It was previously shown that cnbA is a single-copy gene 4 localized on chromosome 1 of D. discoideum 16. In order to silence cnbA we constructed a stem-loop RNA directed against cnbA (fig. 1). Two fragments of cnbA were amplified from the cDNA, both starting at nucleotide +20. To obtain a loop, the fragments differ 100 bp in length. The truncated cnbA gene fragments were fused in reverse orientation relative to each other. The RNAi construct was cloned into pDNeoII under the control of the actin 6 promoter. The resulting plasmid pKB07 was transformed in D. discoideum AX2 and clonal cell lines were further analysed.

In order to analyze whether expression of the RNAi construct leads to reduction of CNB, expression of the protein was measured in vegetative cells of independent recombinant clones. Western blots with specific antibodies against D. discoideum CNB revealed various levels of reduction among individual cell lines (fig. 2). In a number of cell lines (c.f., 01–4 or 01–5 in fig. 2) CNB was reduced to barely detectable amounts, whereas others (c.f., 0–14 in fig. 2) showed only slightly reduced CNB expression. At later stages during development both CNB protein isoforms were detected (not shown) suggesting that processing of the residual cnbA mRNA is not affected by RNAi expression. The expression level of CNB in the mutants remained low throughout development (fig. 3).

Cell lines with slight reduction of CNB expression displayed no or only mild phenotypic aberrations which were mainly manifest in the erection of fruiting bodies with somewhat shorter stalks than observed with wild type organisms (not shown). However, phenotypic alterations were much more prominent in cell lines with pronounced silencing of CNB. To characterize the phenotypic consequences of silencing of cnbA mRNA 10 independent transformants with drastically reduced expression of CNB were further analyzed. The phenotypes of all these transformants were very similar to cell line 01–5 which is described in more detail below.

We first compared expression of cnbA mRNA in cell line 01–5 and parental AX2 cells by Northern blotting. Figure 4 shows that the recombinant cell line had drastically reduced amounts of endogenous cnbA mRNA (0.7 kb). A strong signal corresponding to the size of the RNAi construct (1.2 kb) indicates massive expression of the transfected gene. Degradation of both RNAi and endogenous cnbA mRNA is indicated by the smear detected in the mRNA isolated from 01–5 cells.

The growth rate of mutant 01–5 in AX medium was very similar to that of wild type cells, with doubling times of about 9 hours. When these cells developed on non-nutrient agar aggregation was delayed by about 3 hours as compared to wild type cells. The mutant proceeded with normal kinetics through further development, however, 01–5 populations formed longer, leaner slugs than populations of wild type cells (not shown). After termination of development stalks were significantly (ca. 50%) shorter than wild type fruiting bodies (fig. 5). Comparison of mutant and wild type fruiting bodies did not indicate differences in the size of their spore heads. To analyze whether RNAi against cnbA indeed affected predominantly stalk size, we compared the numbers of fruiting bodies formed on SP agar in the wells of microtiter plates from 4 × 10⁵ cells and counted the numbers of spores which could germinate from the mature fruiting bodies. Mutant 01–5 formed 46 ± 20 fruiting bodies (n = 20). From the spores of the fruiting bodies 3.1 × 10³ ± 7 × 10² (n = 5) clones could re-grow on a lawn of bacteria. Wild type AX2 cells formed 61 ± 36 fruiting bodies (n = 20). From the spores of these fruiting bodies 3.1 × 10³ ± 10³ (n = 5) clones could re-grow on a lawn of bacteria.

In addition to the formation of short stalks, many of the culminants of cell line 01–5 showed one or more additional, irregularly arranged tips protruding from the rising spore heads (fig. 6). These ectopic tips were not observed earlier during development, e.g. on first finger or slug structures but only became visible during culmination. Some of these extra tips (c.f., fig. 6D, E, F, H) are reminiscent of the thicker part of stalks near their base. The tip acts as an organizer region, effectively inhibiting the formation of additional tips 17. Obviously, dominance of the tip in the RNAi mutant is much weaker than in wild type organisms.

Expression of the prestalk-specific gene ecmB has previously been shown to depend on an increase in Ca²⁺_i, making this gene a candidate for transcriptional regulation via CN. Analysis of ecmB expression in AX2 and 01–5 cells revealed a significant inhibition of ecmB induction during development in the RNAi mutant (fig. 7). In contrast to these findings the expression kinetics of the prestalk-specific marker ecmA and of the prespore-specific marker pspA were in 01–5 cells similar to wild type cells (data not shown).

To check whether short stalk formation and ectopic formation of extra tips are cell-autonomous or non-autonomous defects, wild type and cnbA-RNAi mutant cells were mixed in different ratios and allowed to develop. Stalk size decreased proportionally to increasing content of mutant cells (fig. 8A). This gradual decrease in stalk length suggests that formation of short stalks is a cell-autonomous defect. In contrast, ectopic formation of extra tips on the rising sorophores appears to be at least partially non-cell autonomous (fig. 8B). Only pure mutant populations formed extra tips at high frequencies. Even 10% wild type cells could effectively establish nearly normal tip dominance.

The examination of sections from fruiting bodies could give information about the origin and composition of the ectopic tips of the cnbA-RNAi mutant. Fig. 9 shows a longitudinal section through a wild type fruiting body (A) in comparison to a fruiting body from mutant 01–5 (B). Staining allows a clear discrimination between spore and stalk cells. The dark spore cells are small and condensed, stalk cells are expanded and, because they are highly vacuolated, nearly unstained. In the mutant spore head a channel-structure intruding from the periphery of the spore head can be seen which represents a second stalk arising from an ectopic tip. Since the stalk cells in the mutant seemed to be rounder than wild type stalk cells, electron microscopy examinations were performed. Stalk cells of wild type fruiting bodies (fig. 10A) were clearly larger than mutant stalk cells (fig. 10B). This appears due to incomplete vacuolization of the mutant stalk cells. Some of the mutant stalk cells seemed to be not vacuolated at all. In contrast, the size and form of the spore cells in the wild type and the mutant were closely similar.

D. discoideum AX2 cells were grown at 22°C in AX medium 30. Development was induced by washing cells twice with ice-cold Sørensen phosphate (SP) buffer [17 mM (KH₂/Na₂H)PO₄], pH 6.0 and spreading 2 × 10⁷ cells on HABP nitrocellulose filters (0.45 μm, diameter 47 mm, Millipore, Eschborn, Germany) supported by two paper filters (diameter 47 mm) soaked with buffer.

D. discoideum AX2 cells were grown in AX medium to a density of 5 × 10⁶ cells/ml, washed twice with ice-cold H-50 buffer, resuspended at 2 × 10⁷ cells/ml, and 100 μl of this suspension was electroporated with 10 μg of plasmid DNA 3132. Transformed cells were grown on suitable selective media and clonal populations were obtained by serial dilution in microtiter plates. In initial experiments we observed that the phenotypic aberrations which correlated with RNAi expression became gradually weaker upon serial passages of the cells. Therefore, immediately after isolation, clones of recombinant cells were grown to final numbers of approx. 1.5 × 10⁹ (ca. 31 to 32 generations) and allowed to form spores on SP agar plates which were harvested and kept in SP buffer at -70°C until used to inoculate experimental cultures. These underwent additional 13 to 15 generations.

cnbA cDNA was amplified by reverse transcription of total RNA from vegetative D. discoideum using the primer pair 5'GGGCCATGGGGAATCAACATTCATTATTA3' and 5'TTATTCTGACCAATTTACGCTAAG3'. The product was cloned into pDrive (Qiagen, Hilden, Germany) to obtain plasmid pBW104. Construction of the RNAi-encoding plasmid for cnbA was done in three steps. First, a fragment of 437 bp amplified with primers 5'CCGGATCCAAGCTTAAAGAACAATTAGAACAAATGA3' and 5'CCGTCGACTCACCTTCAATAATAGTTTTATCAACA3' was cloned in sense orientation into BamHI/SalI-digested pUC18 33, yielding pKB05. Second, pKB06 was generated by ligating a longer cnbA fragment of 538 bp, amplified with primers 5'CCCTGCAGAAAGAACAATTAGAACAAATGA3' and 5'CCGTCGACTTCTGACCAATTTACGCTAAGTTTT3', in reverse orientation into pKB05 after digestion with PstI and SalI. Finally the fused fragments were subcloned into PstI/BamHI-digested pDNeoII 34 to obtain pKB07 (see below, fig. 1).

Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany), chromatographed on 0.9% agarose gels containing 6.6% formaldehyde and blotted onto nylon membranes which were hybridized with DIG-labelled cDNA probes and stained with CSPstar as recommended by the manufacturer (all reagents from Roche Molecular Diagnostics, Mannheim, Germany).

Proteins were chromatographed on 15% polyacrylamide/0.1% SDS gels 35, transferred to nitrocellulose membranes and probed with 1:5000 diluted rabbit antiserum against recombinant D. discoideum calcineurin B as described 4.

AX2 wild type and mutant strain 01–5 were cultured in AX medium. Cells were washed twice in SP buffer and resuspended at 2 × 10⁷ cells/ml. The cells were mixed in different ratios and 2 × 10⁷ cells spread on HABP nitrocellulose filters. Filters were incubated in the dark at 22°C for 30 h.

Wild type and mutant strains were cultured in AX medium. Cells were washed twice in SP buffer and resuspended to 4 × 10⁶ cells/ml. 100 μl each were spread into individual wells of a 96 well microtiter plate filled with 200 μl SP agar each. Organisms were allowed to develop for 48 h, fruiting bodies were collected, resuspended in SP buffer and frozen at -70°C. After one day spores were spread on nutrient agar with Klebsiella planticola, incubated for three days at 22°C and the numbers of clones were counted.

Dictyostelium fruiting bodies developed on HABP filters were fixed for 3 days in a humid chamber with glutaraldehyde (2.5%) in 0.1 M Na/K phosphate buffer (pH 7.0), using both fixative solution (completely absorbed by the HABP filter) and the arising fixative vapour. The fruiting bodies were then embedded in 1.5% low melting agarose (LGT Agarose, Marine Colloids Inc., US) at 20°C. After hardening the agarose by cooling down to 0°C, blocks including fruiting bodies were prepared. The specimens were then fixed a second time for 2 h at RT with glutaraldehyde in 0.1 M Na/K phosphate buffer (pH 7.0) containing paraformaldehyde (2%) and tannic acid (0.2%). After washing 3 times with the same buffer for 20 min each a third fixation with osmium tetroxyde (1% in 50 mM Na/K phosphate buffer, pH 7.0) for 12 h at 20°C was performed, followed by repeated washing with the same buffer. The specimens were dehydrated in a graded series of ethanol. They were incubated in propylene oxide, followed by a mixture of propylene oxide/epoxide resin (v/v) and pure epoxide resin ERL 36. The resin was polymerized for 2 days at 60°C.

Preparations for light microscopy were made by cutting 1.0 μm sections using a Reichert-Jung Ultracut E ultramicrotome. The sections were fixed onto glass slides by heating for 10 min at 60°C. For histological analysis, sections were stained for 2 min at 60°C with a mixture of Azur II (1% in water) and methylene blue (1% in 1% tetraborate) as described 37, washed in deionised water and dried. Images were obtained with a Leitz Ortholux II microscope using bright field and photographed with a Nikon Digital Camera Cool PIX 990.

Ultrathin sections of ca. 50–80 nm were prepared and mounted on 400 mesh cupper grids. The samples were contrasted with 2% w/v uranyl acetate for 10 min and with 0.2% w/v lead citrate in 0.2 M NaOH for 2 min. Electron micrographs were obtained with a Zeiss EM 10 microscope using Scientia negative films. The negatives were scanned with an Epson 1680 Pro scanner at a resolution of 1200 dpi.