<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1471-213X-8-102</ui>
   <ji>1471-213X</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Expression profiling of human glial precursors</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Campanelli</snm>
               <mi>T</mi>
               <fnm>James</fnm>
               <insr iid="I1"/>
               <email>jcampanelli@qthera.com</email>
            </au>
            <au id="A2">
               <snm>Sandrock</snm>
               <mi>W</mi>
               <fnm>Robert</fnm>
               <insr iid="I1"/>
               <email>rsandrock@qthera.com</email>
            </au>
            <au id="A3">
               <snm>Wheatley</snm>
               <fnm>Will</fnm>
               <insr iid="I1"/>
               <email>wwheatley@qthera.com</email>
            </au>
            <au id="A4">
               <snm>Xue</snm>
               <fnm>Haipeng</fnm>
               <insr iid="I2"/>
               <email>haipeng.xue@invitrogen.com</email>
            </au>
            <au id="A5">
               <snm>Zheng</snm>
               <fnm>Jianhua</fnm>
               <insr iid="I2"/>
               <email>jianhua.zheng@invitrogen.com</email>
            </au>
            <au id="A6">
               <snm>Liang</snm>
               <fnm>Feng</fnm>
               <insr iid="I2"/>
               <email>feng.liang@invitrogen.com</email>
            </au>
            <au id="A7">
               <snm>Chesnut</snm>
               <mi>D</mi>
               <fnm>Jonathan</fnm>
               <insr iid="I2"/>
               <email>jon.chesnut@invitrogen.com</email>
            </au>
            <au id="A8">
               <snm>Zhan</snm>
               <fnm>Ming</fnm>
               <insr iid="I3"/>
               <email>zhanmi@mail.nih.gov</email>
            </au>
            <au id="A9">
               <snm>Rao</snm>
               <mi>S</mi>
               <fnm>Mahendra</fnm>
               <insr iid="I2"/>
               <email>mahendra.rao@invitrogen.com</email>
            </au>
            <au id="A10" ca="yes">
               <snm>Liu</snm>
               <fnm>Ying</fnm>
               <insr iid="I2"/>
               <email>ying.liu1@invitrogen.com</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Q Therapeutics, Inc. 615 Arapeen Dr., Ste. 102, Salt Lake City, UT 84108, USA</p>
            </ins>
            <ins id="I2">
               <p>Invitrogen Corporation, 5781 Van Allen Way, Carlsbad, California 92008, USA</p>
            </ins>
            <ins id="I3">
               <p>Bioinformatics Unit, Branch of Research Resources, National Institute on Aging, NIH, Baltimore, MD 21224, USA</p>
            </ins>
         </insg>
         <source>BMC Developmental Biology</source>
         <issn>1471-213X</issn>
         <pubdate>2008</pubdate>
         <volume>8</volume>
         <issue>1</issue>
         <fpage>102</fpage>
         <url>http://www.biomedcentral.com/1471-213X/8/102</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18947415</pubid>
               <pubid idtype="doi">10.1186/1471-213X-8-102</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>08</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>23</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>23</day>
               <month>10</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Campanelli et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>We have generated gene expression databases for human glial precursors, neuronal precursors, astrocyte precursors and neural stem cells and focused on comparing the profile of glial precursors with that of other populations.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>A total of 14 samples were analyzed. Each population, previously distinguished from each other by immunocytochemical analysis of cell surface markers, expressed genes related to their key differentiation pathways. For the glial precursor cell population, we identified 458 genes that were uniquely expressed. Expression of a subset of these individual genes was validated by RT-PCR. We also report genes encoding cell surface markers that may be useful for identification and purification of human glial precursor populations.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>We provide gene expression profile for human glial precursors. Our data suggest several signaling pathways that are important for proliferation and differentiation of human glial precursors. Such information may be utilized to further purify glial precursor populations, optimize media formulation, or study the effects of glial differentiation.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Glial differentiation is a specific developmental process that has been extensively characterized in both rodents and human <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Embryonic stem cells generate a neuroectoderm that undergoes rostrocaudal and dorsoventral patterning and significant expansion to make a large number of neural stem cells (NSCs). NSCs first generate neuronal precursors and subsequently differentiate into glial precursors that further mature into two major types of glia: oligodendrocytes and astrocytes. During this process, multiple growth factors, transcription factors and molecules of different signal transduction pathways are involved, including fibroblast growth factors (FGFs), epidermal growth factors (EGFs), transforming growth factors beta (TGF&#946;) family members, Notch-Hes, inhibitor of DNA-binding (ID) family and Wnt pathways (reviewed in <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>). Identification of these molecules (markers) is important for the isolation, purification, and characterization of human glial precursors, which may find extensive applications in transplantation studies and regenerative medicine.</p>
         <p>Studies of glial development and differentiation in rodents have identified antibodies that recognize markers for isolating human glial cells <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. For instance, A2B5, which reacts with ganglioside epitope GT3 <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, characterizes a glial precursor population <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr></abbrgrp>. Upon further differentiation, A2B5+ cells give rise to oligodendrocyte precursors that express PDGFR&#945;, Sox10, and NG2 <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. Multiple lineage pathways have been suggested for astrocyte development <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, including maturation of radial glia <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>, a neuron-astrocyte precursor and an oligodendrocyte-astrocyte precursor <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. Our laboratory has used antibodies to an extracellular matrix transmembrane protein CD44 to isolate astrocyte precursors from rat, mouse and human neural tissue. These CD44+ cells only gave rise to astrocytes in vitro and in vivo and did not differentiate into neuronal or oligodendrocytic lineages, even in conditions where glial progenitors or stem cells readily differentiated into such phenotypes <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Growth factors that are important for glial differentiation include bone morphogenetic proteins (BMP) 2 and 4, leukemia inhibitory factor (LIF), and ciliary neurotrophic factor (CNTF, <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>).</p>
         <p>Although there are significant similarities in the differentiation of glia in chick, rodent and human systems, there are nevertheless differences as well. For example, A2B5, which characteristically labels glial precursors in rodent cells, has been reported to occasionally recognize cells of the neuronal lineage derived from human embryonic stem cells (hESCs) <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. This is not surprising since even between rat and mouse spinal cord, the A2B5 staining pattern is slightly different (Liu and Rao, unpublished). Likewise the pattern of CD44 expression in mouse and rat is distinct <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp> and the growth factor requirements of early precursors appears to differ as well <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>We have previously created large scale gene expression profiles of hESCs, NSCs and multipotent neural precursor cells and identified a list of markers, which can be used to generate antibodies, design PCR primers, and characterize developmental stages for human neural cells <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B22">22</abbr></abbrgrp>. In this manuscript, we extended these studies to compare human glial progenitors to NSCs and more differentiated progeny. We confirmed the utility of some of the glial precursor markers that were defined in rodent, and proposed novel markers and signaling pathways that may be important for proliferation and differentiation of human glial precursor cells.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Preparation of fetal brain derived cell populations</p>
            </st>
            <p>Tissue from fetal cadavers of gestational age 20 to 23 weeks was procured by Procurement Specialists employed by Advanced Bioscience Resources (ABR) following Donor ID and Informed Consent SOPs, Donor Medical Record Review procedures. All protocols and procedures were reviewed by the Western Institutional Review Board and deemed that any further IRB oversight was unnecessary. Each population of cells included in the present study was derived from a different biological donor.</p>
            <p>The isolation of the cells used in the present study is described as follows (Figure <figr fid="F1">1</figr>). Fetal forebrain was dissociated into a single cell suspension using enzymatic and mechanical methods according to published procedures and these cells are named as <ul>S</ul>tarting <ul>M</ul>aterial: SM <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. Purified precursors were obtained by single or double immunomagnetic cell sorting (magnetic cell sorting, MACS) using Miltenyi superparamagnetic bead technology according to the manufacturer's instructions. Briefly, the single cell suspension was incubated in anti-PSA-NCAM antibody (NCAM; 1:5000, Millipore, MAB5324) followed by incubation with bead conjugated anti-IgM antibody (Mitenyi). The NCAM positive cells were purified from the mixture first by passage through a magnetic field, these cells were collected and termed NE for <ul>N</ul>CAM <ul>E</ul>luate. Un-retained cells (NCAM negative, i.e., NCAM flow through) were collected afterwards and incubated with A2B5 antibody (1:1000, R&amp;D Systems, MAB1416) followed by incubation with bead conjugated anti-IgM antibody before they were passaged through a second magnetic field. Then the retained cells were collected. These cells were immunologically NCAM- and A2B5+, and were named NAE, for <ul>N</ul>CAM flow through, <ul>A</ul>2B5 <ul>E</ul>luate). AE, another type of population used in this study was obtained by incubating single cell suspension with anti-A2B5 antibody followed by bead conjugated anti-IgM antibody. The retained cells were A2B5+ and hence named AE (<ul>A</ul>2B5 <ul>E</ul>luate).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Flow chart of generation of selected samples using MACS or double MACS in this work</p>
               </caption>
               <text>
                  <p>
                     <b>Flow chart of generation of selected samples using MACS or double MACS in this work.</b>
                  </p>
               </text>
               <graphic file="1471-213X-8-102-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Cell Culture</p>
            </st>
            <p>Human fetal tissue derived glial restricted precursor cell populations (NAE and AE, as described above) were harvested and grown on poly-L-ornithine and laminin-coated dishes for six days in vitro before RNA was extracted for analysis. Cells were grown in DMEM/F12 (with L-glutamine and 15 mM Hepes, no phenol red, Invitrogen), 0.01% human serum albumin, 1&#215; N1 supplement (Sigma), Pen/Strep Fungizone, basic fibroblast growth factor (20 ng/ml), platelet derived growth factor AA (10 ng/ml), and Neurotrophin-3 (5 ng/ml). Human astrocyte precursor cells (hAPCs, CD44+) were derived from human neural precursor cells (ScienCell Research Laboratories) and cultured as described <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>. Culture of other cell populations was described in Shin et al <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. Unpurified cells (SM) and NCAM+ cells (NE) were not grown in culture and RNA was extracted shortly after cell purification.</p>
         </sec>
         <sec>
            <st>
               <p>Immunocytochemistry</p>
            </st>
            <p>NAE, NE, AE and SM cells were seeded on chamber slides (LabTek) and grown overnight before they were fixed with 2% paraformaldehyde. For cell surface antigens, cells were blocked with detergent free blocking buffer (10% normal goat serum and 5% bovine serum albumin in PBS) and for internal antigens Triton X-100 and 0.05% Tween-20 were added to the blocking buffer. The following antibodies were used: A2B5 (1:1000), PSA-NCAM (1:5000), PDGFR&#945; (BD Pharmingen, 1:200), NG2 (Millipore, 1:200), GFAP (DAKO, 1:4000), Tuj1 (Sigma, 1:4000), Nestin (BD Bioscience, 1:200) and NeuN (Sigma, 1:200). Appropriate fluorescent labeled secondary antibodies (Invitrogen) were used and nuclei were revealed by counter staining with DAPI.</p>
         </sec>
         <sec>
            <st>
               <p>Illumina bead array, statistical analysis and RT-PCR verification</p>
            </st>
            <p>RNA isolation, cDNA synthesis and Illumina bead array were performed as described <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B24">24</abbr></abbrgrp>. Briefly, RNA was isolated from sorted or cultured cells using TRIzol (Invitrogen) and 100 ng total RNA was used for amplification and hybridization to Illumina HumanRef-8 BeadChip according to the Manufacturer's instructions (Illumina, Inc., San Diego, CA; <url>http://www.illumina.com/pages.ilmn?ID=197</url>. Array performed by microarray core facility at the Burnham Institute for Medical Research). Array data were processed using Illumina BeadStudio software. Background and rank invariant method <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp> were used for normalization. Differential gene expression analysis were done using TMEV program in the TM4 software package <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Before analyses, all populations that have biological or technical replicates were categorized into six groups, including NAE (A2B5+/NCAM- double sorted cells, two biological replicates), NE (NCAM+ single sorted cells, two biological replicates), AE (A2B5+ single sorted cells, three biological replicates), hAPC (CD44+ cells, three technical replicates), HOPC (A2B5+/NCAM-, fluorescence activated cell sorting, or FACS-purified cells, two technical replicates), and WBFB (WB-015 and FB-017, regarded as two biological replicates of NSCs), and only average values were used for further analysis along with samples that did not have replicates, i.e., SM, hAST line and hSC line. Differentially expressed genes between NAE and NE, AE, WBFB, HOPC and hAPC samples were identified by t-test <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Gene expression levels were considered significant only when their detection values were &#8805; 0.99 (i.e., p-value &#8804; 0.01). Selected genes were verified by RT-PCR using GAPDH as an internal control. Primer sequences in a 5' to 3' format are presented in Table <tblr tid="T1">1</tblr>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primers for RT-PCR</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Gene</p>
                     </c>
                     <c ca="left">
                        <p>Forward primer</p>
                     </c>
                     <c ca="left">
                        <p>Reverse primer</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C17</p>
                     </c>
                     <c ca="left">
                        <p>cgacttcaacctcctgcagg</p>
                     </c>
                     <c ca="left">
                        <p>ttctctggtctcagttcccttagc</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CHAD</p>
                     </c>
                     <c ca="left">
                        <p>acccagctccacccagcagtg</p>
                     </c>
                     <c ca="left">
                        <p>agaacgtcctggcaggtggg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DACH</p>
                     </c>
                     <c ca="left">
                        <p>aaaatggtggatctgagggg</p>
                     </c>
                     <c ca="left">
                        <p>ttgagtcctcttaggaggcctt</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GSTM1</p>
                     </c>
                     <c ca="left">
                        <p>tcaagctatgaggaaaagaagtacacg</p>
                     </c>
                     <c ca="left">
                        <p>tcagggagttcctccaagtactttg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MMP7</p>
                     </c>
                     <c ca="left">
                        <p>tacagtgggaacaggctcaggactat</p>
                     </c>
                     <c ca="left">
                        <p>gccccacatgtttaaagcctttg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>IGSF1</p>
                     </c>
                     <c ca="left">
                        <p>agttctagagttggaggcacca</p>
                     </c>
                     <c ca="left">
                        <p>ctgagattcaggctttctccag</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC150221</p>
                     </c>
                     <c ca="left">
                        <p>attacaaccccctggtgatgtc</p>
                     </c>
                     <c ca="left">
                        <p>taaaccatgaccacgtctcctg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PIP3-E</p>
                     </c>
                     <c ca="left">
                        <p>gaaagagcatctgaatgcaag</p>
                     </c>
                     <c ca="left">
                        <p>tcagcagcagacaaactgttaac</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SLC17A8</p>
                     </c>
                     <c ca="left">
                        <p>tgtcaaccacctggacattg</p>
                     </c>
                     <c ca="left">
                        <p>tctggacttcacaattctggg</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TNFAIP6</p>
                     </c>
                     <c ca="left">
                        <p>gcctattgctacaacccaca</p>
                     </c>
                     <c ca="left">
                        <p>caaggtcatgacatttcctgtac</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Human glial precursors and neuronal precursors can be isolated from fetal tissue</p>
            </st>
            <p>We have established transcriptional profiles of 14 cell populations derived or purified from human fetal brain tissues by five different laboratories (Table <tblr tid="T2">2</tblr>). These include seven glial precursors derived by two methods, FACS and MACS; two neuronal precursors, a population of astrocyte precursors (run in triplicate), an immortalized human astrocyte line, an immortalized Schwann cell line, and two populations of NSCs in the form of neurospheres derived from whole brain and frontal brain. A population of unsorted fetal brain cells (Starting Material, SM) was also included as a control. This SM sample showed similar expression profile to the other seven SM samples examined in a parallel experiment which will be reported in a separate manuscript. In the sample list for the current study, the potential glial precursors NAE (A2B5+/NCAM-), were obtained from fetal brains of 20 weeks and 21 weeks of age by magnetic bead separation using a double sorting method. Cells were first incubated with NCAM antibody, then the NCAM+ population was depleted and NCAM negative cells collected. After subsequent incubation with the A2B5 antibody, A2B5+/NCAM- cells were sorted by magnetic beads. These cells were named NAE (<ul>N</ul>CAM depleted, <ul>A</ul>2B5 column <ul>E</ul>luate). FACS-purified A2B5+/NCAM- cells (HOPC) <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> were included to serve as a control to the MACS-sorted NAE cell population.</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Samples included in this study</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>Bar Code</p>
                     </c>
                     <c ca="left">
                        <p>No.</p>
                     </c>
                     <c ca="left">
                        <p>Name</p>
                     </c>
                     <c ca="left">
                        <p>Description</p>
                     </c>
                     <c ca="left">
                        <p>Fetus age</p>
                     </c>
                     <c ca="left">
                        <p>Source</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071H</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>SM060310</p>
                     </c>
                     <c ca="left">
                        <p>Unsorted fetal brain cells</p>
                     </c>
                     <c ca="left">
                        <p>20 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071F</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NAE050421</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+, PSA-NCAM- cells</p>
                     </c>
                     <c ca="left">
                        <p>20 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071G</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>3</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NAE060615</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+, PSA-NCAM- cells</p>
                     </c>
                     <c ca="left">
                        <p>23 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>4</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AE060609&#8211;93</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+ cells</p>
                     </c>
                     <c ca="left">
                        <p>21 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>5</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AE060617</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+ cells</p>
                     </c>
                     <c ca="left">
                        <p>21 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071E</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>6</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>AE060309</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071A</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>7</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NE060309</p>
                     </c>
                     <c ca="left">
                        <p>PSA-NCAM+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1521406071B</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>8</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>NE060310</p>
                     </c>
                     <c ca="left">
                        <p>PSA-NCAM+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Q therapeutics</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1334328027F</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>9</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>HOPC</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+, PSA-NCAM- cells</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Steve Goldman</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1334328026C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>10</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>HOPC replicate</p>
                     </c>
                     <c ca="left">
                        <p>A2B5+, PSA-NCAM- cells</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Steve Goldman</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1400364009C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>11</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>WB-015</p>
                     </c>
                     <c ca="left">
                        <p>Neurosphere from whole brain</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Cognate</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1400364009D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>12</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>FB-017</p>
                     </c>
                     <c ca="left">
                        <p>Neurosphere from frontal brain</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Cognate</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1400401019A</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>13</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hAPC</p>
                     </c>
                     <c ca="left">
                        <p>CD44+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20&#8211;22 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Mahendra Rao</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1334328022D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>14</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hAPC replicate</p>
                     </c>
                     <c ca="left">
                        <p>CD44+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20&#8211;22 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Mahendra Rao</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1334328023C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>15</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hAPC replicate</p>
                     </c>
                     <c ca="left">
                        <p>CD44+ cells</p>
                     </c>
                     <c ca="left">
                        <p>20&#8211;22 weeks</p>
                     </c>
                     <c ca="left">
                        <p>Mahendra Rao</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1400401019B</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>16</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hAST line</p>
                     </c>
                     <c ca="left">
                        <p>Human astrocyte line</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Ahmet Hoke</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>1400401019C</p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>17</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>hSC line</p>
                     </c>
                     <c ca="left">
                        <p>Human Schwann line</p>
                     </c>
                     <c ca="left">
                        <p>NA</p>
                     </c>
                     <c ca="left">
                        <p>Ahmet Hoke</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>As an assessment of purity, the glial precursor NAE cells were immunocytochemically characterized. Approximately 88% of the NAE (A2B5+/NCAM-, MACS sorted) cell population stained positive for the glial precursor marker A2B5 (Figure <figr fid="F2">2B</figr>), and ~9% stained positive for the neuronal precursor marker NCAM (Figure <figr fid="F2">2D</figr>). Compared with the unsorted starting material (SM), cells of neuronal lineage such as NeuN+ (not shown) or &#946;III tubulin (Tuj1)+ cells (Figure <figr fid="F2">2E</figr>) were effectively depleted in the NAE population. NAE cells expressed several known glial markers such as GFAP (76%), NG2 (74%), and PDGFR&#945; (96%, Figure <figr fid="F2">2C, F, G</figr>). These results, combined with the data that were reported for the FACS purified glial precursors (HOPC, A2B5+/NCAM-), NSCs (whole brain and forebrain derived neurospheres) <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>, and hAPC (astrocyte precursors, CD44+) <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B20">20</abbr></abbrgrp>, indicated that distinct populations of precursors could be isolated and purified.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>A2B5+/PSA-NCAM- MACS-sorted cells show properties of glial precursors</p>
               </caption>
               <text>
                  <p><b>A2B5+/PSA-NCAM- MACS-sorted cells show properties of glial precursors</b>. Immunocytochemistry analysis was done for the double MACS-enriched A2B5+/PSA-NCAM- (NAE) cells. Approximately 87% of NAE cells are A2B5+ (B) and ~9% are PSA-NCAM+ (D), They have high immunoreactivity to several glial (GFAP; C) and glial precursor markers (NG2 and PDGFR&#945;; F and G). In contrast, lower percentage of cells show markers specific for the neuronal lineage, such as PSA-NCAM (D) and TuJ1 (&#946;III tubulin, E).</p>
               </text>
               <graphic file="1471-213X-8-102-2"/>
            </fig>
            <p>We then went on to perform large scale gene expression profiling using Illumina bead array for all 14 samples including technical replicates (Table <tblr tid="T2">2</tblr>). We chose the Illumina array platform because it has been proven to be reliable, highly sensitive and cost effective <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B24">24</abbr><abbr bid="B29">29</abbr></abbrgrp>. This platform contained ~24,000 transcripts derived from the Human RefSeq database including full-length and splice variants. Internal reliability for every transcript was achieved by averaging signals obtained from ~30 beads for the same gene or transcript. Before any analysis was performed, the quality of each sample was evaluated by two methods; one means was to assess the quality of the array by analyzing biological or technical replicates in the same run for their general expression patterns; the other means was to examine whether known markers that characterized these populations could be detected using the array system. As shown in Figure <figr fid="F3">3</figr>, biological replicates of glial precursor populations (NAE) and NSCs (neurospheres) derived from either whole brain (WB) or forebrain (FB) were quite similar (R<sup>2 </sup>= 0.94 and 0.92 respectively; Figure <figr fid="F3">3A</figr> and <figr fid="F3">3B</figr>). Technical replicates for HOPCs and hAPCs also showed significant overlap (R<sup>2 </sup>= 0.98 for both; Figure <figr fid="F3">3C</figr> and <figr fid="F3">3D</figr>). Two populations of neuronal precursors (NE) did not have a high R<sup>2 </sup>value, possibly due to the difference in gestational ages or the nature of the single column purification (data not shown). In summary, these results show that replicate samples in the present work cluster closely to each other, which allows for a robust analysis of the similarities and differences between these populations.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Scatter plots and dendrogram of related samples</p>
               </caption>
               <text>
                  <p><b>Scatter plots and dendrogram of related samples.</b> Biological replicates of MACS sorted glial precursors (NAE) (A), and neurospheres (B), and technical replicates of FACS sorted glial precursors (HOPC) (C), and astrocyte precursors (hAPC) (D) show high R<sup>2 </sup>values indicating the array data are reliable. The dendrogram generated using BeadStudio software based on Euclidean distance (E) shows that replicates and samples with similar biological properties cluster closer to each other.</p>
               </text>
               <graphic file="1471-213X-8-102-3"/>
            </fig>
            <p>Based on the properties of this array platform, only when the detection value is &#8805; 0.99 (i.e., detection p value &#8804; 0.01), can the corresponding average signal be regarded as "detected" or "expressed". Generally speaking, when detection value is &#8805; 0.99, the signal intensity value (i.e., gene expression level) is almost always &#8805; 30. In order to further restrict the analysis to improve the reliability of the results, we used a higher cutoff of 100 on signal intensity values. On average, our cell populations expressed 6,200 to 8,900 transcripts at intensity &#8805; 100 (Table <tblr tid="T3">3</tblr>), which was similar to the numbers detected in our earlier reports using Illumina array. Consistent with previous analyses, genes with the highest abundance were ribosomal and structural genes (see Additional file <supplr sid="S1">1</supplr>).</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>
                     <b>Gene expression of all samples included in this study.</b>
                  </p>
               </text>
               <file name="1471-213X-8-102-S1.zip">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Signal abundance of all samples</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Samples</p>
                     </c>
                     <c ca="right">
                        <p>Signal &#8805; 100</p>
                     </c>
                     <c ca="right">
                        <p>%</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SM060310</p>
                     </c>
                     <c ca="right">
                        <p>6221</p>
                     </c>
                     <c ca="right">
                        <p>28.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NAE050421</p>
                     </c>
                     <c ca="right">
                        <p>6453</p>
                     </c>
                     <c ca="right">
                        <p>29.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NAE060615</p>
                     </c>
                     <c ca="right">
                        <p>7723</p>
                     </c>
                     <c ca="right">
                        <p>34.8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AE060609&#8211;93</p>
                     </c>
                     <c ca="right">
                        <p>7807</p>
                     </c>
                     <c ca="right">
                        <p>35.2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AE060617</p>
                     </c>
                     <c ca="right">
                        <p>7491</p>
                     </c>
                     <c ca="right">
                        <p>33.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AE060309</p>
                     </c>
                     <c ca="right">
                        <p>6649</p>
                     </c>
                     <c ca="right">
                        <p>30.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NE060309</p>
                     </c>
                     <c ca="right">
                        <p>7242</p>
                     </c>
                     <c ca="right">
                        <p>32.6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NE060310</p>
                     </c>
                     <c ca="right">
                        <p>6908</p>
                     </c>
                     <c ca="right">
                        <p>31.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HOPC</p>
                     </c>
                     <c ca="right">
                        <p>8016</p>
                     </c>
                     <c ca="right">
                        <p>36.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HOPC (replicate)</p>
                     </c>
                     <c ca="right">
                        <p>7978</p>
                     </c>
                     <c ca="right">
                        <p>35.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>WB-015</p>
                     </c>
                     <c ca="right">
                        <p>7911</p>
                     </c>
                     <c ca="right">
                        <p>35.6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>FB-017</p>
                     </c>
                     <c ca="right">
                        <p>7892</p>
                     </c>
                     <c ca="right">
                        <p>35.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hAPC</p>
                     </c>
                     <c ca="right">
                        <p>7794</p>
                     </c>
                     <c ca="right">
                        <p>35.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hAPC (replicate 1)</p>
                     </c>
                     <c ca="right">
                        <p>8901</p>
                     </c>
                     <c ca="right">
                        <p>40.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hAPC (replicate 2)</p>
                     </c>
                     <c ca="right">
                        <p>8671</p>
                     </c>
                     <c ca="right">
                        <p>39.1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hAST line</p>
                     </c>
                     <c ca="right">
                        <p>7302</p>
                     </c>
                     <c ca="right">
                        <p>32.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>hSC line</p>
                     </c>
                     <c ca="right">
                        <p>8061</p>
                     </c>
                     <c ca="right">
                        <p>36.3</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>After implementing a signal intensity value cutoff of &#8805; 100, we next examined the expression of several known positive and negative glial markers across these samples. Known glial markers, such as SOX10, PDGFRA, S100B, NKX2.2, OLIG2, EGFR, NESTIN, and OLIG1, had higher expression level in glial precursor NAE than in other populations (Table <tblr tid="T4">4</tblr>). In contrast, expression of neuronal lineage-related genes such as NPAS1 (neuronal PAS domain protein), DCX (doublecortin), CHRNA3 and CHRNA5 (cholinergic receptor nicotinic alpha polypeptide 3 and 5), ENO2 (enolase 2), and NEF3 (neurofilament 3, 150 kDa), was downregulated compared to the unsorted population SM and the sorted neuronal population NE, supporting the conclusion that NAE was a population enriched for glial precursors but not for neuronal lineage (Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Fold change in the expression of selected known glial markers in glial precursors NAE versus neuronal precursors NE and unsorted population SM</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Symbol</p>
                     </c>
                     <c ca="left">
                        <p>Synonym</p>
                     </c>
                     <c ca="right">
                        <p>NAE/NE</p>
                     </c>
                     <c ca="right">
                        <p>NAE/SM</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SOX10</p>
                     </c>
                     <c ca="left">
                        <p>DOM;WS4;MGC15649</p>
                     </c>
                     <c ca="right">
                        <p>3.4</p>
                     </c>
                     <c ca="right">
                        <p>19.8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PDGFRA</p>
                     </c>
                     <c ca="left">
                        <p>CD140A;PDGFR2</p>
                     </c>
                     <c ca="right">
                        <p>2.9</p>
                     </c>
                     <c ca="right">
                        <p>80.4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S100B</p>
                     </c>
                     <c ca="left">
                        <p>NEF;S100</p>
                     </c>
                     <c ca="right">
                        <p>2.8</p>
                     </c>
                     <c ca="right">
                        <p>10.7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NKX2-2</p>
                     </c>
                     <c ca="left">
                        <p>NKX2B;NKX2.2</p>
                     </c>
                     <c ca="right">
                        <p>2.5</p>
                     </c>
                     <c ca="right">
                        <p>22.0</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>OLIG2</p>
                     </c>
                     <c ca="left">
                        <p>BHLHB1;RACK17;PRKCBP2</p>
                     </c>
                     <c ca="right">
                        <p>2.4</p>
                     </c>
                     <c ca="right">
                        <p>25.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>EGFR</p>
                     </c>
                     <c ca="left">
                        <p>ERBB;ERBB1</p>
                     </c>
                     <c ca="right">
                        <p>2.3</p>
                     </c>
                     <c ca="right">
                        <p>40.9</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NES</p>
                     </c>
                     <c ca="left">
                        <p>FLJ21841</p>
                     </c>
                     <c ca="right">
                        <p>2.0</p>
                     </c>
                     <c ca="right">
                        <p>6.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>OLIG1</p>
                     </c>
                     <c ca="left">
                        <p>BHLHB6</p>
                     </c>
                     <c ca="right">
                        <p>2.0</p>
                     </c>
                     <c ca="right">
                        <p>58.6</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>Expression of neuronal specific genes is downregulated in glial precursors NAE versus neuronal precursors NE and unsorted population SM</p>
               </caption>
               <tblbdy cols="4">
                  <r>
                     <c ca="left">
                        <p>Symbol</p>
                     </c>
                     <c ca="left">
                        <p>Synonym</p>
                     </c>
                     <c ca="right">
                        <p>NAE/NE</p>
                     </c>
                     <c ca="right">
                        <p>NAE/SM</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NPAS1</p>
                     </c>
                     <c ca="left">
                        <p>MOP5</p>
                     </c>
                     <c ca="right">
                        <p>0.09</p>
                     </c>
                     <c ca="right">
                        <p>0.06</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DCX</p>
                     </c>
                     <c ca="left">
                        <p>DC;DBCN;LISX;SCLH;XLIS</p>
                     </c>
                     <c ca="right">
                        <p>0.33</p>
                     </c>
                     <c ca="right">
                        <p>0.31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NEF3</p>
                     </c>
                     <c ca="left">
                        <p>NFM;NEFM;NF-M</p>
                     </c>
                     <c ca="right">
                        <p>0.53</p>
                     </c>
                     <c ca="right">
                        <p>0.82</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ENO2</p>
                     </c>
                     <c ca="left">
                        <p>NSE</p>
                     </c>
                     <c ca="right">
                        <p>0.62</p>
                     </c>
                     <c ca="right">
                        <p>0.78</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CHRNA5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>0.67</p>
                     </c>
                     <c ca="right">
                        <p>0.43</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NCAM1</p>
                     </c>
                     <c ca="left">
                        <p>CD56;NCAM;MSK39</p>
                     </c>
                     <c ca="right">
                        <p>0.69</p>
                     </c>
                     <c ca="right">
                        <p>1.87</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CHRNA3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="right">
                        <p>0.82</p>
                     </c>
                     <c ca="right">
                        <p>0.61</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Glial precursors show distinct gene expression profiles</p>
            </st>
            <p>Similarities and differences of all samples included in the present work were determined, with a focus on obtaining a list of novel glial precursor markers. A Venn diagram using gene expression intensities of NAE (glial precursors), APC (astrocyte precursors) and SM (unsorted starting material) is shown in Figure <figr fid="F4">4A</figr>. A total of 5,929 transcripts were commonly expressed (at an intensity of &#8805; 100 in NAE, SM and APC). Four hundred and fifty eight transcripts were uniquely expressed in the glial precursor population NAE. Among these 458 transcripts, we validated 10 by RT-PCR (Figure <figr fid="F4">4B</figr> and <figr fid="F4">4C</figr>), which were among the 344 genes that were expressed more than two fold higher in NAE than in other cell types based on the array data (see Additional file <supplr sid="S2">2</supplr>).</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>
                     <b>Transcripts that are expressed at 2-fold or higher in NAE cells.</b>
                  </p>
               </text>
               <file name="1471-213X-8-102-S2.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Unique genes that are expressed in glial precursors NAE</p>
               </caption>
               <text>
                  <p><b>Unique genes that are expressed in glial precursors NAE.</b> (A) shows the extent of overlap for expressed genes of three distinct types of cell populations, NAE, unsorted SM and astrocyte precursor hAPC. A total of 458 transcripts are expressed at &#8805; 100 as detected by the array uniquely to NAE (detailed gene list can be found in Additional file <supplr sid="S2">2</supplr>). A selected group of genes (B) are validated by RT-PCR (C). In (B), the numbers in columns NAE, SM and APC represent the expression levels of these samples. The units are arbitrary as the signals are obtained by comparing with the background signals of the array chip. The numbers in columns NAE/SM and NAE/APC represent the ratios of the expression levels of the listed genes. The RT-PCR results (C) validate that all 10 genes listed in (B) have higher expression for NAE than for SM or APC, while the expression for the internal control GAPDH is similar across all three samples.</p>
               </text>
               <graphic file="1471-213X-8-102-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Novel cell surface markers can be identified for glial precursors</p>
            </st>
            <p>In search of novel cell surface markers from A2B5+/NCAM- magnetically sorted glial precursor NAE cells, we compared NAE with unsorted fetal brain cells (SM), and with NCAM+ sorted neuronal precursor NE cells. We have found that the expression of several known glial specific cell surface markers, such as NG2 (chondroitin sulfate proteoglycan 4, melanoma-associated, CSPG4), was upregulated in NAE. BCAN, the gene encoding the proteoglycan molecule Brevican,, was found to be enriched in NAE as its expression was nearly 15-fold higher in NAE than in unsorted brain cells SM and 2&#8211;4 fold higher than in NCAM+ sorted NE and A2B5+ single sorted AE cells (the signal intensity was 6873.3 in NAE, 466.2 in SM, 2930.8 in NE and 1561.9 in AE). Another group of cell surface molecules that were differentially expressed by NAE were members of the integrin family, particularly integrin beta 5 (ITGB5) and integrin beta 8 (ITGB8). Both were expressed higher (15- and 6-fold, respectively) in glial precursors than in unpurified cells (the signal intensity of ITGB5 was 4712.6 in NAE and 301.7 in SM; the signal intensity of ITGB8 was 29.7 in NAE and 4.9 in SM).</p>
         </sec>
         <sec>
            <st>
               <p>Transcription factors and molecules of major signal transduction pathways show distinct profile in A2B5+/NCAM- glial precursors</p>
            </st>
            <p>Screening of transcription factors, cell surface markers, receptors, and extracellular matrix molecules showed distinct profile for glial precursor population NAE. Sixty-one transcription factors were expressed at 2-fold or higher in glial precursors NAE, which included known transcription factors that drove glial specification such as Olig2, ID3 and Nkx2.2. GJA1 (Connexin 43), a known marker for glial precursors, was detected 4-fold higher in glial precursors (signal intensity 375.3) than in neuronal precursors (signal intensity 96.2).</p>
            <p>We also performed a detailed pathway analysis by comparing the A2B5+/NCAM- glial precursors NAE to NSCs (WBFB, Table <tblr tid="T6">6</tblr>). Forty seven transcription factors were expressed higher in NAE than in WBFB. Among them were genes from the SLIT and NTRK-like family, SLITRK1, SLITRK4, and SLITRK5, which were expressed 5~10-fold higher in glial precursor NAE than in WBFB NSCs. In particular, expression signal value for SLITRK4 in NAE was 160 and was not detected in WBFB (signal intensity&lt;0).</p>
            <tbl id="T6">
               <title>
                  <p>Table 6</p>
               </title>
               <caption>
                  <p>Important pathways in NAE</p>
               </caption>
               <tblbdy cols="10">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Symbol</p>
                     </c>
                     <c ca="right">
                        <p>NAE</p>
                     </c>
                     <c ca="right">
                        <p>WBFB</p>
                     </c>
                     <c ca="right">
                        <p>NAE/WBFB</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Symbol</p>
                     </c>
                     <c ca="right">
                        <p>NAE</p>
                     </c>
                     <c ca="right">
                        <p>WBFB</p>
                     </c>
                     <c ca="right">
                        <p>NAE/WBFB</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Transcription</p>
                     </c>
                     <c ca="left">
                        <p>SOX10</p>
                     </c>
                     <c ca="right">
                        <p>978.4</p>
                     </c>
                     <c ca="right">
                        <p>16.4</p>
                     </c>
                     <c ca="right">
                        <p>59.8</p>
                     </c>
                     <c ca="center">
                        <p>FGF</p>
                     </c>
                     <c ca="left">
                        <p>FGF12</p>
                     </c>
                     <c ca="right">
                        <p>116.3</p>
                     </c>
                     <c ca="right">
                        <p>8</p>
                     </c>
                     <c ca="right">
                        <p>14.5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>factors</p>
                     </c>
                     <c ca="left">
                        <p>POU3F2</p>
                     </c>
                     <c ca="right">
                        <p>488.3</p>
                     </c>
                     <c ca="right">
                        <p>129.1</p>
                     </c>
                     <c ca="right">
                        <p>3.8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>FGF9</p>
                     </c>
                     <c ca="right">
                        <p>58.2</p>
                     </c>
                     <c ca="right">
                        <p>16.9</p>
                     </c>
                     <c ca="right">
                        <p>3.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>LZTS1</p>
                     </c>
                     <c ca="right">
                        <p>218.7</p>
                     </c>
                     <c ca="right">
                        <p>11.2</p>
                     </c>
                     <c ca="right">
                        <p>19.6</p>
                     </c>
                     <c ca="center">
                        <p>TGF&#946;</p>
                     </c>
                     <c ca="left">
                        <p>BAMBI</p>
                     </c>
                     <c ca="right">
                        <p>537.9</p>
                     </c>
                     <c ca="right">
                        <p>156.6</p>
                     </c>
                     <c ca="right">
                        <p>3.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>DACH</p>
                     </c>
                     <c ca="right">
                        <p>175.9</p>
                     </c>
                     <c ca="right">
                        <p>0.3</p>
                     </c>
                     <c ca="right">
                        <p>703.4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CDKN2B</p>
                     </c>
                     <c ca="right">
                        <p>342.4</p>
                     </c>
                     <c ca="right">
                        <p>35</p>
                     </c>
                     <c ca="right">
                        <p>9.8</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SLITRK4</p>
                     </c>
                     <c ca="right">
                        <p>160.4</p>
                     </c>
                     <c ca="right">
                        <p>-1.2</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>STAT1</p>
                     </c>
                     <c ca="right">
                        <p>274.1</p>
                     </c>
                     <c ca="right">
                        <p>124.7</p>
                     </c>
                     <c ca="right">
                        <p>2.2</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NR0B1</p>
                     </c>
                     <c ca="right">
                        <p>94.1</p>
                     </c>
                     <c ca="right">
                        <p>-8</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IGFBP3</p>
                     </c>
                     <c ca="right">
                        <p>159.4</p>
                     </c>
                     <c ca="right">
                        <p>22</p>
                     </c>
                     <c ca="right">
                        <p>7.3</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SLITRK5</p>
                     </c>
                     <c ca="right">
                        <p>91</p>
                     </c>
                     <c ca="right">
                        <p>8.9</p>
                     </c>
                     <c ca="right">
                        <p>10.3</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>COL1A2</p>
                     </c>
                     <c ca="right">
                        <p>127.9</p>
                     </c>
                     <c ca="right">
                        <p>46.7</p>
                     </c>
                     <c ca="right">
                        <p>2.7</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>EMX1</p>
                     </c>
                     <c ca="right">
                        <p>82.7</p>
                     </c>
                     <c ca="right">
                        <p>12.7</p>
                     </c>
                     <c ca="right">
                        <p>6.5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>BMP6</p>
                     </c>
                     <c ca="right">
                        <p>93.4</p>
                     </c>
                     <c ca="right">
                        <p>7.5</p>
                     </c>
                     <c ca="right">
                        <p>12.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SLIT2</p>
                     </c>
                     <c ca="right">
                        <p>51.4</p>
                     </c>
                     <c ca="right">
                        <p>23</p>
                     </c>
                     <c ca="right">
                        <p>2.2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>TGFBI</p>
                     </c>
                     <c ca="right">
                        <p>49.6</p>
                     </c>
                     <c ca="right">
                        <p>4.1</p>
                     </c>
                     <c ca="right">
                        <p>12.2</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Wnt</p>
                     </c>
                     <c ca="left">
                        <p>SFRP1</p>
                     </c>
                     <c ca="right">
                        <p>2241</p>
                     </c>
                     <c ca="right">
                        <p>638.9</p>
                     </c>
                     <c ca="right">
                        <p>3.5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SERPINE1</p>
                     </c>
                     <c ca="right">
                        <p>41.6</p>
                     </c>
                     <c ca="right">
                        <p>15.3</p>
                     </c>
                     <c ca="right">
                        <p>2.7</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SFRP2</p>
                     </c>
                     <c ca="right">
                        <p>259.5</p>
                     </c>
                     <c ca="right">
                        <p>51</p>
                     </c>
                     <c ca="right">
                        <p>5.1</p>
                     </c>
                     <c ca="center">
                        <p>cAMP</p>
                     </c>
                     <c ca="left">
                        <p>NPY</p>
                     </c>
                     <c ca="right">
                        <p>3923</p>
                     </c>
                     <c ca="right">
                        <p>167.9</p>
                     </c>
                     <c ca="right">
                        <p>23.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IL11</p>
                     </c>
                     <c ca="right">
                        <p>62.8</p>
                     </c>
                     <c ca="right">
                        <p>-2.3</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>LDHA</p>
                     </c>
                     <c ca="right">
                        <p>3855</p>
                     </c>
                     <c ca="right">
                        <p>1923</p>
                     </c>
                     <c ca="right">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Steroid</p>
                     </c>
                     <c ca="left">
                        <p>CRH</p>
                     </c>
                     <c ca="right">
                        <p>1990</p>
                     </c>
                     <c ca="right">
                        <p>41.2</p>
                     </c>
                     <c ca="right">
                        <p>48.4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SCG2</p>
                     </c>
                     <c ca="right">
                        <p>2126</p>
                     </c>
                     <c ca="right">
                        <p>137.9</p>
                     </c>
                     <c ca="right">
                        <p>15.4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>related</p>
                     </c>
                     <c ca="left">
                        <p>HMGA1</p>
                     </c>
                     <c ca="right">
                        <p>381.8</p>
                     </c>
                     <c ca="right">
                        <p>157.5</p>
                     </c>
                     <c ca="right">
                        <p>2.4</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>SGK</p>
                     </c>
                     <c ca="right">
                        <p>595.2</p>
                     </c>
                     <c ca="right">
                        <p>250.9</p>
                     </c>
                     <c ca="right">
                        <p>2.4</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>STAT1</p>
                     </c>
                     <c ca="right">
                        <p>274.1</p>
                     </c>
                     <c ca="right">
                        <p>124.7</p>
                     </c>
                     <c ca="right">
                        <p>2.2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>PENK</p>
                     </c>
                     <c ca="right">
                        <p>433.9</p>
                     </c>
                     <c ca="right">
                        <p>-5.6</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NR0B1</p>
                     </c>
                     <c ca="right">
                        <p>94.1</p>
                     </c>
                     <c ca="right">
                        <p>-8</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>PLAT</p>
                     </c>
                     <c ca="right">
                        <p>367.9</p>
                     </c>
                     <c ca="right">
                        <p>155.8</p>
                     </c>
                     <c ca="right">
                        <p>2.4</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>MAPK</p>
                     </c>
                     <c ca="left">
                        <p>CDKN2B</p>
                     </c>
                     <c ca="right">
                        <p>342.4</p>
                     </c>
                     <c ca="right">
                        <p>35</p>
                     </c>
                     <c ca="right">
                        <p>9.8</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CDKN2B</p>
                     </c>
                     <c ca="right">
                        <p>342.4</p>
                     </c>
                     <c ca="right">
                        <p>35</p>
                     </c>
                     <c ca="right">
                        <p>9.8</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CCNA1</p>
                     </c>
                     <c ca="right">
                        <p>334.5</p>
                     </c>
                     <c ca="right">
                        <p>44.5</p>
                     </c>
                     <c ca="right">
                        <p>7.5</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CCNA1</p>
                     </c>
                     <c ca="right">
                        <p>334.5</p>
                     </c>
                     <c ca="right">
                        <p>44.5</p>
                     </c>
                     <c ca="right">
                        <p>7.5</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>MAPK8IP2</p>
                     </c>
                     <c ca="right">
                        <p>162.8</p>
                     </c>
                     <c ca="right">
                        <p>81.1</p>
                     </c>
                     <c ca="right">
                        <p>2</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>BDNF</p>
                     </c>
                     <c ca="right">
                        <p>57.3</p>
                     </c>
                     <c ca="right">
                        <p>15.9</p>
                     </c>
                     <c ca="right">
                        <p>3.6</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>CALB1</p>
                     </c>
                     <c ca="right">
                        <p>34.4</p>
                     </c>
                     <c ca="right">
                        <p>-4.1</p>
                     </c>
                     <c ca="right">
                        <p>&#8733;</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Two secreted frizzled-related proteins, SFRP1 and SFRP2, which are important antagonists of the Wnt pathway, were expressed three to five fold higher in the glial precursor NAE. On the contrary, a Wnt inducer, IL11, was also upregulated in NAE (signal intensity 62.8) and not detected in NSCs (WBFB, signal intensity &lt;0). These data indicated that at least Wnt molecules were differentially regulated in NAE and direct evidence is needed to establish the role of SFRPs and other Wnt molecules in glial differentiation <abbrgrp><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr></abbrgrp>.</p>
            <p>FGFs are important in both proliferation and differentiation of NSCs. Here we have found that FGF9 and FGF12 were highly expressed (3~14-fold) in glial precursors NAE compared to NSCs WBFB (signal intensity was 58.2 and 116.3 in NAE, and 16.9 and 8 in WBFB). Further examination of these two growth factors for their role in directing NSCs or glial precursors toward mature glia is warranted.</p>
            <p>Steroids have been shown to affect and regulate glial gene expression <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. We have found that corticotropin releasing hormone (CRH or CRF) was highly expressed in NAE (signal intensity 1989.8) but was 48-fold lower in WBFB (signal intensity 41.2). Additionally, expression of nuclear receptor family members such as NR0B1, was upregulated in NAE as compared to WBFB as well.</p>
            <p>Several cell cycle regulators and key genes of the MAPK pathway, CDKN2B (cyclin-dependent kinase inhibitor 2B, or p15) which inhibits CDK4, and CCNA1 (Cyclin A1), were found to be expressed at 7&#8211;10 fold higher in NAE than in WBFB.</p>
            <p>The TGF&#946; pathway is a key pathway involved in glial differentiation <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B34">34</abbr></abbrgrp> and our findings were consistent with the published data. Expression of several key components of the TGF&#946; pathway, for example, nuclear receptor subfamily 0, group B, member 1 (NR0B1), bone morphogenetic protein 6 (BMP6), transforming growth factor beta-induced (TGFBI), and BMP and activin membrane-bound inhibitor homolog (BAMBI), was detected more than 10-fold higher in glial precursor NAE than in NSCs WBFB.</p>
            <p>Cyclic AMP also plays an important role in neural and glial differentiation <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Several cAMP related genes, including calbindin 1 (CALB1), proenkephalin (PENK), neuropeptide Y (NPY) and secretogranin II (chromogranin C) (SCG2) were highly expressed in NAE but were expressed much lower (7~20-fold) or were absent in the NSC population WBFB.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In this manuscript, we generated global gene expression profiles for human glial precursors, astrocyte precursors, neuronal precursors and NSCs isolated from fetal tissues using Illumina bead array. We focused on detailed marker and pathway analysis for glial precursors by comparing their profile to other populations.</p>
         <p>Differential expression of markers on the plasma membrane of glial precursors was used to isolate these cells from a general population of fetal brain cells. The general cellular population was depleted for those expressing NCAM followed by enrichment of those cells that were recognized by the A2B5 antibody. The resultant population (A2B5+ and NCAM-, NAE) has been shown to have characteristics of glial precursors and give rise to only oligodendrocytes and astrocytes upon further differentiation in vitro and in vivo (Figure <figr fid="F2">2</figr> and data not shown).</p>
         <p>Generally accepted glial precursor markers such as Olig1, Olig2, Nkx2.2, ID2, ID4, and glutamate transporter genes were expressed higher in the glial precursor populations (Table <tblr tid="T4">4</tblr>, see Additional file <supplr sid="S1">1</supplr>). Expression data collected for glial precursors, astrocyte precursors, neuronal precursors, and NSCs showed that glial precursors NAE possessed a distinct gene expression profile, suggesting several core signaling pathways that might be important in glial differentiation. For instance, major components of the TGF&#946; pathway, BMP6, BMP7, TGFBI, and TGFBII, were upregulated in glial precursors when compared to NSCs or neuronal precursors. These data are consistent with previous observations that BMPs can induce glial differentiation <abbrgrp><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>.</p>
         <p>We also found several novel pathways or molecules that might be involved in glial differentiation. For instance, the SLIT and NTRK-like family proteins (Slitrk). Slitrk's are integral membrane proteins, with two leucine-rich repeat (LRR) domains similar to Slit family and C-term domains similar to Trk proteins and might possess the Trk kinase function. Genes of Slitrk family are found to be predominantly expressed in the brain and glial tumors including astrocytoma, oligodendroglioma and glioblastoma <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Consistent with these reports, three Slitrk proteins Slitrk1, Slitrk4 and Slitrk5, as well as Slit2 were differentially highly expressed in all glial precursor populations described in this work. These combined indicate that the Slit pathways are important to glial differentiation. Since Slitrk's are integral transmembrane proteins, these molecules may also serve as new cell surface markers for isolating glial precursors.</p>
         <p>Similarly, Ephrins, proteins involved in axon guidance, were found to be differentially expressed in our glial precursor populations as well. For example, EPHA2, EPHA3, EPHA5, EPHB6 were expressed 2~4-fold higher in glial precursors than in NSCs or neuronal populations. In line with our data, the EphB2 receptor has recently been reported to be released at the neuron-glia interaction from neurons and endogenous EphB2 was expressed by glia simultaneously <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. In addition, the Ephrin family receptor tyrosine kinases were shown to be upregulated in response to CNS injury as part of the function of glia <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>. The above mentioned pathways have previously been implicated in neuronal pathfinding and synaptogenesis. Their expression in glial lineages may reflect the growing body of evidence pointing to the importance of glia in neuronal development events <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>.</p>
         <p>Differential expression of genes in the Pax-Six-Eya-Dach (paired box-sine oculis homeobox-eyes absent-dachshund) gene regulatory network was also observed. Dach was expressed 700 fold higher in glial precursors than NSCs (Figure <figr fid="F4">4</figr> and see Additional file <supplr sid="S1">1</supplr>), and Eya2 and Six5 were expressed 2~4-fold higher in glial precursors than in neuronal precursors (see Additional file <supplr sid="S1">1</supplr>). The Pax-Six-Eya-Dach network has been shown to be important for inner ear and other sensory organ development <abbrgrp><abbr bid="B41">41</abbr><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr><abbr bid="B44">44</abbr></abbrgrp>, it may be worthwhile to initiate studies that will elucidate this pathway's role in glial biology.</p>
         <p>Several extracellular matrix metalloproteinases showed differential expression in glial populations and other cell types. For instance, MMP7 was expressed 40- to 200-fold higher in glial cells than in NSCs (Figure <figr fid="F4">4</figr> and see Additional file <supplr sid="S1">1</supplr>). This is not totally unexpected as MMP7 has been reported to be involved in the canonical Wnt pathway as well as during FGF2-mediated response <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. Expression of another metalloproteinase related molecule, tissue inhibitor of metalloproteinase 3 (TIMP3), was elevated in glial precursors as well (the signal intensity in NAE was 496.7). These data indicate that the metalloproteinase family may actively participate in glial differentiation.</p>
         <p>Several frizzled-related protein molecules of the Wnt pathway, SFRP1, SFRP2 FRPB, IL11, and FRAT1, were highly expressed in glial precursors when compared to NSCs. However, similar expression was detected for these Wnt molecules in neuronal precursors, supporting the conclusion that these proteins are involved in general neural cell differentiation instead of glial specification.</p>
         <p>Another gene that was brought to our attention was PENK (proenkephalin). It was expressed higher in glial precursors NAE and HOPC (signal intensities 400&#8211;3000) but was not detected in NSCs (signal intensity &lt;0, Additional file <supplr sid="S1">1</supplr>). However, when we examined the expression levels of MAPK1 and MAPK3 (p38), major components of the MAPK-ERK pathway, which regulates PENK expression, no significant changes were found. Possible reasons might be that phosphorylation status or other posttranslational modifications are more important in determining the pathway activity than mRNA levels. To confirm this, proteomic analysis needs to be done as we and others have performed for several cell types including hESCs <abbrgrp><abbr bid="B46">46</abbr></abbrgrp>. This is worth mentioning as protein expression and function are regulated at multiple levels while the present work focuses on the mRNA levels only.</p>
         <p>Genes relevant to the signal transduction pathways Akt, CNTF, SDF-1/CXCR4, PDGF, glial cell line-derived nerve growth factor (GDNF) and receptor tyrosine kinase (RTK) were found to be differentially expressed as well. As expected, members of the PDGF pathway were expressed higher in glial precursors. For the EGF receptor family, NRG1 and EGFR, ERBB3, and the downstream effector SOS were also observed to be differentially upregulated in glial populations as compared to NSCs and neuronal precursors.</p>
         <p>Recently, several zinc finger proteins have been implicated in various processes of neural development and glial differentiation <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr></abbrgrp>. Here we have found that zinc finger proteins Znf135, Znf136, Znf161, Znf24, Znf91, Znf435, Znf154, Znf232, and Znf219, were expressed as much as 14-fold or higher in glial precursors than in astrocyte precursors hAPC. Znf494, a zinc finger protein of unknown function <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> was expressed 415~663-fold higher in glial precursors than in NSCs. Conversely, another set of zinc finger proteins, Znf145, Znf537 Znf345, Znf370, Znf51 (Bcl6), Znf268, Znf375, and Znf373, were highly expressed in hAPC. The zinc fingers identified in this work may warrant further study.</p>
         <p>Analyses of these expression data have led to the identification of novel cell surface markers which may be used for identification or isolation of glial precursors. Our results indicate that in addition to the well accepted surface marker NG2, Brevican and Integrin beta 5 and beta 8 are potential cell surface molecules for glial precursors. Brevican is a neural-specific chondroitin sulfate proteoglycan and is expressed in mature astrocytes and downregulated in adult rat spinal cords <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B51">51</abbr></abbrgrp>. &#946; integrins have been reported to be involved in spinal cord injury and regeneration process. Both Brevican and integrins can be regulated by the TGF&#946; pathway <abbrgrp><abbr bid="B50">50</abbr><abbr bid="B52">52</abbr></abbrgrp>. Our results show that Brevican expression is significantly increased in glial precursors. In line with this, expression of ADAMTS4, a gene that encodes a disintegrin and metalloproteinase that selectively cleaves Brevican/Lectican, also is elevated in the glial precursor population. A detailed time course study of its expression in glial development in the human fetal brain is underway to validate its utility as a marker for isolating glial precursors.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have compared gene expression profile of glial precursors to neuronal precursors, astrocyte precursors and NSCs. Such information may be utilized to further purify glial precursor populations, optimize media formulation, or study the effects of glial cell differentiation.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>SM: <ul>s</ul>taring <ul>m</ul>aterial (unsorted fetal brain cells); NAE: <ul>N</ul>CAM flow through: <ul>A</ul>2B5 <ul>E</ul>luate (A2B5+: PSA-NCAM- cells); AE: <ul>A</ul>2B5 <ul>E</ul>luate (A2B5+ cells); NE: <ul>N</ul>CAM <ul>E</ul>luate (PSA-NCAM+ cells); HOPC: human oligodendrocyte precursors (A2B5+: PSA-NCAM- cells); WB: Neurosphere from <ul>w</ul>hole <ul>b</ul>rain; FB: Neurosphere from <ul>f</ul>rontal <ul>b</ul>rain; hAPC: <ul>h</ul>uman <ul>a</ul>strocyte <ul>p</ul>recursor <ul>c</ul>ells (CD44+ cells); hESC: <ul>h</ul>uman <ul>e</ul>mbryonic <ul>s</ul>tem <ul>c</ul>ells; mESC: <ul>m</ul>ouse <ul>e</ul>mbryonic <ul>s</ul>tem <ul>c</ul>ells; NSC: <ul>n</ul>eural <ul>s</ul>tem <ul>c</ul>ells; FGF: fibroblast growth factor; EGF: epidermal growth factor; TGF&#946;: transforming growth factors beta; BMP: bone morphogenetic proteins; LIF: leukemia inhibitory factor; CNTF: ciliary neurotropic factor; Slitrk: SLIT and NTRK-like family proteins; PDGF: platelet derived growth factor; GDNF: glial cell line-derived nerve growth factor; RTK: receptor tyrosine kinase; MACS: <ul>ma</ul>gnetic <ul>c</ul>ell <ul>s</ul>orting; FACS: <ul>f</ul>luorescence <ul>a</ul>ctivate <ul>c</ul>ell <ul>s</ul>orting;</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>JTC and RWS provided and analyzed NAE, NE, AE, SM samples, participated in designing the project, drafting and editing the manuscript. WW provided and analyzed NAE, NE, AE, SM samples. HX provided hAPC sample and performed RT-PCR. JZ, FL, MZ performed bioinformatics study. JDC edited the manuscript. YL designed the project, coordinated the collaboration and drafted the manuscript. MSR conceived of the study and supervised YL. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported by Invitrogen Corporation and Q Therapeutics Inc. The authors would like to thank Dr. Steve Goldman, Dr. Ahmet Hoke, and Cognate Inc. for providing samples. We thank all members of our laboratories for constant stimulating discussions. MSR acknowledges the contributions of Dr. S. Rao that made undertaking this project possible.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Glial progenitors in the CNS and possible lineage relationships among them</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Biol Cell</source>
            <pubdate>2004</pubdate>
            <volume>96</volume>
            <fpage>279</fpage>
            <lpage>90</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.biolcel.2004.02.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">15145532</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Gliogenesis in the central nervous system</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Mayer-Proschel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2000</pubdate>
            <volume>30</volume>
            <fpage>105</fpage>
            <lpage>21</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1098-1136(200004)30:2&lt;105::AID-GLIA1>3.0.CO;2-H</pubid>
                  <pubid idtype="pmpid" link="fulltext">10719353</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>An 'oligarchy' rules neural development</p>
            </title>
            <aug>
               <au>
                  <snm>Rowitch</snm>
                  <fnm>DH</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>QR</fnm>
               </au>
               <au>
                  <snm>Kessaris</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>WD</fnm>
               </au>
            </aug>
            <source>Trends Neurosci</source>
            <pubdate>2002</pubdate>
            <volume>25</volume>
            <fpage>417</fpage>
            <lpage>22</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-2236(02)02201-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">12127759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Massively parallel signature sequencing profiling of fetal human neural precursor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Cai</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Shin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Khrebtukova</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Mattson</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Svendsen</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Stem Cells Dev</source>
            <pubdate>2006</pubdate>
            <volume>15</volume>
            <fpage>232</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/scd.2006.15.232</pubid>
                  <pubid idtype="pmpid" link="fulltext">16646669</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Human neural precursor cells &#8211; an in vitro characterization</p>
            </title>
            <aug>
               <au>
                  <snm>Mayer-Proschel</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Carpenter</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Clin Neurosci Res</source>
            <pubdate>2002</pubdate>
            <volume>2</volume>
            <fpage>58</fpage>
            <lpage>69</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S1566-2772(02)00007-5</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>From rodent glial precursor cell to human glial neoplasia in the oligodendrocyte-type-2 astrocyte lineage</p>
            </title>
            <aug>
               <au>
                  <snm>Noble</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gutowski</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bevan</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Engel</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Linskey</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Urenjak</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Bhakoo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>1995</pubdate>
            <volume>15</volume>
            <fpage>222</fpage>
            <lpage>30</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.440150304</pubid>
                  <pubid idtype="pmpid">8586459</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A tripotential glial precursor cell is present in the developing spinal cord</p>
            </title>
            <aug>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Noble</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mayer-Proschel</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>3996</fpage>
            <lpage>4001</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">19951</pubid>
                  <pubid idtype="pmpid" link="fulltext">9520481</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.7.3996</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>The specificity of monoclonal antibody A2B5 to c-series gangliosides</p>
            </title>
            <aug>
               <au>
                  <snm>Saito</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kitamura</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sugiyama</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>2001</pubdate>
            <volume>78</volume>
            <fpage>64</fpage>
            <lpage>74</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1471-4159.2001.00365.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11432974</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Multiple routes to astrocytic differentiation in the CNS</p>
            </title>
            <aug>
               <au>
                  <snm>Rajan</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>McKay</snm>
                  <fnm>RD</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>1998</pubdate>
            <volume>18</volume>
            <fpage>3620</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9570793</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Development of glial cells in the cerebral wall of ferrets: direct tracing of their transformation from radial glia into astrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Voigt</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Comp Neurol</source>
            <pubdate>1989</pubdate>
            <volume>289</volume>
            <fpage>74</fpage>
            <lpage>88</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/cne.902890106</pubid>
                  <pubid idtype="pmpid">2808761</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Lineage of radial glia in the chicken optic tectum</p>
            </title>
            <aug>
               <au>
                  <snm>Gray</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Sanes</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>1992</pubdate>
            <volume>114</volume>
            <fpage>271</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1576964</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>The tripotential glial-restricted precursor (GRP) cell and glial development in the spinal cord: generation of bipotential oligodendrocyte-type-2 astrocyte progenitor cells and dorsal-ventral differences in GRP cell function</p>
            </title>
            <aug>
               <au>
                  <snm>Gregori</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Proschel</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Noble</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mayer-Proschel</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2002</pubdate>
            <volume>22</volume>
            <fpage>248</fpage>
            <lpage>56</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11756508</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Transplantation of glial-restricted precursor cells into the adult spinal cord: survival, glial-specific differentiation, and preferential migration in white matter</p>
            </title>
            <aug>
               <au>
                  <snm>Han</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tyler-Polsz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>I</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2004</pubdate>
            <volume>45</volume>
            <fpage>1</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.10282</pubid>
                  <pubid idtype="pmpid" link="fulltext">14648541</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Glial cell heterogeneity in the mammalian spinal cord</p>
            </title>
            <aug>
               <au>
                  <snm>Miller</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Fok-Seang</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Perspect Dev Neurobiol</source>
            <pubdate>1994</pubdate>
            <volume>2</volume>
            <fpage>225</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7850355</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Multipotential and lineage restricted precursors coexist in the mammalian perinatal subventricular zone</p>
            </title>
            <aug>
               <au>
                  <snm>Levison</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>JE</fnm>
               </au>
            </aug>
            <source>J Neurosci Res</source>
            <pubdate>1997</pubdate>
            <volume>48</volume>
            <fpage>83</fpage>
            <lpage>94</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1097-4547(19970415)48:2&lt;83::AID-JNR1>3.0.CO;2-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">9130137</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Concise review: bone morphogenetic protein pleiotropism in neural stem cells and their derivatives&#8211;alternative pathways, convergent signals</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Panchision</snm>
                  <fnm>DM</fnm>
               </au>
            </aug>
            <source>Stem Cells</source>
            <pubdate>2007</pubdate>
            <volume>25</volume>
            <fpage>63</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1634/stemcells.2006-0339</pubid>
                  <pubid idtype="pmpid" link="fulltext">16973830</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>LIF and BMP signaling generate separate and discrete types of GFAP-expressing cells</p>
            </title>
            <aug>
               <au>
                  <snm>Bonaguidi</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>McGuire</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kan</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Samanta</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kessler</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2005</pubdate>
            <volume>132</volume>
            <fpage>5503</fpage>
            <lpage>14</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1242/dev.02166</pubid>
                  <pubid idtype="pmpid" link="fulltext">16314487</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>CNTF promotes the survival and differentiation of adult spinal cord-derived oligodendrocyte precursor cells in vitro but fails to promote remyelination in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Talbott</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Cao</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Bertram</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nkansah</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Benton</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Lavik</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Whittemore</snm>
                  <fnm>SR</fnm>
               </au>
            </aug>
            <source>Exp Neurol</source>
            <pubdate>2007</pubdate>
            <volume>204</volume>
            <fpage>485</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2430994</pubid>
                  <pubid idtype="pmpid" link="fulltext">17274982</pubid>
                  <pubid idtype="doi">10.1016/j.expneurol.2006.12.013</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Oligodendrocyte and astrocyte development in rodents: an in situ and immunohistological analysis during embryonic development</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Pevny</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Kaprielian</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2002</pubdate>
            <volume>40</volume>
            <fpage>25</fpage>
            <lpage>43</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.10111</pubid>
                  <pubid idtype="pmpid" link="fulltext">12237841</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>CD44 expression identifies astrocyte-restricted precursor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Han</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tuohy</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Cai</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Back</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Sherman</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Fischer</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2004</pubdate>
            <volume>276</volume>
            <fpage>31</fpage>
            <lpage>46</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2004.08.018</pubid>
                  <pubid idtype="pmpid" link="fulltext">15531362</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Differences between human and mouse embryonic stem cells</p>
            </title>
            <aug>
               <au>
                  <snm>Ginis</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Luo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Miura</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Thies</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brandenberger</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gerecht-Nir</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Amit</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hoke</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Carpenter</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Itskovitz-Eldor</snm>
                  <fnm>J</fnm>
               </au>
               <etal/>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2004</pubdate>
            <volume>269</volume>
            <fpage>360</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2003.12.034</pubid>
                  <pubid idtype="pmpid" link="fulltext">15110706</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Whole genome analysis of human neural stem cells derived from embryonic stem cells and stem and progenitor cells isolated from fetal tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Shin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Khaner</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Svant</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cai</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>QX</fnm>
               </au>
               <au>
                  <snm>Davidson</snm>
                  <fnm>BP</fnm>
               </au>
               <au>
                  <snm>Stice</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>AK</fnm>
               </au>
               <etal/>
            </aug>
            <source>Stem Cells</source>
            <pubdate>2007</pubdate>
            <volume>25</volume>
            <fpage>1298</fpage>
            <lpage>306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1634/stemcells.2006-0660</pubid>
                  <pubid idtype="pmpid" link="fulltext">17272497</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Fetal and adult human oligodendrocyte progenitor cell isolates myelinate the congenitally dysmyelinated brain</p>
            </title>
            <aug>
               <au>
                  <snm>Windrem</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Nunes</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Rashbaum</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>TH</fnm>
               </au>
               <au>
                  <snm>Goodman</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>G</snm>
                  <fnm>McKhann</fnm>
                  <suf>2nd</suf>
               </au>
               <au>
                  <snm>Roy</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Goldman</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2004</pubdate>
            <volume>10</volume>
            <fpage>93</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm974</pubid>
                  <pubid idtype="pmpid" link="fulltext">14702638</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Genome wide profiling of human embryonic stem cells (hESCs), their derivatives and embryonal carcinoma cells to develop base profiles of U.S. Federal government approved hESC lines</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Shin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Zeng</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Zhan</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mueller</snm>
                  <fnm>FJ</fnm>
               </au>
               <au>
                  <snm>Schwartz</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Xue</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>SC</fnm>
               </au>
               <etal/>
            </aug>
            <source>BMC Dev Biol</source>
            <pubdate>2006</pubdate>
            <volume>6</volume>
            <fpage>20</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1523200</pubid>
                  <pubid idtype="pmpid" link="fulltext">16672070</pubid>
                  <pubid idtype="doi">10.1186/1471-213X-6-20</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Gene selection for oligonucleotide array: an approach using PM probe level data</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>DT</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Soong</snm>
                  <fnm>SJ</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2004</pubdate>
            <volume>20</volume>
            <fpage>854</fpage>
            <lpage>62</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg493</pubid>
                  <pubid idtype="pmpid" link="fulltext">14752002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Issues in cDNA microarray analysis: quality filtering, channel normalization, models of variations and assessment of gene effects</p>
            </title>
            <aug>
               <au>
                  <snm>Tseng</snm>
                  <fnm>GC</fnm>
               </au>
               <au>
                  <snm>Oh</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Rohlin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Liao</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>2001</pubdate>
            <volume>29</volume>
            <fpage>2549</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">55725</pubid>
                  <pubid idtype="pmpid" link="fulltext">11410663</pubid>
                  <pubid idtype="doi">10.1093/nar/29.12.2549</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>TM4: a free, open-source system for microarray data management and analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Saeed</snm>
                  <fnm>AI</fnm>
               </au>
               <au>
                  <snm>Sharov</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Liang</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Bhagabati</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Braisted</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Klapa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Currier</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Thiagarajan</snm>
                  <fnm>M</fnm>
               </au>
               <etal/>
            </aug>
            <source>Biotechniques</source>
            <pubdate>2003</pubdate>
            <volume>34</volume>
            <fpage>374</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid">12613259</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>A comparative review of statistical methods for discovering differentially expressed genes in replicated microarray experiments</p>
            </title>
            <aug>
               <au>
                  <snm>Pan</snm>
                  <fnm>W</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>546</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/18.4.546</pubid>
                  <pubid idtype="pmpid" link="fulltext">12016052</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements</p>
            </title>
            <aug>
               <au>
                  <snm>Shi</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Reid</snm>
                  <fnm>LH</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>WD</fnm>
               </au>
               <au>
                  <snm>Shippy</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Warrington</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>de Longueville</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kawasaki</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>KY</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nat Biotechnol</source>
            <pubdate>2006</pubdate>
            <volume>24</volume>
            <fpage>1151</fpage>
            <lpage>61</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nbt1239</pubid>
                  <pubid idtype="pmpid" link="fulltext">16964229</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Coordinate regulation of neural tube patterning and proliferation by TGFbeta and WNT activity</p>
            </title>
            <aug>
               <au>
                  <snm>Chesnutt</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Burrus</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Niswander</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2004</pubdate>
            <volume>274</volume>
            <fpage>334</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2004.07.019</pubid>
                  <pubid idtype="pmpid" link="fulltext">15385163</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Wnt regulation of progenitor maturation in the cortex depends on Shh or fibroblast growth factor 2</p>
            </title>
            <aug>
               <au>
                  <snm>Viti</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gulacsi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Lillien</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2003</pubdate>
            <volume>23</volume>
            <fpage>5919</fpage>
            <lpage>27</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12843296</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Wnt signaling and stem cell control</p>
            </title>
            <aug>
               <au>
                  <snm>Nusse</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Cell Res</source>
            <pubdate>2008</pubdate>
            <volume>18</volume>
            <fpage>523</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/cr.2008.47</pubid>
                  <pubid idtype="pmpid" link="fulltext">18392048</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Steroids and glial cell function</p>
            </title>
            <aug>
               <au>
                  <snm>Garcia-Segura</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Melcangi</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2006</pubdate>
            <volume>54</volume>
            <fpage>485</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.20404</pubid>
                  <pubid idtype="pmpid" link="fulltext">16906540</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>BMP and LIF signaling coordinately regulate lineage restriction of radial glia in the developing forebrain</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Grumet</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2007</pubdate>
            <volume>55</volume>
            <fpage>24</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.20434</pubid>
                  <pubid idtype="pmpid" link="fulltext">17001659</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Glutamate enhances proliferation and neurogenesis in human neural progenitor cell cultures derived from the fetal cortex</p>
            </title>
            <aug>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Eickstaedt</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Wallace</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Svendsen</snm>
                  <fnm>CN</fnm>
               </au>
            </aug>
            <source>Eur J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>24</volume>
            <fpage>645</fpage>
            <lpage>53</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1460-9568.2006.04957.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">16848797</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Human SLITRK family genes: genomic organization and expression profiling in normal brain and brain tumor tissue</p>
            </title>
            <aug>
               <au>
                  <snm>Aruga</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Yokota</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mikoshiba</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Gene</source>
            <pubdate>2003</pubdate>
            <volume>315</volume>
            <fpage>87</fpage>
            <lpage>94</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0378-1119(03)00715-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">14557068</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Release of full-length EphB2 receptors from hippocampal neurons to cocultured glial cells</p>
            </title>
            <aug>
               <au>
                  <snm>Lauterbach</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Klein</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <fpage>11575</fpage>
            <lpage>81</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.2697-06.2006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17093078</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Roles of Eph receptors and ephrins in the normal and damaged adult CNS</p>
            </title>
            <aug>
               <au>
                  <snm>Goldshmit</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>McLenachan</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Turnley</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Brain Res Rev</source>
            <pubdate>2006</pubdate>
            <volume>52</volume>
            <fpage>327</fpage>
            <lpage>45</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.brainresrev.2006.04.006</pubid>
                  <pubid idtype="pmpid" link="fulltext">16774788</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Glia promote local synaptogenesis through UNC-6 (netrin) signaling in C. elegans</p>
            </title>
            <aug>
               <au>
                  <snm>Colon-Ramos</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Margeta</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2007</pubdate>
            <volume>318</volume>
            <fpage>103</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1143762</pubid>
                  <pubid idtype="pmpid" link="fulltext">17916735</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Role for glia in synaptogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Ullian</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Christopherson</snm>
                  <fnm>KS</fnm>
               </au>
               <au>
                  <snm>Barres</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Glia</source>
            <pubdate>2004</pubdate>
            <volume>47</volume>
            <fpage>209</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/glia.20082</pubid>
                  <pubid idtype="pmpid" link="fulltext">15252809</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear</p>
            </title>
            <aug>
               <au>
                  <snm>Bricaud</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Collazo</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>J Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>26</volume>
            <fpage>10438</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1523/JNEUROSCI.1025-06.2006</pubid>
                  <pubid idtype="pmpid" link="fulltext">17035528</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Pax-Six-Eya-Dach network during amphioxus development: conservation in vitro but context specificity in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Kozmik</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Holland</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Kreslova</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Oliveri</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Schubert</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jonasova</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Holland</snm>
                  <fnm>LZ</fnm>
               </au>
               <au>
                  <snm>Pestarino</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Benes</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Candiani</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>2007</pubdate>
            <volume>306</volume>
            <fpage>143</fpage>
            <lpage>59</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ydbio.2007.03.009</pubid>
                  <pubid idtype="pmpid" link="fulltext">17477914</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Six1 controls patterning of the mouse otic vesicle</p>
            </title>
            <aug>
               <au>
                  <snm>Ozaki</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Funahashi</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ikeda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yamada</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tokano</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Okamura</snm>
                  <fnm>HO</fnm>
               </au>
               <au>
                  <snm>Kitamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Muto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kotaki</snm>
                  <fnm>H</fnm>
               </au>
               <etal/>
            </aug>
            <source>Development</source>
            <pubdate>2004</pubdate>
            <volume>131</volume>
            <fpage>551</fpage>
            <lpage>62</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1242/dev.00943</pubid>
                  <pubid idtype="pmpid" link="fulltext">14695375</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Expression of zebrafish six1 during sensory organ development and myogenesis</p>
            </title>
            <aug>
               <au>
                  <snm>Bessarab</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Chong</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>Korzh</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>Dev Dyn</source>
            <pubdate>2004</pubdate>
            <volume>230</volume>
            <fpage>781</fpage>
            <lpage>6</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/dvdy.20093</pubid>
                  <pubid idtype="pmpid" link="fulltext">15254912</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Regulation of matrilysin expression in endothelium by fibroblast growth factor-2</p>
            </title>
            <aug>
               <au>
                  <snm>Holnthoner</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Kerenyi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Groger</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kratochvill</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Petzelbauer</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2006</pubdate>
            <volume>342</volume>
            <fpage>725</fpage>
            <lpage>33</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.bbrc.2006.02.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">16494848</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>A large-scale proteomic analysis of human embryonic stem cells</p>
            </title>
            <aug>
               <au>
                  <snm>Schulz</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Swistowska</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Swistowski</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Palmarini</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Brimble</snm>
                  <fnm>SN</fnm>
               </au>
               <au>
                  <snm>Sherrer</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Robins</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Rao</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Zeng</snm>
                  <fnm>X</fnm>
               </au>
            </aug>
            <source>BMC Genomics</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <fpage>478</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2211323</pubid>
                  <pubid idtype="pmpid" link="fulltext">18162134</pubid>
                  <pubid idtype="doi">10.1186/1471-2164-8-478</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Zfp423 controls proliferation and differentiation of neural precursors in cerebellar vermis formation</p>
            </title>
            <aug>
               <au>
                  <snm>Alcaraz</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Gold</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Raponi</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Gent</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Concepcion</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2006</pubdate>
            <volume>103</volume>
            <fpage>19424</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1748242</pubid>
                  <pubid idtype="pmpid" link="fulltext">17151198</pubid>
                  <pubid idtype="doi">10.1073/pnas.0609184103</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>An oligodendrocyte-specific zinc-finger transcription regulator cooperates with Olig2 to promote oligodendrocyte differentiation</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>SZ</fnm>
               </au>
               <au>
                  <snm>Dulin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hurlock</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Jansson</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>QR</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2006</pubdate>
            <volume>133</volume>
            <fpage>3389</fpage>
            <lpage>98</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1242/dev.02522</pubid>
                  <pubid idtype="pmpid" link="fulltext">16908628</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Functional proteomics mapping of a human signaling pathway</p>
            </title>
            <aug>
               <au>
                  <snm>Colland</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Jacq</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Trouplin</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mougin</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Groizeleau</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hamburger</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meil</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wojcik</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Legrain</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Gauthier</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <fpage>1324</fpage>
            <lpage>32</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">442148</pubid>
                  <pubid idtype="pmpid" link="fulltext">15231748</pubid>
                  <pubid idtype="doi">10.1101/gr.2334104</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Altered production and proteolytic processing of brevican by transforming growth factor beta in cultured astrocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Hamel</snm>
                  <fnm>MG</fnm>
               </au>
               <au>
                  <snm>Mayer</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gottschall</snm>
                  <fnm>PE</fnm>
               </au>
            </aug>
            <source>J Neurochem</source>
            <pubdate>2005</pubdate>
            <volume>93</volume>
            <fpage>1533</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1471-4159.2005.03144.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15935069</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Brevican-containing perineuronal nets of extracellular matrix in dissociated hippocampal primary cultures</p>
            </title>
            <aug>
               <au>
                  <snm>John</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Krugel</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Frischknecht</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Smalla</snm>
                  <fnm>KH</fnm>
               </au>
               <au>
                  <snm>Schultz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kreutz</snm>
                  <fnm>MR</fnm>
               </au>
               <au>
                  <snm>Gundelfinger</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Seidenbecher</snm>
                  <fnm>CI</fnm>
               </au>
            </aug>
            <source>Mol Cell Neurosci</source>
            <pubdate>2006</pubdate>
            <volume>31</volume>
            <fpage>774</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.mcn.2006.01.011</pubid>
                  <pubid idtype="pmpid" link="fulltext">16503162</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Integrin alpha(v)beta8-mediated activation of transforming growth factor-beta by perivascular astrocytes: an angiogenic control switch</p>
            </title>
            <aug>
               <au>
                  <snm>Cambier</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gline</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Mu</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Collins</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Araya</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dolganov</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Einheber</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Boudreau</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>SL</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2005</pubdate>
            <volume>166</volume>
            <fpage>1883</fpage>
            <lpage>94</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1602409</pubid>
                  <pubid idtype="pmpid" link="fulltext">15920172</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
