-</it>), and (3) <it>L. plumbeus </it>(<it>trans-</it>) and the rest of Clade 1 (mostly <it>cis</it><b>-</b>Andean, but with <it>Buteogallus </it>species occurring on both sides). The uncertain position of <it>L. princeps </it>may hide a possible fourth disjunction. Three major hypothesis have been suggested to explain the differentiation of ancestral populations into <it>cis- </it>and <it>trans-</it>Andean lineages: the Andean Uplift Hypothesis <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>, advocating separation of populations on either side of the mountains as a consequence of Andean orogeny; the Across Andes Dispersal Hypothesis <abbrgrp><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr><abbr bid="B45">45</abbr></abbrgrp> proposing long distance dispersal across the Andes as the cause of diversification, and the Forest Refugia Hypothesis, with historical expansions and contractions of forest corridors that linked forested lowlands on either side of the Andes <abbrgrp><abbr bid="B45">45</abbr></abbrgrp> (see Brumfield and Capparella <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>, Ribas <it>et al</it>. <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>). Lack of fossil calibrations for raptors, as well as rejection of clock-like evolution for the ATP8 and ATP6 dataset using a likelihood ratio test (data not shown) precluded calculation of divergence times for the hawk species analyzed here, and thus without a temporal framework we are unable to reject any of the Andean biogeography hypotheses based solely on mtDNA phylogenetic inference.</p>
            <p>Few geographic barriers besides the Andes seem to define ranges of Neotropical buteonine species. The Amazon River has been suggested to delineate the distributions of <it>terra-firme </it>forest species <abbrgrp><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr></abbrgrp>, and may have played a role in the separation of <it>L. melanops </it>and <it>L. kuhli </it>north and south of the river, respectively (see <abbrgrp><abbr bid="B40">40</abbr></abbrgrp>). However, there are recent and historical records of sympatry between <it>L. melanops </it>and <it>L. kuhli</it>, with observations of both species south of the Amazon River (Barlow <it>et al</it>. <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>, Amaral <it>et al</it>. pers. obs.). Because of this fact it would appear that the Amazon River does not currently impose a strong barrier blocking <it>L. melanops </it>from occupying southern Amazon forests.</p>
            <p>The putative contraction and expansion of lowland tropical forests associated with climate change has been promoted as one of the factors that explain avian areas of endemism (see <abbrgrp><abbr bid="B51">51</abbr></abbrgrp> for limits and details on those areas), but most Neotropical buteonine species have geographic ranges that cross many of the proposed areas. Nonetheless, one might posit that the two Atlantic forest endemics, <it>L. lacernulatus </it>and <it>L. polionotus </it>represent species formed by the contraction and isolation of forest fragments during glacial episodes, but the mtDNA phylogenetic tree establishes that they are not sister species (Figure <figr fid="F1">1</figr>). The distant phylogenetic separation of these two <it>Leucopternis </it>species supports the proposal that the Atlantic Forest biota has complex origins <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>.</p>
            <p>Our mtDNA-based phylogenetic analysis of Neotropical buteonines (figure <figr fid="F2">2</figr>) also permits strong inference that forest and open-vegetation species are not reciprocally monophyletic. Furthermore, ecological shifts between forest and non-forest habitats occurred early and late in the Neotropical buteonine diversification. The phylogenetic tree presented in Figure <figr fid="F2">2</figr> indicates that separation of the open-vegetation <it>Buteo albicaudatus </it>from <it>Leucopternis </it>forest species occurred early in the radiation compared to the more recent divergence of <it>Buteogallus meridionalis </it>from <it>L. lacernulatus </it>and <it>Parabuteo unicinctus </it>from <it>Buteo leucorrhous</it>. The geographic and altitudinal distributions of these more recently derived sister pairs overlap greatly, but the sister species occupy different habitats, either open-country or forest. This same pattern is reflected in the sister relationship between <it>Harpyhaliaetus coronatus </it>(savannah) and <it>Harpyhaliaetus solitarius </it>(forest, unavailable for this study) <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, although these species do not overlap much in their ranges.</p>
            <p>Habitat shifts between sister species or groups of closely related species have been poorly explored in studies of avian historical biogeography in the Neotropics, mainly due to the predominance of forest lowland bird species in such studies (but see Garcia-Moreno and Cardoso da Silva <abbrgrp><abbr bid="B53">53</abbr></abbrgrp> and Ribas <it>et al</it>. <abbrgrp><abbr bid="B54">54</abbr></abbrgrp>). The pattern of habitat shifts between sister pairs can be consistent with both allopatric (Theory of Vanishing Refuges <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>) and parapatric models of speciation (Gradient Hypothesis <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>). Occurrence of parapatric speciation and divergence with gene flow has been a controversial issue (see Brown <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>, Cracraft and Prum <abbrgrp><abbr bid="B57">57</abbr></abbrgrp>), but explicit tests with vertebrates <abbrgrp><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr></abbrgrp>, including birds <abbrgrp><abbr bid="B62">62</abbr></abbrgrp> have pointed to patterns consistent with between-habitat divergence in the presence of gene flow in tropical habitats. High mobility due to soaring and gliding flight, occurrence of several species in ecotones, and the pattern of sister relationships between forest and non-forest species suggest that buteonine species offer future opportunities to test alternative models of diversification in the Neotropics using phylogeographic data.</p>
            <p>The determination of geographically structured areas of endemism in the Neotropics <abbrgrp><abbr bid="B51">51</abbr><abbr bid="B63">63</abbr></abbrgrp> has promoted allopatry as the principal mode of speciation in the Neotropics, with the Andean orogeny, rivers, and changes in forest cover serving as the principal vicariant events separating populations. Accumulation of phylogenetic and phylogeographic data for Neotropical birds suggests that the process of diversification is more complex [<it>e. g</it>. <abbrgrp><abbr bid="B42">42</abbr><abbr bid="B64">64</abbr></abbrgrp>], and that parapatric and sympatric models of speciation must be properly tested <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B23">23</abbr><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr><abbr bid="B62">62</abbr></abbrgrp>. The family Accipitridae is extensively represented in most Neotropical habitats, and offers opportunities to explore the radiation of an ecologically diverse group with high dispersal capabilities. Further phylogenetic and phylogeographic studies of diurnal raptors, as well as other groups representing varying degrees of vagility and occurrence in habitats other than forests, will permit more explicit tests of the role of alternative modes of speciation acting on Neotropical birds, and refinement of general explanations for the origin and maintenance of Neotropical biodiversity.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Our mtDNA-based inference of Neotropical buteonine phylogeny establishes a polyphyletic relationship among the hawk genera <it>Leucopternis</it>, <it>Buteogallus </it>and <it>Buteo</it>. Thus the phylogeny indicates that the current taxonomy of the Accipitridae is not a good guide to the evolutionary relationships of species in the group, and identifies a need for further systematic analysis of the family at all taxonomic levels. We do not propose nomenclatural modifications, since only a complete buteonine analysis would permit such taxonomic changes. Nonetheless, our results coupled to earlier work predict some of the nomenclatural changes that will undoubtedly be forthcoming, and also establish that plumage has been overemphasized in defining the taxonomy of the Accipitridae. Finally, we conclude that shifts between forest and non-forest habitats, as well as movement across the Andes, have occurred more than once during the Neotropical buteonine diversification.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Taxon sampling, DNA extraction, amplification and sequencing</p>
            </st>
            <p>We sampled a total of 31 specimens, comprising all 10 recognized species of the genus <it>Leucopternis </it>(<it>L. lacernulatus</it>, <it>L. polionotus</it>, <it>L. semiplumbeus, L. plumbeus, L. occidentalis, L. schistaceus, L. princeps, L. melanops, L. kuhli, L. albicollis)</it>, and including two sub-species of <it>L. albicollis </it>(<it>L. a. costaricensis </it>and <it>L. a. ghiesbreghti</it>), as well as almost all Neotropical buteonine genera (representing 15 of the 21 species of the Neotropical "sub-buteonines" <it>sensu </it>Amadon <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>), plus four <it>Buteo </it>species. We chose <it>Geranospiza caerulescens </it>as an outgroup based on a recent higher-level analysis of Accipitridae <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. When possible, we included two individuals per taxon. Nomenclature follows the South American Classification Committee of the American Ornithologists' Union <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. Sequences of <it>Buteo buteo </it>were obtained from Genbank [<ext-link ext-link-type="gen" ext-link-id="NC_003128">NC_003128</ext-link>]. Tissue, feather and blood samples were obtained from specimens collected in the field, museum tissue collections, and captive birds (see <supplr sid="S1">Additional file 1</supplr>: Table 1). Known localities of origin, feathers and photographs are available for most captive specimens.</p>
            <suppl id="S1">
               <title>
                  <p>Additional File 1</p>
               </title>
               <text>
                  <p><b>Table 1. Samples used in the study. </b>The classification follows Remsen <it>et al</it>. <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. Abbreviations: LGEMA = Laborat&#243;rio de Gen&#233;tica e Evolu&#231;&#227;o Molecular de Aves, Universidade de S&#227;o Paulo; LSUMZ = Louisiana State University, Museum of Natural Science; ANSP = Academy of Natural Sciences of Philadelphia; MPEG = Museu Paraense Em&#237;lio Goeldi; MZUSP = Museu de Zoologia da Universidade de S&#227;o Paulo; IBUSP = Instituto de Bioci&#234;ncias, Universidade de S&#227;o Paulo.</p>
               </text>
               <file name="1471-2148-6-10-S1.rtf">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <p>DNA extraction, amplification and sequencing were performed at the Universidade de S&#227;o Paulo (Brazil), the Smithsonian Tropical Institute (Panama) and the Royal Ontario Museum (Canada) based on earlier protocols <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. DNA extraction followed Bruford <it>et al</it>. <abbrgrp><abbr bid="B67">67</abbr></abbrgrp>, or via the DNeasy kit (Qiagen); for feather samples, we added 30 ug of dithiothreitol to the digestion buffer. We sequenced four mitochondrial genes: a portion of the 12S ribosomal RNA gene (12S, longest sequence of 833 bp), the complete ATP synthase F0 subunit 8 (ATP8, 168 bp) and subunit 6 (ATP6, 684 bp) genes, as well as the complete NADH dehydrogenase subunit 6 (ND6, 519 bp) using several primer pair combinations via polymerase chain reaction (PCR) (table <tblr tid="T1">2</tblr>). In few cases, weak amplification products were re-amplified using internal primers. Both strands of the amplified products were sequenced.</p>
            <tbl id="T1">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Primers used in the study.</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Target region</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Primer name</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Sequence (5'to 3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Reference</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>12S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>LPHE1248</p>
                     </c>
                     <c ca="center">
                        <p>AAAGCATGGCACTGAAGAYGCCAAG</p>
                     </c>
                     <c ca="center">
                        <p>E. Tavares, unpublished</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12SL1735</p>
                     </c>
                     <c ca="center">
                        <p>GGATTAGATACCCCACTATGC</p>
                     </c>
                     <c ca="center">
                        <p>Miyaki <it>et al</it>. [75]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12SHC</p>
                     </c>
                     <c ca="center">
                        <p>CCGCCAAGTCCTTAGAGTTT</p>
                     </c>
                     <c ca="center">
                        <p>Eberhard <it>et al</it>. [76]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>12SH2181</p>
                     </c>
                     <c ca="center">
                        <p>GGCTTGTGAGGAGGGTGACGGGC</p>
                     </c>
                     <c ca="center">
                        <p>C. Ribas, unpublished</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>H2294VAL</p>
                     </c>
                     <c ca="center">
                        <p>CTTTCAGGTGTAAGCTGARTGC</p>
                     </c>
                     <c ca="center">
                        <p>J. Patane, modified from Sorenson <it>et al</it>. [77]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>16S2-</p>
                     </c>
                     <c ca="center">
                        <p>ATCCCTGGGGTAGCTTGGTCC</p>
                     </c>
                     <c ca="center">
                        <p>Haring <it>et al</it>. [78]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>16SH3309</p>
                     </c>
                     <c ca="center">
                        <p>TGCGCTACCTTCGCACGGT</p>
                     </c>
                     <c ca="center">
                        <p>Miyaki <it>et al</it>. [75]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>H4017</p>
                     </c>
                     <c ca="center">
                        <p>GCTAGGGAGAGGATTTGAACCTC</p>
                     </c>
                     <c ca="center">
                        <p>Sorenson <it>et al</it>. [77]</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>ATP8/6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>CO2GQL</p>
                     </c>
                     <c ca="center">
                        <p>GGACAATGCTCAGAAATCTGCGG</p>
                     </c>
                     <c ca="center">
                        <p>Eberhard and Bermingham [79]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TLYS9051</p>
                     </c>
                     <c ca="center">
                        <p>CACCAGCACTAGCCTTTTAAG</p>
                     </c>
                     <c ca="center">
                        <p>Fleischer <it>et al</it>. [80]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>A6PWL</p>
                     </c>
                     <c ca="center">
                        <p>CCTGAACCTGACCATGAAC</p>
                     </c>
                     <c ca="center">
                        <p>Eberhard and Bermingham [79]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>CO3HMH</p>
                     </c>
                     <c ca="center">
                        <p>CATGGGCTGGGGTCRACTATGTG</p>
                     </c>
                     <c ca="center">
                        <p>Eberhard and Bermingham [79]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>ARG11145</p>
                     </c>
                     <c ca="center">
                        <p>TTTGTTGAGCCGAAATCAACTGTCT</p>
                     </c>
                     <c ca="center">
                        <p>Present study</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>ND6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>TPROFWD</p>
                     </c>
                     <c ca="center">
                        <p>ATCACCAACTCCCAAAGCTGG</p>
                     </c>
                     <c ca="center">
                        <p>Riesing <it>et al</it>. [7]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>TGLUREV</p>
                     </c>
                     <c ca="center">
                        <p>AAGTTTACAACGGCGATTTTTC</p>
                     </c>
                     <c ca="center">
                        <p>Riesing <it>et al</it>. [7]</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>YCR2REV</p>
                     </c>
                     <c ca="center">
                        <p>GGTTACATGGTTTGGTAGGGG</p>
                     </c>
                     <c ca="center">
                        <p>Riesing <it>et al</it>. [7]</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Alignment and phylogenetic analysis</p>
            </st>
            <p>Multiple strands obtained for each specimen were assembled in CodonCode Aligner v. 1.3.4 (CodonCode Corporation) or Sequencher v. 4 (Gene Codes Corporation). Contigs were exported and alignment performed in Clustal X 1.83 <abbrgrp><abbr bid="B68">68</abbr></abbrgrp> with default parameters. The 12S alignment had 21 indels, which consisted mostly of autapomorphies and sites of ambiguous alignment; these were removed from all analyses. All single marker and combined datasets were tested for significant departures from average base frequencies with PAUP* 4b10 <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>, using only variable sites. Uncorrected codon-based (ATP8, ATP6, ND6) and total (12S) transition and transversion distances were plotted against Kimura-2-parameters distances using the software Dambe v4.2 <abbrgrp><abbr bid="B70">70</abbr></abbrgrp> to evaluate the effect of multiple substitutions in each dataset. We implemented a partition homogeneity test in PAUP*, using only variable sites with 1000 replicates with random additions, to evaluate the congruence of the phylogenetic signal between the different genes. Because the latter test did not detect significantly-different phylogenetic signal among the partitions (P = 0.29), all four genes were combined into a single combined dataset. Separated analyses of subsets of single gene region were also performed to evaluate the concordance among those datasets. The ATP8 and ATP6 genes overlap by 10 bp; however in all phylogenetic analyses of the combined dataset and the single gene region of ATP (subunit 8 plus subunit 6) this region was considered only once. We performed phylogenetic reconstructions using maximum likelihood (ML) and maximum parsimony (MP) implemented in PAUP*, and Bayesian analysis (BA) with MrBayes v3.1.1 <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>, to evaluate the concordance of topologies obtained under different optimization criteria. ML and MP heuristic searches were performed using 1000 and 10 random additions of sequences, respectively. Nonparametric bootstrapping was performed to assess branch support (100 replicates with single random additions for the ML analysis and 1,000 replicates with 10 random additions for the MP analysis). Modeltest v3.7 <abbrgrp><abbr bid="B72">72</abbr></abbrgrp> was used to choose among evolutionary models of DNA substitution for ML and BA analyses using a hierarchical likelihood ratio test. Modeltest determined that the TrN+I+G model was the best fit for the total dataset with base frequencies of A = 0.3217, C = 0.3521, G = 0.1235, T = 0.2027, a gamma shape parameter of 1.0617 and proportion of invariable sites of 0.5631. The BA analyses of the combined dataset was run with individual likelihood for each of the three gene regions (12S, ATP 6 and ATP 8, and ND6) as selected by Modeltest (TrN+I+G, HKY+I+G, TrN+G), which were the same models used for subset ML and BA analyses. MrBayes was run with four chains for 4,000,000 generations with trees sampled every 100 generations, replicated four times. All runs reached stationarity around 400 sampled generations, so we discarded the first 40000 generations as a "burnin"; a consensus topology was created with all the remaining sampled generations.</p>
            <p>To determine whether our data support monophyly of <it>Leucopternis</it>, monophyly of forest species, monophyly of species presenting black and white plumage patterns, or reciprocal monophyly of <it>trans- </it>and <it>cis-</it>Andean species, we compared alternative constraint topologies to the ML tree using the nonparametric Shimodaira-Hasegawa test <abbrgrp><abbr bid="B73">73</abbr></abbrgrp> implemented in PAUP*. Ancestral states of habitat and general plumage pattern (according to Thiollay <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>, Fergusson-Lees and Christie <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> and Sibley and Monroe <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>) were mapped onto the ML tree inferred from the combined dataset using unordered parsimony in Mesquite v1.05 <abbrgrp><abbr bid="B74">74</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>FSRA conceived the study, carried out most of the data collection and phylogenetic analysis, and drafted the manuscript. MJM carried out the data collection from the LSUMZ samples, and made substantial contributions to the manuscript. LFS obtained part of the samples, and made substantial contributions to the manuscript. EB made substantial contributions to the manuscript. AW helped to conceive the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank the following individuals and institutions for kindly providing samples, without which this work could not have been performed: Donna Dittman, Robb Brumfield and Fred Sheldon (LSUMZ); Leo Joseph (ANSP); Alexandre Aleixo and Marcos P&#233;rsio D. Santos (MPEG); Marcelo Soares (UFPA); Carlos E. A. Carvalho; Eduardo P. M. de Carvalho Filho; Giancarlo Zorzin, Gustavo D. M. de Carvalho and Marcus Canuto (SOS Falconiformes), Pedro Scherer Neto (Museu de Hist&#243;ria Natural Cap&#227;o do Imbu&#237;a), Zool&#243;gico de Paul&#237;nia, Ricardo Pereira (Zool&#243;gico de S&#227;o Paulo), Leo Fukui and Jorge Lisboa (ABPFAR); David Whitacre, Rick Watson and Martin Gilbert (Peregrine Fund); Tammo Hoeksema (ZOOMAT); S&#233;rgio Aguilar (Veracruz Pronatura); Alexandre Miranda, Jos&#233; H. Fontenele, Greicelene R. Pedro (Orquid&#225;rio de Santos); Renato Gaban-Lima and Guilherme Renzo (USP); Adriana Joppert (DEPAVE/SP); Robson Silva e Silva and F&#225;bio Olmos. We are grateful to Erika S. Tavares for kindly sequencing the ANSP samples at the Royal Ontario Museum and helping with the analyses, and Allan Baker for allowing use of the ROM laboratory for sequencing. We also thank S&#233;rgio Pereira and Martin Riesing for useful suggestions and support, Erwin T. Grau for invaluable help with the laboratory methods, Robb Brumfield for help with the analyses, and Camila Ribas, Cibele Biondo, Gustavo S. Cabanne, Rodrigo Pessoa and three anonymous referees for comments and several contributions to the manuscript. Financial support was provided by Funda&#231;&#227;o de Amparo a Pesquisa do Estado de S&#227;o Paulo, CNPq and CAPES.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Family Accipitridae (Hawks and Eagles)</p>
            </title>
            <aug>
               <au>
                  <snm>Thiollay</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Handbook of the birds of the world. New World Vultures to Guineafowl</source>
            <publisher>Barcelona: Lynx Edicions</publisher>
            <editor>Hoyo J del, Elliott A, Sargatal J</editor>
            <pubdate>1994</pubdate>
            <volume>2</volume>
            <fpage>52</fpage>
            <lpage>205</lpage>
         </bibl>
         <bibl id="B2">
            <aug>
               <au>
                  <snm>Sick</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Ornitologia Brasileira</source>
            <publisher>Rio de Janeiro: Nova Fronteira</publisher>
            <pubdate>1997</pubdate>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Taxonomic notes on birds of prey</p>
            </title>
            <aug>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Amer Mus Novit</source>
            <pubdate>1964</pubdate>
            <volume>2166</volume>
            <fpage>1</fpage>
            <lpage>24</lpage>
         </bibl>
         <bibl id="B4">
            <title>
               <p>A revision of the sub-buteonine hawks (Accipitridae, Aves)</p>
            </title>
            <aug>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Amer Mus Novit</source>
            <pubdate>1982</pubdate>
            <volume>2741</volume>
            <fpage>1</fpage>
            <lpage>20</lpage>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The fossil record of birds</p>
            </title>
            <aug>
               <au>
                  <snm>Olson</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Avian biology</source>
            <publisher>New York:Academic Press</publisher>
            <editor>Farner D, King J R, Parkes K</editor>
            <pubdate>1985</pubdate>
            <volume>VIII</volume>
            <fpage>79</fpage>
            <lpage>239</lpage>
         </bibl>
         <bibl id="B6">
            <aug>
               <au>
                  <snm>Ferguson-Lees</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Christie</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Raptors of the world</source>
            <publisher>London: Christopher Helm</publisher>
            <pubdate>2001</pubdate>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Molecular phylogeny of the genus <it>Buteo </it>(Aves: Accipitridae) based on mitochondrial marker sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Riesing</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Kruckenhauser</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gamauf</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Haring</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2003</pubdate>
            <volume>27</volume>
            <fpage>328</fpage>
            <lpage>342</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1055-7903(02)00450-5</pubid>
                  <pubid idtype="pmpid" link="fulltext">12695095</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A multi-gene phylogeny of aquiline eagles (Aves: Accipitriformes) reveals extensive paraphyly at the genus level</p>
            </title>
            <aug>
               <au>
                  <snm>Helbig</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Kocum</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Seibold</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Braun</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Mol Phyl Evol</source>
            <pubdate>2005</pubdate>
            <volume>35</volume>
            <fpage>147</fpage>
            <lpage>164</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/j.ympev.2004.10.003</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Hawks and owls of the world. A distributional and taxonomic list</p>
            </title>
            <aug>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bull</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Proc West Found Vert Zool</source>
            <pubdate>1988</pubdate>
            <volume>3</volume>
            <fpage>295</fpage>
            <lpage>357</lpage>
         </bibl>
         <bibl id="B10">
            <aug>
               <au>
                  <snm>Friedman</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>The birds of North and Middle America. Part XI. Cathartidae to Falconidae</source>
            <publisher>United States National Museum Bulletin 50. Washington D.C.: Smithsonian Institution</publisher>
            <pubdate>1950</pubdate>
            <volume>50</volume>
         </bibl>
         <bibl id="B11">
            <aug>
               <au>
                  <snm>Grossman</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Hamlet</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Birds of prey of the world</source>
            <publisher>New York: Bonanza Books</publisher>
            <pubdate>1964</pubdate>
         </bibl>
         <bibl id="B12">
            <aug>
               <au>
                  <snm>Brown</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Eagles, hawks and falcons of the world</source>
            <publisher>Feltham: Country Life Books</publisher>
            <pubdate>1968</pubdate>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Speciation in Amazonian forest birds</p>
            </title>
            <aug>
               <au>
                  <snm>Haffer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1969</pubdate>
            <volume>165</volume>
            <fpage>131</fpage>
            <lpage>137</lpage>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Time's cycle and time's arrow in the history of Amazonia</p>
            </title>
            <aug>
               <au>
                  <snm>Haffer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Biogeographica</source>
            <pubdate>1993</pubdate>
            <volume>69</volume>
            <fpage>15</fpage>
            <lpage>45</lpage>
         </bibl>
         <bibl id="B15">
            <title>
               <p>South American anoles: the geographical variation and and evolution of the <it>Anolis chrysolepis </it>species group (Sauria, Iguanidae)</p>
            </title>
            <aug>
               <au>
                  <snm>Vanzolini</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>EE</fnm>
               </au>
            </aug>
            <source>Arq Zool S&#227;o Paulo</source>
            <pubdate>1970</pubdate>
            <volume>19</volume>
            <fpage>1</fpage>
            <lpage>298</lpage>
         </bibl>
         <bibl id="B16">
            <title>
               <p>On the monkeys of the Amazon</p>
            </title>
            <aug>
               <au>
                  <snm>Wallace</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>Proc Zool Soc London</source>
            <pubdate>1852</pubdate>
            <volume>20</volume>
            <fpage>107</fpage>
            <lpage>110</lpage>
         </bibl>
         <bibl id="B17">
            <title>
               <p>River dynamics and the diversity of Amazon lowland forest</p>
            </title>
            <aug>
               <au>
                  <snm>Salo</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kalliola</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>H&#228;kkinen</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>M&#228;kinen</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Niemel&#228;</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pubakka</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Coley</snm>
                  <fnm>PD</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1986</pubdate>
            <volume>322</volume>
            <fpage>254</fpage>
            <lpage>258</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1038/322254a0</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Late Miocene tidal deposits in the Amazonian foreland basin</p>
            </title>
            <aug>
               <au>
                  <snm>R&#228;s&#228;nen</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Linna</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Santos</snm>
                  <fnm>JCR</fnm>
               </au>
               <au>
                  <snm>Negri</snm>
                  <fnm>FR</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1995</pubdate>
            <volume>269</volume>
            <fpage>386</fpage>
            <lpage>390</lpage>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Plio-Pleistocene South American history and the Amazon lagoon hypothesis: a piece in the puzzle of Amazonian diversification</p>
            </title>
            <aug>
               <au>
                  <snm>Marroig</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Cerqueira</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Comp Biol</source>
            <pubdate>1997</pubdate>
            <volume>2</volume>
            <fpage>103</fpage>
            <lpage>119</lpage>
         </bibl>
         <bibl id="B20">
            <title>
               <p>An alternative hypothesis for the origin of Amazonian bird diversity</p>
            </title>
            <aug>
               <au>
                  <snm>Nores</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Biogeography</source>
            <pubdate>1999</pubdate>
            <volume>26</volume>
            <fpage>475</fpage>
            <lpage>485</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1046/j.1365-2699.1999.t01-1-00311.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>A method of analysis for historical biogeography</p>
            </title>
            <aug>
               <au>
                  <snm>Platnick</snm>
                  <fnm>NI</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>GJ</fnm>
               </au>
            </aug>
            <source>Syst Zool</source>
            <pubdate>1978</pubdate>
            <volume>27</volume>
            <fpage>1</fpage>
            <lpage>16</lpage>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Pleistocene forest refuges: fact or fancy</p>
            </title>
            <aug>
               <au>
                  <snm>Endler</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Biological Diversification in the Tropics</source>
            <publisher>New York: Columbia University Press</publisher>
            <editor>Prance GT</editor>
            <pubdate>1982</pubdate>
            <fpage>641</fpage>
            <lpage>657</lpage>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Diversification of rainforest faunas: an integrated molecular approach</p>
            </title>
            <aug>
               <au>
                  <snm>Moritz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Patton</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Schneider</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
            </aug>
            <source>Annu Rev Ecol Syst</source>
            <pubdate>2000</pubdate>
            <volume>31</volume>
            <fpage>533</fpage>
            <lpage>563</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1146/annurev.ecolsys.31.1.533</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Molecular systematic analysis reveals cryptic Tertiary diversification of a widespread tropical rain forest tree</p>
            </title>
            <aug>
               <au>
                  <snm>Dick</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Abdul-Salim</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bermingham</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Am Nat</source>
            <pubdate>2003</pubdate>
            <volume>162</volume>
            <fpage>691</fpage>
            <lpage>703</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/379795</pubid>
                  <pubid idtype="pmpid" link="fulltext">14737707</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Long-distance gene flow and cross-Andean dispersal of lowland rainforest bees (Apidae: Euglossini) revealed by comparative mitochondrial DNA phylogeography</p>
            </title>
            <aug>
               <au>
                  <snm>Dick</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Roubik</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Gruber</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Bermingham</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Mol Ecol</source>
            <pubdate>2004</pubdate>
            <volume>13</volume>
            <fpage>3775</fpage>
            <lpage>3885</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1365-294X.2004.02374.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15548290</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Raptor migration in the Neotropics: patterns, processes and consequences</p>
            </title>
            <aug>
               <au>
                  <snm>Bildstein</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>Ornitol Neotrop</source>
            <pubdate>2004</pubdate>
            <issue>Suppl 15</issue>
            <fpage>83</fpage>
            <lpage>99</lpage>
         </bibl>
         <bibl id="B27">
            <title>
               <p>An exploratory phylogenetic analysis of the genera of the Accipitridae, with notes on the biogeography of the family</p>
            </title>
            <aug>
               <au>
                  <snm>Holdaway</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Raptor conservation today: proceedings of the IV World Conference on Birds of Prey and Owls. 10&#8211;17 May 1992, Berlin</source>
            <publisher>Berlin, London, Paris: Pica Press and World Working Group on Birds of Prey and Owls</publisher>
            <editor>Meyburg BU, Chancellor RD</editor>
            <pubdate>1994</pubdate>
            <fpage>601</fpage>
            <lpage>637</lpage>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Phylogeny of eagles, Old World vultures, and other Accipitridae based on nuclear and mitochondrial DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Lerner</snm>
                  <fnm>HRL</fnm>
               </au>
               <au>
                  <snm>Mindell</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2005</pubdate>
            <volume>37</volume>
            <fpage>327</fpage>
            <lpage>346</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2005.04.010</pubid>
                  <pubid idtype="pmpid" link="fulltext">15925523</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Low number of mitochondrial pseudogenes in the chicken (<it>Gallus gallus</it>) nuclear genome: implications for molecular inference of population history and phylogenetics</p>
            </title>
            <aug>
               <au>
                  <snm>Pereira</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>BMC Evol Biol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>17</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">449702</pubid>
                  <pubid idtype="pmpid" link="fulltext">15219233</pubid>
                  <pubid idtype="doi">10.1186/1471-2148-4-17</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Catalogue of Birds of the Americas</p>
            </title>
            <aug>
               <au>
                  <snm>Hellmayr</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Conover</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Field Mus Nat Hist Zool Ser</source>
            <pubdate>1949</pubdate>
            <fpage>13</fpage>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Cat&#225;logo das aves do Brasil e lista dos exemplares que as representam no Museu Paulista, 1.a Parte. Aves n&#227;o Passeriformes e Passeriformes n&#227;o Oscines excluida a Fam. Tyrannidae e seguintes</p>
            </title>
            <aug>
               <au>
                  <snm>Pinto</snm>
                  <fnm>OMO</fnm>
               </au>
            </aug>
            <source>Rev Mus Paulista</source>
            <pubdate>1938</pubdate>
            <volume>22</volume>
            <fpage>1</fpage>
            <lpage>566</lpage>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Posic&#237;on sistem&#225;tica del g&#233;nero <it>Heterospizias</it></p>
            </title>
            <aug>
               <au>
                  <snm>Pl&#243;tnick</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Hornero</source>
            <pubdate>1956</pubdate>
            <volume>10</volume>
            <fpage>136</fpage>
            <lpage>139</lpage>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Lista de las aves de Venezuela con su distribucion. Tomo II. parte I. No Passeriformes</p>
            </title>
            <aug>
               <au>
                  <snm>Phelps</snm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Phelps</snm>
                  <fnm>WH</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Bol Soc Venez Cienc Nat</source>
            <pubdate>1958</pubdate>
            <volume>19</volume>
            <fpage>1</fpage>
            <lpage>317</lpage>
         </bibl>
         <bibl id="B34">
            <aug>
               <au>
                  <snm>Meyer de Schauensee</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>A guide to the birds of South America</source>
            <publisher>Wynnewood, Pennsylvania: Livingston Publishing</publisher>
            <pubdate>1970</pubdate>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Notes on <it>Harpyhaliaetus</it></p>
            </title>
            <aug>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Auk</source>
            <pubdate>1949</pubdate>
            <volume>66</volume>
            <fpage>53</fpage>
            <lpage>56</lpage>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Observations of Mexican Birds</p>
            </title>
            <aug>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Eckelberry</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Condor</source>
            <pubdate>1955</pubdate>
            <volume>57</volume>
            <fpage>65</fpage>
            <lpage>80</lpage>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Studies of the American Falconidae</p>
            </title>
            <aug>
               <au>
                  <snm>Ridgway</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Bull U S Geol Geog Surv Terr</source>
            <pubdate>1876</pubdate>
            <volume>2</volume>
            <fpage>91</fpage>
            <lpage>182</lpage>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Order Falconiformes</p>
            </title>
            <aug>
               <au>
                  <snm>Stressemann</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Amadon</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Check-List of Birds of the World</source>
            <publisher>Cambridge, Massachusetts: Museum of Comparative Zoology</publisher>
            <editor>Mayr E, Cottrell GW</editor>
            <edition>2</edition>
            <pubdate>1979</pubdate>
            <volume>1</volume>
            <fpage>271</fpage>
            <lpage>425</lpage>
         </bibl>
         <bibl id="B39">
            <aug>
               <au>
                  <snm>Sibley</snm>
                  <fnm>CG</fnm>
               </au>
               <au>
                  <snm>Monroe</snm>
                  <fnm>BL</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Distribution and taxonomy of birds of the world</source>
            <publisher>New Haven and London: Yale Univ Press</publisher>
            <pubdate>1990</pubdate>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Biogeography of Neotropical birds</p>
            </title>
            <aug>
               <au>
                  <snm>Haffer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Biogeography and quaternary history in tropical America</source>
            <publisher>Oxford:Clarendon Press</publisher>
            <editor>Whitmore TC, Prance GT</editor>
            <pubdate>1987</pubdate>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Reconstructing plumage evolution in orioles (<it>Icterus</it>): repeated convergence and reversal in patterns</p>
            </title>
            <aug>
               <au>
                  <snm>Omland</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Lanyon</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2000</pubdate>
            <volume>54</volume>
            <fpage>2119</fpage>
            <lpage>2133</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11209787</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Complex evolutionary history of a Neotropical lowland forest bird (<it>Lepidothrix coronata</it>) and its implications for historical hypotheses of the origin of Neotropical avian diversity</p>
            </title>
            <aug>
               <au>
                  <snm>Cheviron</snm>
                  <fnm>ZA</fnm>
               </au>
               <au>
                  <snm>Hackett</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Capparella</snm>
                  <fnm>AP</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2005</pubdate>
            <volume>36</volume>
            <fpage>338</fpage>
            <lpage>357</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ympev.2005.01.015</pubid>
                  <pubid idtype="pmpid" link="fulltext">15955514</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>The distribution of bird life in Colombia</p>
            </title>
            <aug>
               <au>
                  <snm>Chapman</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Bull Am Mus Nat Hist</source>
            <pubdate>1917</pubdate>
            <volume>36</volume>
            <fpage>1</fpage>
            <lpage>729</lpage>
         </bibl>
         <bibl id="B44">
            <title>
               <p>The distribution of bird life in Colombia</p>
            </title>
            <aug>
               <au>
                  <snm>Chapman</snm>
                  <fnm>FM</fnm>
               </au>
            </aug>
            <source>Bull Am Mus Nat Hist</source>
            <pubdate>1926</pubdate>
            <volume>55</volume>
            <fpage>1</fpage>
            <lpage>784</lpage>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Speciation in Colombian forest birds west of the Andes</p>
            </title>
            <aug>
               <au>
                  <snm>Haffer</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>American Museum Novitates</source>
            <pubdate>1967</pubdate>
            <volume>294</volume>
            <fpage>1</fpage>
            <lpage>57</lpage>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Historical diversification of birds in northwestern South America: a molecular perspective on the role of vicariant events</p>
            </title>
            <aug>
               <au>
                  <snm>Brumfiled</snm>
                  <fnm>RT</fnm>
               </au>
               <au>
                  <snm>Capparella</snm>
                  <fnm>AP</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1996</pubdate>
            <fpage>1607</fpage>
            <lpage>1624</lpage>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Historical biogeography and diversification within the Neotropical parrot genus <it>Pionopsitta </it>(Aves:Psittacidae)</p>
            </title>
            <aug>
               <au>
                  <snm>Ribas</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Gaban-Lima</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Miyaki</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Cracraft</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Biogeography</source>
            <pubdate>2005</pubdate>
            <volume>32</volume>
            <fpage>1409</fpage>
            <lpage>1427</lpage>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Genetic variation in Neotropical birds: implications for the speciation process</p>
            </title>
            <aug>
               <au>
                  <snm>Capparella</snm>
                  <fnm>AP</fnm>
               </au>
            </aug>
            <source>Acta XIX Congr Int Ornithol</source>
            <pubdate>1988</pubdate>
            <volume>19</volume>
            <fpage>1658</fpage>
            <lpage>1673</lpage>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Historical diversification of a Terra-firme forest bird superspecies: a phylogeographic perspective on the role of different hypotheses of Amazonian diversification</p>
            </title>
            <aug>
               <au>
                  <snm>Aleixo</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>2004</pubdate>
            <volume>58</volume>
            <fpage>1303</fpage>
            <lpage>1317</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15266979</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Sympatry of the Black-faced Hawk <it>Leucopternis melanops </it>and the White-browed Hawk <it>Leucopternis kuhli </it>in the Lower Rio Tapaj&#243;s, Par&#225;, Brazil</p>
            </title>
            <aug>
               <au>
                  <snm>Barlow</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Haugaasen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Peres</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Cotinga</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>77</fpage>
            <lpage>79</lpage>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Historical biogeography and patterns of differentiation within the South American avifauna: areas of endemism</p>
            </title>
            <aug>
               <au>
                  <snm>Cracraft</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Ornith Monogr</source>
            <pubdate>1985</pubdate>
            <volume>36</volume>
            <fpage>49</fpage>
            <lpage>84</lpage>
         </bibl>
         <bibl id="B52">
            <title>
               <p>The historical bridge between Amazon and the Atlantic Forest of Brazil: a study of molecular phylogeography with small mammals</p>
            </title>
            <aug>
               <au>
                  <snm>Costa</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Biogeography</source>
            <pubdate>2003</pubdate>
            <volume>30</volume>
            <fpage>71</fpage>
            <lpage>86</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1046/j.1365-2699.2003.00792.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>An interplay between forest and non-forest South American avifaunas suggested by a phylogeny of <it>Lepidocolaptes </it>woodcreepers (Dendrocolaptidae)</p>
            </title>
            <aug>
               <au>
                  <snm>Garcia-Moreno</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Cardoso da Silva</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Stud Neotrop Fauna &amp; Environm</source>
            <pubdate>1997</pubdate>
            <volume>32</volume>
            <fpage>164</fpage>
            <lpage>173</lpage>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Molecular systematics in <it>Aratinga </it>parakeets: species limits and historical biogeography in the 'solstitialis' group, and the systematic position of <it>Nandayus nenday</it></p>
            </title>
            <aug>
               <au>
                  <snm>Ribas</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Miyaki</snm>
                  <fnm>CY</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2004</pubdate>
            <volume>30</volume>
            <fpage>663</fpage>
            <lpage>675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1055-7903(03)00223-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">15012946</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>The vanishing refuge: a mechanism for ecogeographic speciation</p>
            </title>
            <aug>
               <au>
                  <snm>Vanzolini</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>EE</fnm>
               </au>
            </aug>
            <source>Pap Avulsos Zoo</source>
            <pubdate>1981</pubdate>
            <volume>34</volume>
            <fpage>251</fpage>
            <lpage>255</lpage>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Conclusions, synthesis, and alternative hypothesis</p>
            </title>
            <aug>
               <au>
                  <snm>Brown</snm>
                  <fnm>KS</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Biogeography and quaternary history in tropical America</source>
            <publisher>New York: Clarendon Press</publisher>
            <editor>Whitmore TC, Prance GT</editor>
            <pubdate>1987</pubdate>
            <fpage>175</fpage>
            <lpage>196</lpage>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Patterns and processes of diversification: speciation and historical congruence in some Neotropical birds</p>
            </title>
            <aug>
               <au>
                  <snm>Cracraft</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Prum</snm>
                  <fnm>RO</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1988</pubdate>
            <volume>42</volume>
            <fpage>603</fpage>
            <lpage>620</lpage>
         </bibl>
         <bibl id="B58">
            <title>
               <p>A test of alternative models of diversification in tropical rainforests: ecological gradients vs rainforest refugia</p>
            </title>
            <aug>
               <au>
                  <snm>Schneider</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Larison</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Moritz</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Proc Nat Acad Sci USA</source>
            <pubdate>1999</pubdate>
            <volume>24</volume>
            <fpage>13869</fpage>
            <lpage>13873</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1073/pnas.96.24.13869</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>A role for ecotones in generating rainforest biodiversity</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Wayne</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Girman</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Bruford</snm>
                  <fnm>MW</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1997</pubdate>
            <volume>276</volume>
            <fpage>1855</fpage>
            <lpage>1857</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1126/science.276.5320.1855</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Refugial isolation versus ecological gradients</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Schneider</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Holder</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Genetica</source>
            <pubdate>2001</pubdate>
            <volume>112&#8211;113</volume>
            <fpage>383</fpage>
            <lpage>398</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1023/A:1013312510860</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Molecular evidence for ecological speciation in tropical habitats</p>
            </title>
            <aug>
               <au>
                  <snm>Ogden</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Thorpe</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>13612</fpage>
            <lpage>13615</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">129722</pubid>
                  <pubid idtype="pmpid" link="fulltext">12370440</pubid>
                  <pubid idtype="doi">10.1073/pnas.212248499</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Testing alternative mechanisms of evolutionary divergence in an African rain forest passerine bird</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Calsbeek</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Wayne</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Holder</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Pires</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bardeleben</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Evol Biol</source>
            <pubdate>2005</pubdate>
            <volume>18</volume>
            <fpage>257</fpage>
            <lpage>268</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1420-9101.2004.00825.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15715832</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Area-relationships in the Neotropical lowlands: a hypothesis based on raw distributions of Passerine birds</p>
            </title>
            <aug>
               <au>
                  <snm>Bates</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Hackett</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Cracraft</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Biogeography</source>
            <pubdate>1998</pubdate>
            <volume>25</volume>
            <fpage>783</fpage>
            <lpage>793</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1046/j.1365-2699.1998.2540783.x</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Historical relationships among Neotropical lowland forest areas of endemism as determined by mitochondrial DNA sequence variation within the Wedge-billed Woodcreeper (Aves: Dendrocolaptidae: <it>Glyphorynchus spirurus</it>)</p>
            </title>
            <aug>
               <au>
                  <snm>Marks</snm>
                  <fnm>BD</fnm>
               </au>
               <au>
                  <snm>Hackett</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Capparella</snm>
                  <fnm>AP</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>2002</pubdate>
            <volume>24</volume>
            <fpage>153</fpage>
            <lpage>167</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1055-7903(02)00233-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">12128035</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>A classification of the bird species of South America. American Ornithologists' Union</p>
            </title>
            <aug>
               <au>
                  <snm>Remsen</snm>
                  <fnm>JV</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Jaramillo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nores</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pacheco</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Robbins</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Schulenberg</snm>
                  <fnm>TS</fnm>
               </au>
               <au>
                  <snm>Stiles</snm>
                  <fnm>FG</fnm>
               </au>
               <au>
                  <snm>da Silva</snm>
                  <fnm>JMC</fnm>
               </au>
               <au>
                  <snm>Stotz</snm>
                  <fnm>DF</fnm>
               </au>
               <au>
                  <snm>Zimmer</snm>
                  <fnm>KJ</fnm>
               </au>
            </aug>
            <url>http://www.museum.lsu.edu/~Remsen/SACCBaseline.html</url>
            <note>[Version 30 november 2005]</note>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Phylogenetic relationships among some Neotropical parrot genera (Psittacidae) based on mitochondrial sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Tavares</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Yamashita</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Miyaki</snm>
                  <fnm>CY</fnm>
               </au>
            </aug>
            <source>Auk</source>
            <pubdate>2004</pubdate>
            <volume>121</volume>
            <fpage>230</fpage>
            <lpage>242</lpage>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Multi and single-locus DNA fingerprinting</p>
            </title>
            <aug>
               <au>
                  <snm>Bruford</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Hanotte</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Brookfield</snm>
                  <fnm>JFY</fnm>
               </au>
               <au>
                  <snm>Burke</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Molecular Genetic Analysis of Populations &#8211; a Practical Approach</source>
            <publisher>New York: IRL Press</publisher>
            <editor>Hoelzel AR</editor>
            <pubdate>1992</pubdate>
            <fpage>225</fpage>
            <lpage>269</lpage>
         </bibl>
         <bibl id="B68">
            <title>
               <p>The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Plewniak</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jeanmougin</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1997</pubdate>
            <volume>25</volume>
            <fpage>4876</fpage>
            <lpage>4882</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">147148</pubid>
                  <pubid idtype="pmpid" link="fulltext">9396791</pubid>
                  <pubid idtype="doi">10.1093/nar/25.24.4876</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <aug>
               <au>
                  <snm>Swofford</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>PAUP* Phylogenetic analysis using parsimony (*and other methods)</source>
            <publisher>Sunderland, Massachusetts: Sinauer Associates</publisher>
            <pubdate>2002</pubdate>
         </bibl>
         <bibl id="B70">
            <title>
               <p>DAMBE: Data analysis in molecular biology and evolution</p>
            </title>
            <aug>
               <au>
                  <snm>Xia</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Xie</snm>
                  <fnm>Z</fnm>
               </au>
            </aug>
            <source>Journal of Heredity</source>
            <pubdate>2001</pubdate>
            <volume>92</volume>
            <fpage>371</fpage>
            <lpage>373</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jhered/92.4.371</pubid>
                  <pubid idtype="pmpid" link="fulltext">11535656</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>MRBAYES 3: Bayesian phylogenetic inference under mixed models</p>
            </title>
            <aug>
               <au>
                  <snm>Ronquist</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Huelsenbeck</snm>
                  <fnm>JP</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>1572</fpage>
            <lpage>1574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg180</pubid>
                  <pubid idtype="pmpid" link="fulltext">12912839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>MODELTEST: testing the model of nucleotide substitution</p>
            </title>
            <aug>
               <au>
                  <snm>Posada</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Crandall</snm>
                  <fnm>KA</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>1998</pubdate>
            <volume>14</volume>
            <fpage>817</fpage>
            <lpage>818</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/14.9.817</pubid>
                  <pubid idtype="pmpid" link="fulltext">9918953</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Multiple comparisons of log-likelihoods with applications to phylogenetic inference</p>
            </title>
            <aug>
               <au>
                  <snm>Shimodaira</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hasegawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>1114</fpage>
            <lpage>1116</lpage>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Mesquite: a modular system for evolutionary analysis. Version 1.05</p>
            </title>
            <aug>
               <au>
                  <snm>Maddison</snm>
                  <fnm>WP</fnm>
               </au>
               <au>
                  <snm>Maddison</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <pubdate>1999</pubdate>
            <url>http://mesquiteproject.org</url>
         </bibl>
         <bibl id="B75">
            <title>
               <p>Parrot evolution and paleogeographic events: mitochondrial DNA evidence</p>
            </title>
            <aug>
               <au>
                  <snm>Miyaki</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Matioli</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Burke</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Wajntal</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1998</pubdate>
            <volume>15</volume>
            <fpage>544</fpage>
            <lpage>551</lpage>
         </bibl>
         <bibl id="B76">
            <title>
               <p>Duplication and concerted evolution of the mitochondrial control region in the parrot genus <it>Amazona</it></p>
            </title>
            <aug>
               <au>
                  <snm>Eberhard</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Bermingham</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <fpage>1330</fpage>
            <lpage>1342</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11420371</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B77">
            <title>
               <p>Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates</p>
            </title>
            <aug>
               <au>
                  <snm>Sorenson</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Ast</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Dimcheff</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Yuri</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Mindell</snm>
                  <fnm>DP</fnm>
               </au>
            </aug>
            <source>Mol Phylogenet Evol</source>
            <pubdate>1999</pubdate>
            <volume>12</volume>
            <fpage>105</fpage>
            <lpage>114</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/mpev.1998.0602</pubid>
                  <pubid idtype="pmpid" link="fulltext">10381314</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B78">
            <title>
               <p>The complete sequence of the mitochondrial genome of <it>Buteo buteo </it>(Aves, Accipitridae) indicates an early split in the phylogeny of raptors</p>
            </title>
            <aug>
               <au>
                  <snm>Haring</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Kruckenhauser</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Gamauf</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Riesing</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Pinsker</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2001</pubdate>
            <volume>18</volume>
            <fpage>1892</fpage>
            <lpage>1904</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11557795</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B79">
            <title>
               <p>Phylogeny and biogeography of the <it>Amazona ocrocephala </it>(Aves:Psittacidae) complex</p>
            </title>
            <aug>
               <au>
                  <snm>Eberhard</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Bermingham</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Auk</source>
            <pubdate>2004</pubdate>
            <volume>121</volume>
            <fpage>318</fpage>
            <lpage>332</lpage>
         </bibl>
         <bibl id="B80">
            <title>
               <p>Identification of the extinct Hawaiian eagle (<it>Haliaeetus</it>) by mtDNA sequence analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Fleischer</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>James</snm>
                  <fnm>HF</fnm>
               </au>
               <au>
                  <snm>Cooper</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>Auk</source>
            <pubdate>2000</pubdate>
            <volume>117</volume>
            <fpage>1051</fpage>
            <lpage>1056</lpage>
         </bibl>
      </refgrp>
   </bm>
</art>

