IGF2 was largely cytoplasmic in all tissues tested. In the uterus, IGF2 protein was localised in the cytoplasm of glandular cells in the endometrium and in the uterine epithelium. Accumulated staining was observed in the lumen of some, but not all, uterine glands and in a few cells of the uterine stroma (Fig. 1). In the yolk sac, IGF2 protein was detected in the trophoblast and yolk sac endoderm of bilaminar and trilaminar regions, but rarely in the mesenchymal or endothelial cells of vitelline vessels (Fig. 1).

IGF2R protein co-localised with IGF2 in the yolk sac, but was also detected in the cell membrane in addition to the cytoplasm (Fig. 2). Unlike IGF2, IGF2R staining was similar in both the bilaminar and trilaminar yolk sac and it did not markedly change over the developmental period examined (Fig. 3A). Staining for IGF2R was more restricted than IGF2 in the endometrium, with immuno-reactivity limited to the uterine epithelium. All cells in the bilaminar and trilaminar yolk sac, including the mesenchyme and endothelium, reacted with the IGF1R antibody (Fig. 2). There was no staining in the IgG antibody or no-antibody negative controls. Staining for IGF1R was common in the endometrium, with reactivity to the endometrial stroma, endometrial glands, and many endothelial cells.

IGF2 antibody immunoreactivity was stronger in the bilaminar than in the trilaminar yolk sac at all stages examined, but this difference was most notable in the two days before parturition (Fig. 3A). Both the bilaminar and trilaminar yolk sac had less IGF2 immuno-staining between days 19 to 21 than at later stages of pregnancy. IGF2 immunostaining in the trophoblast of the bilaminar and trilaminar yolk sac was consistently stronger than in the yolk sac endoderm (Fig. 3B). Additionally, there was light background staining in the yolk sac endoderm, but not the trophoblast, of IgG antibody negative controls (Fig. 1). However, background staining was not as intense as staining to the IGF2 antibody. Although there was stronger staining of IGF2R in the trophoblast, the intensity of staining was not markedly different from the yolk sac endoderm (Fig. 3B).

Western blots using protein extracts from both the uterus and placenta detected a single band of approximately 23 kD consistent with predicted protein size for IGF2. This confirmed that the antibody was specific for tammar IGF2, validating the immunohistochemistry (Fig 4A).

RT-PCR amplified products of the expected size, 422 bp (IGF2) and 443 bp (IGF2R), which were sequenced to confirm gene identity. BLAST-N on the sequence of these PCR fragments showed high homology with sequences in other species: tammar IGF2 showed 95% nucleotide identity to North American opossum IGF2 (AY55235.1) and tammar IGF2R showed 99% nucleotide identity to the red-necked wallaby, Macropus rufogriseus IGF2R (AF339159). IGF2 and IGF2R mRNA was detected in the bilaminar and trilaminar yolk sac of all stages between day 19 and day 26. Additionally, both genes were expressed in the allantois, adult liver, endometrium, and in the pouch young tail (Fig. 4B).

Contamination by primer dimers was eliminated from analysis by reading sample fluorescence above the primer dimer melting temperatures, as indicated by melting curve analyses, thus ensuring C_T values reflected amplification of the target only. Melting curve analysis and agarose gel electrophoresis also confirmed a single product was obtained for each reaction. β-Actin (β-ACT) (the endogenous gene control) had no primer dimers and plates could be read at temperatures required for target genes.

All standard curves were linear over three orders of magnitude of yolk sac cDNA dilutions, indicating that the primers work over a range of cDNA concentrations. A correlation co-efficient above 0.98 was recorded for the standard curve of all genes examined. Standard deviations of C_T values from triplicate reactions were on average 0.28 of a cycle for IGF2, 0.58 for IGF2R, and 0.56 for VEGF. Therefore, within each triplicate all C_T values were within 1 cycle of each other. If standard deviation within the triplicate was greater than 1.5, indicating a substantial variation in the estimated C_T, all data for those individuals were removed from further analyses.

IGF2 expression was significantly lower in the bilaminar compared to the trilaminar yolk sac at all stages from days 19 to 26 (Bonferroni adjusted paired t-test, n ≤ 5, α ≤ 0.013) (Fig. 4B). In both regions of the yolk sac there was a significant increase in IGF2 expression between days 19 to 21 and days 22 to 24 (Bonferroni adjusted unpaired t-test, n = 7, α 0.009). Further, IGF2 declined at term and this was significant in the bilaminar yolk sac (Bonferroni adjusted unpaired t-test, n = 6, α ≤ 0.036). Unlike IGF2,IGF2R expression was similar in the bilaminar and trilaminar yolk sac and did not change markedly over the gestational period examined (Fig. 4C).

VEGF was expressed in the trilaminar yolk sac at all gestational stages examined. A gradual increase in VEGF expression was observed for days 19 to 21 through to days 25 to 26 (Fig. 5A). The presence of additional IGF2 (in the form of human-recombinant IGF2 at 100 ng/ml) significantly increased VEGF expression in trilaminar yolk sac explants cultured for 8 hours compared to control cultures (one-tailed, one-sample t-test, n = 4, α = 0.023) (Fig. 5B). At 18 hours a similar trend was observed, but was not significant (one-tailed, one-sample t-test, n = 5, α = 0.110). Combining this data with that from the 8 hour treatments gives an overall significant increase in VEGF expression when IGF2 was added to the culture medium (ANOVA, n = 9, α = 0.012).

In many eutherians, IGF2 mRNA is abundant in trophoblast-derived cell lineages, yolk-sac endoderm and mesoderm, and chorioallantoic mesoderm of eutherians 3132. Similarly, tammar IGF2 protein was abundant in analogous cell lineages of the yolk sac – the trophoblast and yolk sac endoderm. However, while IGF2 mRNA expression is high in many mesodermal tissues in eutherians, there was little IGF2 protein detected in the yolk sac mesenchyme of the tammar. However, IGF2 mRNA expression in the trilaminar yolk sac was higher than in the bilaminar yolk sac

IGF2 can act as both a mitogen and a differentiation factor, which it does by triggering different signalling pathways 4950. The expression of IGF2 mRNA and protein, as well as the co-localisation of both IGF receptors in the tammar yolk sac, provides evidence of its function in this tissue. Basal IGF2 expression in the bilaminar yolk sac suggests a constitutive mitogenic role that is likely shared with the trilaminar yolk sac, and is consistent with the localisation of IGF1R, the primary mediator of IGF2 mitogenic activity throughout the yolk sac. High IGF2 expression in the trilaminar yolk sac may reflect high rates of proliferation in this region during late gestation 795152. Between days 13 and 26 the trilaminar yolk sac rapidly expands, from approximately 1/20 of the yolk sac surface to 1/2 by the end of gestation 95253.

Igf2 induction of the mesoderm can be independent of Igf2 regulation of cellular proliferation 54. The abundance of IGF2 binding proteins in yolk sac blood vessels of the guinea pig suggests it may also stimulate angiogenesis in this tissue 55. In the tammar placenta, the bilaminar yolk sac is avascular, while the mesodermal layer of the trilaminar yolk sac differentiates into vascular tissue and mesenchyme. The high relative expression of IGF2 in the trilaminar yolk sac suggests that it may be required for growth and vascularisation of the marsupial placenta during the final third of gestation. Although both IGF2 transcript and protein were found in the trilaminar yolk sac, IGF2 antibodies did not react with the mesenchyme or endothelium of vitelline vessels. IGF2 in the mesenchyme may be bound by tissue-specific IGF-BPs that inhibit its interaction with the antibody.

IGF2 may also promote vascularisation of the yolk sac indirectly. Like IGF2, IGF2R was found in the trophoblast and yolk sac endoderm, but not the mesenchyme. These results suggest that the primary targets of IGF2 activity in the yolk sac are the trophoblast and extra-embryonic endoderm. In the eutherian yolk sac, endodermal cells appear critical for the differentiation of mesenchymal cells into angioblasts 56. Similarly, development of the yolk sac vasculature in the tammar wallaby may require signals from surrounding IGF2-responsive cells (trophoblast and/or yolk sac endoderm).

In the mouse, Vegf is needed for haematopoiesis, differentiation of endothelial lineages, and neo-vascularisation of developing organs including the placenta 455758. IGF2 may stimulate vascular differentiation of the yolk sac by regulating VEGF expression. The present results support this hypothesis. In vivo there was a parallel increase in VEGF and IGF2 expression in the yolk sac during the final third of gestation. Although IGF2 expression declines during days 25 to 26 of gestation while VEGF continues to increase, this is likely to reflect the long half-life of IGF2 protein in vivo, where it is maintained in labile pools by IGF2 binding proteins 2931. In vitro, VEGF expression increased significantly in trilaminar yolk sac explants grown in culture with human-recombinant IGF2. It is possible that IGF2 increased VEGF expression in yolk sac cultures by increasing cellular proliferation, rather than stimulating VEGF expression directly. This study cannot distinguish between these two possibilities. VEGF expression in both control and treatment cultures was higher than in the same stages in vivo, possibly due to IGF2 contained within the fetal calf serum in the culture medium. The data presented support the suggestion that IGF2 can increase VEGF expression either directly or via an increase in cell numbers in the differentiating vascular yolk sac.

IGF2 is clearly important in the marsupial placenta during late gestation. Moreover, IGF2 is imprinted in the fetus and placenta of the tammar wallaby 14. Organogenesis and rapid growth occur in the final third of gestation in the tammar, and the metabolic needs of the fetus are greatest at this time 785359. The increase in trilaminar yolk sac area may facilitate efficient transfer of gases and support fetal metabolism during this phase of rapid growth 789. Thus, by stimulating cellular proliferation and survival in the bilaminar and trilaminar yolk sac as well as vascularisation, placental IGF2 may be critical for the fetus to meet its metabolic requirements.

IGF2 may also influence nutrient transport through the yolk sac. In the tammar, glucose transport across the yolk sac increases during the final third of gestation 760. Insulin typically regulates glucose transport, but not in the rodent yolk sac placenta 6162. IGF2 may, instead, perform this function in the yolk sac and possibly the chorioallantoic placenta, in which glucose transport is also largely insensitive to insulin 63646566. In bovine endothelial cells IGF-BP2 enhances glucose transport 67 and IGF2 increases glucose transport in cultured human cytotrophoblasts 68. However, insulin is also present and imprinted in the marsupial yolk sac 77, so the two may act synergistically.

The placenta is a key site of imprinted gene expression in eutherians and imprinted genes regulate its development and function 6970. Presumably the growth promoting functions of IGF2 in the placenta and fetus may explain the maintenance of its imprinting in divergent mammalian species. Further, increased vascular development and growth of the yolk sac is needed to maintain fetal growth and the present study establishes the potential for IGF2 to influence growth and angiogenesis in the placenta of the tammar.

Adult female tammars carrying fetuses in the final third of gestation (day 19 to day 26 of a 26.5 day gestation 71) were euthanised either by cervical dislocation or by an anaesthetic overdose (sodium pentobarbitone, 60 mg/ml, to effect) and portions of the bilaminar (BYS) and trilaminar (TYS) yolk sac collected as previously described 75360. All experiments were approved by the University of Melbourne Animal Experimentation Ethics Committees and the animal handling and husbandry were in accordance with the CSIRO/Australian Bureau of Agriculture and National Health and Medical Research Council of Australia (1990) guidelines.

Immunohistochemistry was performed on matching bilaminar and trilaminar yolk sac samples collected from 13 tammar fetuses in mid to late gestation. Small pieces of endometrium with placenta attached were collected and fixed in 4% PFA before paraffin embedding. Sections (7 μm) were mounted on SuperFrost Plus slides (Menzel-Glaser) before dewaxing and rehydration. A 3 min 0.05% pronase (sigma type XXIV, # P5147) antigen retrieval step was required for the IGF2 antibody (Santa Cruz, # Sc-7435). IGF1Rα (Santa Cruz, IGF-IRα, #Sc-712) and IGF2R (Santa Cruz, # Sc-14408) antibodies required a 5 min wash in 0.1% Triton-X-100. Details on the antibodies used are presented in Table 1. Sections were blocked for 25 min at room temperature in 10% normal serum/TBS/1% BSA. IGF2 and IGF2R were used at a concentration of 0.002 g/L and IGF1Rα at 0.0006 g/L. Sections were incubated overnight at 4°C. A biotinylated secondary antibody (DAKO, # E0432 or DAKO, # E0466) was used with ABComplex/HRP kit (DAKO, # K0355) and colour developed with DAB Chromagen tablets (DAKO, # S3000). Sections were counterstained in haematoxylin. Immuno-reactivity was evaluated subjectively using the intensity of brown (DAB) colour development, with strong staining of many/most cells given a grade of 5 reducing to no staining (0). Appropriate control, reactions were run in parallel.

Approximately 300 ng of DNase treated (DNA-free, Ambion, # 1906) total RNA (GenElute Mammalian Total RNA Kit, Sigma, # RTN70) was used in an Oligo (dT)_12–18 primed cDNA synthesis reaction (SuperScript First Strand Synthesis System for RT-PCR, Invitrogen, # 11904-018). Approximately 5 ng of cDNA was used with IGF2 primers (Suzuki et al, 2004) (Table 2). PCR was performed with an initial incubation at 94°C for 2 min, 39 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min. Primers for IGF2R were designed using sequence provided by Professor F. Ishino and Primer3 software (Table 2). IGF2R PCR conditions where the same as IGF2 PCR but annealing was carried out at 55°C. Promega Taq polymerase B (# M1661) and accompanying reagents were used at concentrations of 1.5 mM MgCl₂, 0.2 mM each dNTPs, and 0.2 μM each primers.

Matched bilaminar and trilaminar yolk sac samples for quantitative PCR were collected from 23 individuals and all were assessed. However, two of these samples were excluded from further analysis due to consistent variations within triplicate samples. mRNA levels were measured for IGF2, IGF2R, and VEGF (sequence provided by Dr. Laura Parry, The University of Melbourne). cDNA was synthesised as described above. SYBR green (Quantitect, # 204143) was used in a quantitative PCR on the MJ Research Opticon 2 thermocycler. PCR conditions and primer sequences for target genes are given in Table 3. All primers crossed intron-exon boundaries. B-ACT was used as an endogenous gene controland calibrator (forward primer 5' GATCCATTGGAGGGCAAGTCT 3' and reverse primer 5' CCAAGATCCAACTACGAGCTTTTT 3'). Reactions were performed in triplicate and the data analysed in Microsoft Excel and Systat. The amplification efficiency was calculated from the standard curve and Ct values corrected 727374.

Three day 19 and five day 21 fetuses were collected and the yolk sac dissected under sterile conditions at 37°C in either yolk sac fluid or medium (DMEM/Pen-Strep/L-Glutamine/10% FCS). Trilaminar yolk sac portions (2 × 2 mm for day 19 and 4 × 4 mm for day 21) were obtained from each conceptus. Explants were grown in Nunc plates coated with 1.7 % agar in either base medium or base medium containing human recombinant-IGF2 (Chemicon, # GF007) in an environment of 6% CO₂ (BOC gases) and air (20% O₂: 75% N₂). Cultures were grown at 37°C in an air-jacketed incubator (Steri-cycle CO₂ incubator – Hera filter). Based on culture of mouse tissue and the binding efficiency of kangaroo IGF2R for eutherian IGF2, hr-IGF2 was added at a concentration of 100 ng/ml (diluted in sterile filtered PBS/1% BSA) 467576. IGF2-treated and control explants from day 19 were cultured for 8 hours and then snap-frozen in liquid nitrogen, while day 21 explants were cultured for 18 hours before snap-freezing. Quantitative RT-PCR as described above established relative levels of VEGF expression in control and treated yolk sac explants.

Statistical analyses (means, variation, Bonferroni adjusted t-tests) were performed using Microsoft Excel. Repeated measures analyses of variance and multiple comparison tests were conducted using Systat Version 10.2. Quantitative data are presented as means ± s.e.m. unless otherwise indicated. Statistical significance was at the 5% level. An α-value between 0.05 and 0.1 was considered to show a trend worth further consideration.