Mutations in members of the Sma/Mab TGFβ-like signaling pathway result in animals that are phenotypically smaller than wild-type. These Sma/Mab mutants are approximately 70% the size of their wild-type counterparts 89111214. Based on this small body size phenotype, we set out to isolate additional loci which when mutated resulted in small animals. From an F2 EMS screen of N2 wild-type animals, we identified kin-29(wk61) 15. kin-29(lf) animals are small, like known Sma/Mab pathway components (Table 1). However, unlike the known pathway components, kin-29 does not possess male tail ray fusions or crumpled spicules, suggesting that kin-29 is involved in regulation of body size morphogenesis but not male tail development.

kin-29 was mapped to linkage group X between unc-2 and fax-1. Appropriate YACs, cosmids, and DNA fragments were used to rescue the gene. The longest cDNA available, y293c7 (Y. Kohara, National Institute of Genetics), spanning this open reading frame was obtained. Based on the ORF sequenced from y293c7, a 10 kb region of genomic DNA containing kin-29 was fused in frame with GFP. This construct, kin-29p::kin-29 gfp, was then injected into kin-29 mutant animals and conferred rescue (Table 3).

We searched for molecular lesions in kin-29(wk61). Genomic DNA spanning the entire coding region of kin-29 was isolated from kin-29(wk61) animals, sequenced and compared to sequence obtained from EST y293c7. Sequence analysis reveals kin-29 to consist of 16 exons that encode a protein of 822 amino acids in length (Fig. 1). A mutation found in the eighth exon of kin-29(wk61) changes a single nucleotide from cytosine to thymine. This change results in a premature termination codon and a truncated protein of 273 amino acids. While this work was in progress, kin-29 was cloned as a modifier of olfactory gene expression 19. Two alleles from that study, kin-29(oy38) and kin-29(oy39), result from a 526 bp deletion, which is replaced by sequence found on LG X, and a missense mutation in the kinase domain, respectively 19.

kin-29 encodes a predicted serine-threonine kinase. Within its kinase domain, KIN-29 is homologous to members of the

E

m

k

m

a

r

k

In order to assess whether KIN-29 acts as a functional kinase, 293T cells were transfected with either C-terminal FLAG-tagged full length kin-29 or various constructs, which truncate the carboxy terminal region of the protein. As controls, both the kinase active and kinase inactive mammalian TGFβ type II RSK were also transfected. Lysates were immuniprecipitated with anti-Flag antibody and in vitro kinase assays performed. We observe that full length KIN-29 is capable of autophophorylation (Fig. 3). However, when we truncate the C-terminal domain, we find that the kinase domain, along with the ubiquitin-associated domain (UBA) or the kinase domain (with or without lysine 45 changed to arginine) are no longer capable of autophosphorylation. Lysine 45 is a conserved residue essential for catalytic function in kinases. This indicates that the C-terminal domain is required for autophosphorylation. The C-terminal domain could be required for kinase activity or it may simply be the substrate for autophosphorylation. Lanjuin and colleagues have previously shown that animals possessing a mutation (oy39) in the kinase domain have a small body size 19, indicating that the kinase domain is required for proper body size.

Epistasis between kin-29 and dbl-1 or lon-1 was examined in order to determine the relationship between kin-29 and Sma/Mab pathway signaling. Double mutant analysis between several of the known pathway components and lon-1 results in animals that are long (Lon) 1617, making it the most downstream gene in the pathway. We examined lon-1(wk50); kin-29(wk61) double mutants to determine whether kin-29 can be placed in a similar position in the pathway as the current Sma/Mab components. We find that double mutants are longer than the single mutants of kin-29(wk61), suggesting that lon-1 suppresses the Sma phenotype of kin-29 (Table 1).

Next, we examined the relationship between dbl-1 and kin-29. Over-expression of dbl-1 results in Lon animals, suggesting more ligand causes an increase in the TGFβ signal output. When dbl-1 over-expressing animals are crossed into sma-2, sma-3, sma-4, sma-6 or daf-4 mutant backgrounds, the Lon phenotype is suppressed 8 and the animals are Sma. This places the type I receptor and the Smads downstream of the ligand, dbl-1. When dbl-1 is over-expressed in a kin-29(wk61) background, the animals are also Sma (Table 2). Additionally, using a weak allele of sma-6, we generated a sma-6(e1482)unc4(e120); kin-29(wk61) double mutant and examined its body size. We find that these animals are similar in size to that observed for sma-6(e1482)unc4(e120) mutants alone suggesting that sma-6 and kin-29 may not function in parallel pathways (Table 2). This indicates that kin-29 behaves in a manner consistent with known Sma/Mab pathway signaling molecules and is likely to function within this signaling cascade.

Since lon-1 is genetically downstream of the Sma/Mab pathway signaling, we examined whether lon-1 mRNA levels are altered in kin-29 mutants. We have previously shown that lon-1 mRNA levels are up-regulated in sma-6(wk7) mutants and down-regulated in animals that over-express dbl-1 1617. To test whether lon-1 mRNA is regulated in kin-29 animals, we examined lon-1 mRNA levels in a kin-29(wk61) background (Fig. 4). kin-29(wk61) animals show an increase in the expression level of the lon-1 transcript. This increase is comparable to that previously observed in sma-6(wk7) mutant animals 16.

kin-29 has been shown to affect the expression of a subset of olfactory receptor genes 19. Several olfactory receptors expressed in AWB, ASH and ASK sensory neurons were either reduced or up-regulated in the kin-29 mutant background. Given that kin-29 affects mRNA levels of these olfactory receptors, we asked whether kin-29 alters the mRNA expression levels of the Sma/Mab components. We examined sma-6 mRNA expression (the type I receptor) in a kin-29 background and find no changes in expression levels of sma-6 mRNA. Because kin-29 and dbl-1 expression patterns overlap, we examined mRNA expression levels of dbl-1 in a kin-29 mutant background. We find that kin-29 does not affect dbl-1 mRNA expression levels (data not shown).

In efforts to elucidate the function of kin-29 in TGFβ signaling, we examined its expression pattern. A construct consisting of the kin-29 promoter and coding region fused in frame to gfp was injected into kin-29(wk61) animals. As described above, this construct was able to rescue the small body size phenotype of kin-29(wk61) to wild-type (Table 3). Upon examination of the expression pattern, we observe KIN-29 to be localized to various tissue types (Fig. 5). Most notably, KIN-29 is seen in several neuronal cells in the head and tail throughout the course of development. Several of the sensory neurons found in the head express KIN-29, including ASH, AFD and ASI 19. Additional neuronal staining is observed in both CAN cells and the ventral nerve cord (Fig. 5A). We find expression both in pharyngeal and body wall muscle (Fig. 5B). During the L1, L3 and L4 stages, we see expression throughout the intestine both in the nuclei and to a lesser extent in the cytoplasm (Fig. 5C) and in cells in the tail (Fig. 5D). This intestinal expression is rarely seen in later stages of development. Occasionally, expression is seen in vulval muscles as well.

In order to determine where kin-29 activity is required, we examined the body size of kin-29(lf) animals transformed with constructs expressing kin-29 in specific tissues. elt-3 and rol-6 promoters drive expression in the hypodermis, while dbl-1 drives expression in a subset of neurons. All three promoters were fused to kin-29 genomic DNA sequences. Each of these constructs was injected into kin-29(wk61) animals and transgenic strains were analyzed for body size. Several of the Sma/Mab pathway components, sma-3, sma-6, and lon-1, when specifically expressed in hypodermal tissues, rescue the body size defects associated with loss-of-function mutations in each of these genes 16171826. Using the rol-6 and elt-3 promoters to drive hypodermal expression of the genomic region of kin-29 results in rescue of the small body size phenotype of kin-29(wk61). Since KIN-29 expression overlaps that of the Sma/Mab pathway ligand DBL-1 in the amphid neurons, ventral nerve cord, CAN cells and body wall muscle, we reasoned that KIN-29 and DBL-1 may function together in the same tissues to regulate body size morphogenesis 89. We find that kin-29 under the control of the dbl-1 promoter rescues the small body size phenotype of kin-29(wk61) animals (Table 3). These data suggest that KIN-29 functions in neuronal and hypodermal tissues to regulate body size morphogenesis (Table 3 and data not shown).

The growth properties of Sma/Mab animals differ from other small animals. For example, mutants of the spectrin gene, sma-1, which have been shown to affect embryonic elongation but not thought to be involved in TGFβ signaling, are approximately 50% the size of wild-type animals at hatching 27. This is in contrast to the body size of L1 animals mutant in known Sma/Mab pathway components. For example, sma-3, sma-6, dbl-1, and lon-1 are indistinguishable in length from wild-type L1 animals at hatching 26. This suggests that the Sma/Mab pathway components are defective in post-embryonic rather than embryonic stages of development. Sma/Mab pathway mutant animals grow at a slower rate as development progresses through the later larval stages into adulthood 26. There is no defining switch during development that regulates body growth. We tested whether kin-29 mutations cause body size defects in a similar manner to Sma/Mab pathway mutations or whether kin-29 possessed embryonic defects. We examined the body size of kin-29 mutant animals in comparison to sma-6(wk7) and N2 animals at hatching and then at 24 hour intervals to 96 hours. We find that all three alleles of kin-29 are similar in length at the L1 stage to N2 animals. This is also what we observe for sma-6(wk7) which suggests that kin-29 delays growth post-embryonically, as do Sma/Mab pathway components (Fig. 6). The Sma body size of kin-29 is therefore due to a delay in development in later larval stages.

In addition, we find that kin-29 grows more slowly than N2 and Sma/Mab pathway mutants do. Animals hatched and grown at 20°C were scored based on their developmental stage after 72 hours. We find that 99% of wild-type animals are adults at this time point, while only 2% of kin-29(wk61) animals are adults (Table 4). Lanjuin and colleagues report a similar observation; 98% of wild-type animals hatched and grown at 25°C for 3 days were adults in comparison to approximately 24% of kin-29(oy38) animals 19. We asked if lon-1(lf) could suppress the developmental delay characteristic of kin-29(wk61) animals (Table 4). lon-1(wk50) mutants on their own show a slight delay in development, but which is distinguishable from the Sma/Mab mutants. In the double mutant lon-1(wk50);kin-29(wk61), we find that the developmental defect of kin-29(wk61) can be partially suppressed by lon-1(wk50). This result is consistent with our conclusion that lon-1 is genetically downstream of kin-29.

We observed that Sma/Mab pathway mutants have a reduced brood size. In addition to the developmental defects, kin-29(wk61) also has a reduced brood size (Table 5). Like sma-6(lf) and lon-1(lf), kin-29(wk61) shows a brood size approximately 30% the size of that seen in wild-type animals. We find that sma-6(wk7) and lon-1(wk50) along with kin-29(oy38) and kin-29(oy39) have a reduction in brood size as well. Although brood size is affected, embryonic survival rate appears to be normal.

Several components of the Sma/Mab pathway have been shown to genetically interact with members of the dauer pathway 914. The dauer-constitutive (Daf-c) phenotype of the type I receptor daf-1 is enhanced by mutations in sma-6. At 15°C, daf-1 mutant strains exhibit a very weak dauer-constitutive phenotype. However, sma-6(wk7); daf-1(m40) mutants show a 50% increase in the number of dauered animals at 15°C 14. In addition, double mutants between the ligand daf-7(e1372) and either dbl-1(kk3) or sma-2(e502) also have been shown to enhance the weak Daf-c phenotype of daf-7(e1372) at 20°C 9. These data suggest that there is some crosstalk between the Sma/Mab pathway and the TGFβ-like daf-7 dauer pathway.

Based on these findings, we examined the effects of the kin-29 alleles on dauer formation. Double homozygotes were made between daf-7(e1372) and each of the three alleles of kin-29. Genetic interactions were analyzed at 15°C, 20°C and 25°C. For comparison, daf-7(e1372) mutants raised at 25°C show almost 100% dauered animals compared to no dauered animals at 15°C or 20°C. At 15°C and 20°C, kin-29(oy38) is able to enhance dauer formation of daf-7(e1372) similar to the enhancement observed in sma-6(wk7); daf-7(e1372) mutant animals (Fig. 7A,B). We also see that kin-29(wk61) shows a weak enhancement of dauer formation while the missense mutant kin-29(oy39) shows no genetic interaction at all. These results are consistent with genetic interactions previously observed between Sma/Mab and dauer pathway components. However, at 25°C, we find that kin-29 can also suppress the constitutive dauer formation of daf-7(e1372). kin-29(wk61) and kin-29(oy39) are able to suppress the Daf-c defects of daf-7(e1372) while kin-29(oy38) does not (Fig. 7C).

Expression of the Sma/Mab pathway components in the hypodermis is sufficient to rescue the body size defects seen in mutants. Specific expression of sma-3, sma-6 and lon-1 in the hypodermal tissues has been shown to restore body length in these respective mutant animals 16171826. This implies that body size is regulated largely via hypodermal function. Our work presented here further supports that C. elegans body size is regulated in hypodermal tissues. When the genomic region of kin-29 is specifically expressed in the hypodermis, under the control of the elt-3 and rol-6 promoters, we see that the small body size phenotype of kin-29(wk61) is partially rescued. Although KIN-29 functions in the hypodermis to regulate body size morphogenesis, we do not see KIN-29::GFP, under the control of its own promoter, expressed in the hypodermal tissues, suggesting that KIN-29 expression levels are relatively low in these tissues.

DBL-1 is expressed primarily in neurons, which includes several amphid and pharyngeal neurons, ventral nerve cord, and CAN cells 817. Since KIN-29 expression closely parallels that seen for DBL-1, we also examined whether the dbl-1 promoter driving kin-29 genomic sequences is capable of rescuing the body size defect of kin-29(wk61). When kin-29 is expressed in the same tissues as dbl-1, we observe partial rescue of the small body size defect seen in kin-29(lf) animals. It has been demonstrated that kin-29 under the control of the unc-14 and odr-4 promoters is able to rescue the body size defect of kin-29 mutant animals 19. unc-14 is expressed in all neuronal cells while odr-4 is expressed in a subset of the sensory neurons including the AFD neurons where DBL-1 and KIN-29 are also expressed 2829. This suggests that neuronal expression of KIN-29 is also sufficient to regulate body size morphogenesis. Determining how this occurs will require further study.

Mutations in the ligand dbl-1, the receptors sma-6 and daf-4, and Smads sma-2, sma-3 and sma-4, result in animals that are approximately 70% the size of wild-type animals 89111214. Additional defects are seen as male tail ray fusions and crumpled spicules. However, the negatively regulated Sma/Mab target gene lon-1, suppresses the small body size phenotype of sma-2, sma-3, sma-4 and sma-6 but not the male tail defects observed in each of these loss-of-function mutants 1617. This implies that Sma/Mab pathway signaling may branch downstream of the Smads to regulate a subset of genes that control body size morphogenesis while others specifically affect male tail development. We find that kin-29(lf) animals do not posses ray fusions or crumpled spicules and may exert its effects upstream of this branch point in the signaling pathway. In addition, we see that lon-1 is genetically downstream of kin-29 and that kin-29 suppresses the Lon phenotype associated with over expression of dbl-1. Taken together, this data suggests that kin-29 may function in tissues with Sma/Mab pathway components to regulate body size but not male tail formation.

Members of the EMK family have been shown to affect cell polarity and microtubule stability. Mammalian MARK phosphorylates microtubule associated proteins and has been shown to destabilize microtubules when over expressed in CHO cells 23. Drosophila PAR-1 influences the cytoskeletal organization of the oocyte 21. In wild-type Drosophila oocytes, the microtubules are arranged in an anterior to posterior gradient with no microtubules observed at the most posterior region of the oocyte. Microtubules in Drosophila par-1 mutants, however, are organized around the cortex of the oocyte. In this reorganization, microtubules are now observed in the most posterior region of the oocyte. In addition, posterior localization of Drosophila oskar is dependent on microtubule polarity. oskar is mislocalized in dpar-1 mutants, further supporting the involvement of dpar-1 in regulating microtubule dynamics. C. elegans PAR-1 regulates the early asymmetrical cell divisions of the embryo but has not been shown to have any affects on the microtubule network 20. KIN-29 only shows homology to the EMK family members within its N-terminal kinase domain, indicating that KIN-29 is a more distantly related member of the EMK family. However, lack of homology between the C-termini of KIN-29 and EMK family proteins suggests that KIN-29 activity may diverge from that observed for members of this family.

We have observed that KIN-29 functions in both neuronal and hypodermal tissues. How kin-29 functions in each of these tissues to regulate body size morphogenesis is unclear. Since kin-29 encodes a kinase it might act to regulate the activities of a variety of molecules that affect Sma/Mab pathway signaling. Recently, it has been shown that several olfactory receptors are misexpressed in kin-29(lf) animals, suggesting that KIN-29 may regulate proper expression levels of various genes 19. One model is that KIN-29 phosphorylates a transcription factor and/or co-factor, which leads to the transcriptional mis-regulation of some component important for Sma/Mab pathway signaling. We have examined the expression levels of the Sma/Mab ligand dbl-1 and the type I RSK sma-6 and do not see any alteration in their levels of expression. However, this does not rule out that other genes that impinge on pathway signaling might be affected at the transcriptional level in neurons and hypodermal cells. Alternatively, KIN-29 may function in microtubule dynamics as described above 2123. kin-29 might therefore influence microtubule (MT) organization in both neuronal and hypodermal tissues and affect Sma/Mab pathway signaling in each of these cell types.

We have shown that KIN-29 helps to promote dauer formation at 25°C and to suppress dauer formation at 15°C. ttx-3, a LIM homeobox gene, shows a similar genetic interaction with daf-7 30. Like kin-29, ttx-3 single mutants do not affect dauer formation. daf-7(e1372); ttx-3(ks5) double mutant animals show an enhanced Daf-c phenotype of daf-7 at 15°C while suppressing it at 25°C. In wild-type animals, high temperatures contribute to dauer formation, while lower temperatures suppress dauer formation. ttx-3 decouples both hot and cold inputs from the dauer pathway, and kin-29 may act similarly 30. tph-1, a tryptophan hydroxylase involved in the synthesis of serotonin, has been shown to form 10–15 % dauers in the presence of food and this defect is not dependent on temperature which implicates serotonergic signaling in modulating temperature sensitive dauer arrest 31. tph-1 is also able to enhance the constitutive dauer phenotype of daf-7 mutants at 15°C similar to the enhancement observed for kin-29 31. Sze and colleagues did not examine the affects of tph-1 mutants on daf-7 at 25°C. They did show, however, that over-expression of tph-1 in a daf-7 background at 25°C suppresses the Daf-c phenotype of daf-7. This is opposite to what we observe for kin-29. Although there are some similarities between tph-1 and kin-29, tph-1(mg280); kin-29(oy38) double mutants are synthetic-daf at 20°C and 25°C suggesting that kin-29 may not function in a linear pathway with tph-1 but rather parallel to tph-1 19. tph-1 has also been shown to regulate the expression of daf-7 while kin-29 does not, suggesting that kin-29 functions downstream or in parallel to daf-7 production to affect TGFβ signaling outputs 1931. kin-29 may partly influence dauer formation through a serotonin mediated pathway and a non-serotonin mediated pathway such as the Sma/Mab pathway. The Sma/Mab pathway has been shown to influence dauer formation in combination with the TGFβ-like daf-7 pathway 914.

Starved animals are smaller than animals grown with abundant food supplies, indicating that environmental conditions influence body size morphogenesis 13. Drosophila S6 kinase mutants are smaller in body size due to decreased cell size, which is similar to the body size defect observed in nutrient deprived flies 3233. It is thought that S6 kinase alters cell growth in response to nutrients and growth factors by regulating the efficiency of the translational apparatus 34. Recently, it has been shown that a deletion found within the C. elegans homolog of S6 kinase (sv31) also results in a reduced body size in the adult stage (J. Friberg and S, Tuck, personal communication). S6 kinase (sv31) and kin-29(lf) animals also show other similar phenotypes, including reduced brood size and slow growth defects. In addition, fat accumulation is also observed in S6 kinase (sv31) animals similar to that observed in dauered animals. Previously, it has been demonstrated that animals that show pheromone hypersensitivity are unable to sense food or temperature signals properly 3536373839. Recently, kin-29 mutants have been shown to be hypersensitive to pheromone 19. In addition, kin-29 mutants also possess hyperforaging activity in the presence of abundant food supplies 19. Hyperforaging is normally observed in animals that have been deprived of food. These defects suggest that kin-29(lf) mutant animals may not sense food or temperature signals properly and this may influence body size regulation. Taken together, this evidence supports an environmental role in regulation of body size. kin-29 may function to transmit these environmental cues to the Sma/Mab TGFβ signaling pathway, thereby affecting proper body size morphogenesis.

C. elegans strains were grown using standard methods 40. kin-29(wk61) was used for body size rescue experiments. N2, sma-6(wk7), kin-29(wk61), kin-29(oy38) and kin-29(oy39) were used in generating growth curves 19. Interactions between kin-29 and the dauer pathway were examined using daf-7(e1372). Total RNA used for northern blot analysis was isolated from N2, sma-6(wk7), sma-3(wk30), and kin-29(wk61) animals. Epistasis was determined using kin-29(wk61), lon-1(wk50), dbl-1 over expressing strain ctIs40 [pTG96 (sur-5::gfp)], and lon-1(wk50); kin-29(wk61) mutant animals.

kin-29(wk61) was generated from an EMS F2 screen designed to isolate small body size mutants 15. kin-29(oy38) and kin-29(oy39) were obtained from P. Sengupta 19.

kin-29(wk61) was mapped to a small region on the X chromosome between unc-2 and fax-1 using genetic markers and deficiencies. The YAC clone Y76F7 from this interval was purified from total yeast DNA using pulse field gel electrophoresis. Injection of YAC Y76F7 into kin-29(wk61) rescued the small body size phenotype. Next DNA from cosmids contained within the region of Y76F7 was isolated and transgenic lines were generated. Cosmid F58H12, with one predicted open reading frame (ORF), conferred rescue. ESTs spanning this region were obtained from the C. elegans cDNA project (Y. Kohara, National Institute of Genetics). The longest EST, y293c7, was sequenced and shows minor differences from the Genefinder prediction. A 10 kb genomic region fused in frame to GFP, which contained the corresponding sequence from y293c7, was generated by PCR as described below. This kin-29p::kin-29:gfp fusion construct rescued the small body size of kin-29(wk61). Genomic DNA from homozygous kin-29(wk61) animals was sequenced. Two independent PCR amplifications were generated for each of the three regions spanning the kin-29 coding region using the following primer sets: CGCTGCGGCCGCTTCAGGCGCCGCCACACCAA/ CGCCGCTGCAGCCGCCGGCAACGAGAATGTA; CGCTGCGGCCGCCCAAGCCAACGTTGCAGGTA/ CGCCGCTGCAGGATAACATGCTCCACTGGCTA; CGCTGCGGCCGCCACCGCACGGGCTAGATATT/ CGCCGCTGCAGCCATTCACTCCGAGCTCCAG. Each PCR product was digested with Not I and Pst I, subcloned into pBluescript SK+, and sequenced.

kin-29p::kin-29 gfp contains the 10 kb genomic region of kin-29 fused in frame to gfp. This construct was generated using the primers CGCGCTGCAGCAGACCATGGACGT GTTTTAATG and CCGGGGATCCTCCGAGCTCCAGCTTGGATCA, digesting with Pst I and BamH I, and inserting the PCR product into the promoterless vector pPD95.75. kin-29p::gfp was generated by cloning 1.4 kb upstream of the predicted kin-29 ATG into the Hind III and Xba I sites of the GFP insertion vector pPD95.69 (A. Fire, Stanford University). The 1.4 kb piece was generated by PCR using primers CCGGAAGCTTCAGACCATGGACGTGTTTTAATG and CGCGTCTAGATGCAGTGTTGGTGTGGCGGC. Fluorescent GFP expression patterns were examined in larval and adult animals using a Zeiss compound microscope.

kin-29 genomic DNA was ectopically expressed in specific tissues using the promoters rol-6, elt-3 and dbl-1 84142. The rol-6 and elt-3 promoters express in the hypodermis, while the dbl-1 promoter expresses primarily in neuronal tissues. PCR fragments containing the elt-3, rol-6 and dbl-1 promoters were generated using the primer sets CCGGAAGCTTGTGACACGTTGTTTCACGGTCAT/ CCGGCTGCAGGAAGTTTGAAATACCAGGTAGCCGA, CCGGCTGCAGCTTCGTATTAGATCTCAGCAGC/ CGCGCGTCGACAGTTAGATCTAAAGATATATCCAG, and CCGGCTGCAGCCCGGAAATCACGACCAAATGGGTC/ CGCGCGTCGACAGTTGAGTTGGGCGCATCAGGCAG respectively. elt-3 PCR products were digested with Hind III and Pst I while rol-6 and dbl-1 products were digested with Pst I and Sal I. 7.7 kb PCR fragments comprising kin-29 genomic DNA were generated using the primer sets CCCGGGTCGACATGGCTGCGCCACGGCGGCGTAT/CCGGGGATCCTC CGAGCTCCAGCTTGGATCA and CGCGCTGCAGCAGACCATGGACGTGTT TTAATG/ CCGGGGATCCTCCGAGCTCCAGCTTGGATCA and digested with either Sal I and Bam HI or Pst I and Bam HI respectively. Fragments were inserted in frame into the promoterless gfp insertion vector pPD95.75. All constructs were injected into kin-29(wk61) and transformants were analyzed for body size rescue.

For body size measurements, animals were photographed 48 hours after the L4 stage using a Nikon SMZ-U dissecting microscope set at 3.5× magnification and software from Strata Video Shop (Strata Inc.). Screen dimensions were 680 X 460 pixels. Perimeter analysis was done using Image Pro Plus (Mediacybernetics).

For brood size analyses, single L4 animals were picked to individual plates. Every 12 hours, animals were transferred to new plates to continue egg laying. All eggs were counted. 24 hours later, hatchlings were scored.

For growth rate analyses, animals were synchronized. Gravid animals were treated with a hypochlorite/NaOH solution in order to isolate eggs. The eggs were allowed to hatch in M9 for at least 24 hours. Approximately 30 L1 animals were placed onto plates seeded with OP50. Animals were initially measured at the L1 stage (time zero) and then at 24 hour intervals thereafter. The final time point was taken 96 hours after the L1 stage. Images were obtained and perimeter analyses were performed as described above.

Double mutants were generated between daf-7(e1372) and the following mutants: sma-6(wk7), kin-29(wk61), kin-29(oy38), and kin-29(oy39). Gravid animals were placed onto plates well seeded with OP50 and allowed to lay eggs at room temperature. Animals were removed from plates after approximately 30 – 50 eggs were laid. Eggs were allowed to hatch at 15°C, 20°C and 25°C. The number of dauered animals was counted and graphed.

Total RNA from L4 animals was isolated from N2, sma-6(wk7), sma-3(wk30) and kin-29(wk61) as described previously (previously described in 16. Equal amounts (20–30 μg) of total RNA were loaded per lane onto a 1.2% agarose/6.6% formaldehyde gel and resolved by electrophoresis. Samples were transferred to nitrocellulose (Osmonics Inc.) and baked at 80°C for 2 hours. The lon-1 and dbl-1 probes were generated by digesting both the lon-1 cDNA B1.11 and the dbl-1 cDNA with Eco RI. The sma-6 probe was generated by PCR using the primer set: GCCGCCTCGAGATGAACATCACCTTTATATTTATTCTC/ GCCGCGGATCCTTAAGATTGATTGGTGGCTGAC. Elongation factor-2 and α-tubulin were used as controls to indicate the amount of total RNA loaded per lane. Before probes were added, the nitrocellulose blots were prehybridized with 1 mM EDTA, 0.5 M NaPO4, pH7.2, 7% SDS, and 1% BSA fraction V (Sigma) for at least 30 minutes. Probes were labeled using the Prime It II kit (Stratagene), added to the prehybridization solution, and incubated overnight at 65°C. Blots were washed (1 mM Na₂EDTA, 40 mM NaPO₄, pH 7.2, and 1% SDS) at least three times at 65°C for 15 minutes. Each blot was placed onto a phosphorimager screen for at least 48 hours and analyzed using a Molecular Dynamics Phosphorimager (Amersham Pharmacia Biotech) and IQMacv1.2 software. For each band, intensity levels were corrected for background and normalized according to the loading control (eft-2 mRNA). Relative transcript levels of the mutants were normalized to the intensity ratio of lon-1/eft-2 of N2.

C-terminally tagged Flag kin-29 constructs were generated in the mammalian vector pRK5. KIN-29-KU contains amino acids 1–354 which includes the kinase domain and UBA domain. KIN-29K contains amino acids 1–300 which includes only the kinase domain and KIN-29K(K45R) contains amino acids 1–300 with a point mutation at position 45 that changes a lysine to an arginine. Cell transfection, immunoprecipitation and kinase assays were carried out as previously described 41. Human 293T cells at 30% confluency were transfected with each construct (2 μg in 100 mm plates) using LipofectAMINE (Life Technologies, Inc.). Forty eight h after transfection, cells were lysed in the lysis buffer (25 mM Tris-HCl, 300 mM NaCl, and 1% Triton X-100). Lysates were immunoprecipitated using anti-Flag antibody M2 (Sigma), washed 3 times in the same buffer and a final wash in the kinase buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl₂, and 5 mM CaCl₂). For in vitro kinase assays, the immunoprecipitated protein samples were divided into two aliquots. One aliquot was analyzed by anti-Flag western blotting. The second aliquot was subjected to a kinase autophosphorylation assay at room temperature for 30 min in the kinase buffer containing 5 μCi of ³²P-ATP (5000 μCi/mmol). The reaction was terminated by adding an equal volume of 2 × SDS sample buffer (80 mM Tris, pH 6.8, 3.2% SDS, 16% glycerol, 200 mM dithiothreitol, 0.02% bromphenol blue), then subjected to SDS-PAGE and visualized by autoradiography.