We noted that 6 binding sites for Tcf/Lef transcription factors are conserved between mouse and pufferfish in the FOXP2 genomic region, which is more than for any other putative Tcf/Lef target gene (Table S6 of 25. This finding, and our prior observations that foxP2 and lef1 are expressed in the tectum and hindbrain during CNS embryogenesis 727, raised the possibility that lef1 might regulate foxP2 expression. We performed in situ labeling for foxP2 and lef1 to investigate whether they shared temporal and/or spatial domains of expression. We found that lef1 is expressed in the mid-hindbrain boundary (MHB) starting at 24 hpf, and in the tectum starting at 30 hpf (Figure 1A–C). foxP2 expression in the MHB and tectum becomes apparent at 36 hpf (Figure 1D–F). Other domains of lef1 and foxP2 expression, including the telencephalon, hypothalamus, and dorsal diencephalon, had non-overlapping expression. To confirm that foxP2 and lef1 are indeed co-expressed in the same cells, rather than in distinct subsets of cells in the same region, we performed double in situs, and found that foxP2 and lef1 are co-expressed in tectal cells at 36 hpf (Figure 2A–D). This sequentially overlapping pattern of expression in the MHB, and contemporaneous overlap in the tectum, confirmed that lef1 was present in a relevant pattern to potentially direct foxP2 expression.

Based on this overlap of expression, we hypothesized that lef1 might regulate foxP2. To test this, we used several approaches. First, we used a morpholino to knockdown lef1 27, and evaluated foxP2 in situ expression. Knockdown of lef1 causes a near-complete loss of foxP2 expression in the tectum, MHB, and hindbrain at 36 hpf (Figure 3A, B) in 85% of injected embryos (n = 61), compared with 0% of uninjected embryos (n = 53). This effect is specific to lef1, since a morpholino against a different Lef/Tcf family member, tcf3b 28, which is also expressed in the tectum and hindbrain 28, showed no effect on foxP2 expression (n = 48, data not shown). The loss of foxP2 expression in the hindbrain, where lef1 expression is not detectable by in situ (Figure 1A–C), is presumably an indirect effect, perhaps via loss of an inductive signal from the MHB. Alternatively, this could be a direct effect, for example, if lef1 is expressed at very low levels in the hindbrain, or if some lef1-positive neurons migrate from the MHB to the hindbrain.

To confirm that loss of foxP2 expression was due to knockdown of lef1 and not a non-specific morpholino effect, we utilized two alternative means to remove lef1 expression. First, we examined expression of foxP2 in Df(LG01)^x8 mutant embryos. Df(LG01)^x8 is a deletion on chromosome 1 which contains lef1 (but not foxP2); homozygous deficiency mutants do not express lef1 2729. We found that homozygous Df(LG01)^x8 mutants do not express foxP2 in the tectum, MHB, or hindbrain (Figure 3C) (100%, n = 25 embryos).

Second, we examined whether a dominant negative construct which inhibits lef1 function would cause a loss of foxP2 expression. We used embryos carrying the transgene hsp70l:Δtcf-GFP, which expresses an N-terminal deletion of Tcf3a fused to GFP. In the absence of its N-terminal DNA-binding domain, Tcf3a acts as a dominant repressor of Wnt-mediated transcription 30. Following heat-shock at 32 hpf for 1 hour, embryos were collected 3 hours post-heat shock. There was loss of foxP2 expression in the tectum, MHB, and hindbrain (Figure 3D) in 61% of transgenic embryos (n = 38), and in 0% of non-transgenic siblings (n = 82). Decrease of foxP2 telencephalic expression is presumably due to a dominant effect of the transgene, since the decrease was not seen using the morpholino or Df(LG01)^x8.

The loss of foxP2 expression in the tectum and hindbrain is not secondary to an absence of cells, as expression of the tectal marker mbx 31 is indistinguishable between wild type and lef1 morphants (Figure 3E, F). Other markers for the tectum (emx2), and hindbrain (isl1, zash1a) of lef1 morphants also appear as wild type patterns and levels 27; J.E.L. and R.I.D., unpublished data). Furthermore, the loss of foxP2 expression persists at 48 hpf (Additional File 1). These results show that loss of lef1 specifically causes loss of foxP2 expression in the tectum, MHB, and hindbrain.

6 potential conserved binding sites for lef/tcf family transcription factors were identified in the FOXP2 genomic locus of mouse and pufferfish using in silico analysis 25. This algorithm (enhancer element locator) aligns transcription factor sequence sites from orthologous genomic regions between two species, with scoring of the sites determined by conservation, affinity, and clustering of sites. Based on conserved synteny between zebrafish, mouse, and pufferfish, we initially were able to identify 5 of these sites in the zebrafish foxP2 genomic locus using Sanger Centre genome assembly Zv6 (see Methods; Figure 4A).

Because the foxP2 genomic assembly is incomplete in the region upstream of the 2^nd coding exon (J.L.B., unpublished data), we sought to identify the sixth predicted lef1 binding site. In human FOXP2 this site is 8.8 kb upstream of the first coding exon. We obtained the sequence for this region in zebrafish from the unassembled BAC DKEY-116L11. Using the enhancer element locator algorithm 25, we compared the 9 kb regions immediately upstream of the first coding exon of foxP2 from the human and zebrafish genomes. We found conservation of this same element (zebrafish: ttgtgggctGCTTTCATCtgtgggttaa; human: atgatcagtGCTTTCATCtttattttaa) located 8.5 kb upstream of the first coding exon in zebrafish (contained within foxP2-enhancerA).

To identify foxP2 enhancers, and to determine whether any of the potential lef1 sites might function in vivo in the context of enhancer elements, we cloned genomic fragments containing the sites into a Tol2 transposon-based vector (Figure 4B) 323334. To visualize expression controlled by the potential enhancers, each DNA fragment was cloned immediately upstream of GFP under control of a minimal promoter 32. In total we cloned nine genomic DNA fragments (Figure 4A), from five different regions, containing the six predicted lef1 sites (two sites are contained in foxP2-fragmentC). To test for expression, we injected one cell stage embryos and assayed GFP expression from 12 hpf through 96 hpf (Figure 4C). Subsequent analysis used stable transgenic lines, which mostly reproduced the same patterns of expression. Three of the regions, foxP2-enhancerA, B, and D, drove GFP expression in patterns partially recapitulating foxP2 expression (Figure 5). Potential enhancers foxP2-fragmentC and foxP2-fragmentE had no expression.

foxP2-enhancerA drove expression in the eye, diencephalon, tectum, hindbrain, and telencephalon (Figure 5A, B). GFP expression was first noted in the telencephalon at 24 hpf, then at 48 hpf in the eye, tectum and hindbrain, becoming maximal at 72 hpf. By 80 hpf expression in the CNS diminished significantly, while jaw expression became visible. Subcloning of foxP2-enhancerA to yield enhancerA.1 and A.2 revealed very similar patterns to foxP2-enhancerA (Figure 5C–F). However, enhancerA.2 had significantly fewer labeled cells, suggesting that the more proximal region of enhancerA and enhancerA.1 contains necessary elements. foxP2-enhancerB expression in the telencephalon began at 24 hpf, with eye and hindbrain expression apparent by 72 hpf (Figure 5G, H). foxP2-enhancerD expression in the eye, dorsal diencephalon, and tectum began at 36 hpf, was maximal at 48 hpf, and decreased by 72 hpf (Figure 5I, J).

The enhancers we have identified partially mirror endogenous foxP2 expression 7. While the enhancer fragments were chosen based on in silico prediction of potential lef1 binding sites 25, our analysis shows the importance of in vivo validation, since only 3 of the 6 predicted binding sites appear to lie in functional enhancer elements for the stages analyzed.

Based on our observations that foxP2-enhancers A.1, B, and D show expression in a pattern mirroring lef1 expression in the tectum and hindbrain, and contained putative binding sites for Lef1, we tested whether knockdown of lef1 led to loss of GFP expression. We injected lef1 morpholino into stable transgenic foxP2 enhancer lines (Tg(foxP2-enhancerA.1:EGFP)^zc44, Tg(foxP2-enhancerB:EGFP)^zc41, Tg(foxP2-enhancerD:EGFP)^zc47), and looked for GFP expression in the tectum and hindbrain at 36 hpf. To detect enhancer-driven transcription with maximum sensitivity, we used an in situ probe for gfp. Morphants showed a loss of GFP expression in the tectum and hindbrain, but maintenance of telencephalic expression, in 89% of enhancerA.1 embryos (n = 71), 100% of enhancerB embryos (n = 22), and 100% of enhancerD embryos (n = 27) (Figure 6A–F). In contrast, in uninjected embryos only 2%, 0%, and 0% (n = 58, 15, and 16), respectively, showed loss of tectum and hindbrain expression. Further, the lef1-mediated loss of expression from the enhancers was visible at 52 hpf by visualization of GFP (Additional File 2).

To demonstrate that loss of GFP expression in the lef1 morphants was not simply due to absence of the GFP-expressing cells, we injected lef1 morpholino into transgenic fish lines Tg(elavl3:EGFP)^zf8 (also known as HuC:GFP) and Tg(pax2a:GFP)^e1. Tg(elavl3:EGFP)^zf8 expresses GFP in all post-mitotic neurons 35, while Tg(pax2a:GFP)^e1 expresses GFP in a pattern mirroring pax2a expression, including in the MHB, cerebellum, and hindbrain 36. In both lines we found that lef1 morphants still expressed GFP in the tectum, MHB, and hindbrain (Figure 6G, H, and Additional File 2). In addition, using Tg(isl3:GFP)^zc7 to label retinal axons (A. Pittman and C.B.C., unpublished), we observed that the pattern of retinotectal projections appeared normal in 48 hpf morphants (data not shown). Although overall numbers of GFP-expressing cells appeared reduced in lef1 morphants of Tg(elavl3:EGFP)^zf8 and Tg(pax2a:GFP)^e1, in the foxP2 enhancer lines there was a complete lack of GFP-expressing cells in the tectum and hindbrain. These results show that loss of tectal and hindbrain expression observed with the lef1 morpholino in foxP2-enhancerA.1, foxP2-enhancerB, and foxP2-enhancerD is not simply due to a loss of neurons, but instead indicates a requirement for lef1 in these enhancers' function.

To test whether Lef1 can bind to foxP2-enhancerA.1 and foxP2-enhancerB to regulate foxP2 expression, we performed chromatin immunoprecipitation (ChIP) using a polyclonal antibody against zebrafish Lef1 27. We designed PCR amplicons to test different regions of foxP2-enhancerA.1 and foxP2-enhancerB (Figure 7A), using chromatin extracted from 30 hpf embryos. For foxP2-enhancerA.1, we found that PCR amplicon FP2700 (centered around base pair 2700 in the enhancerA.1 DNA fragment) showed significant enrichment compared to controls (no antibody, and extracts from homozygous Df(LG01)^x8 embryos) (Figure 7B). Interestingly, amplicon FP300, encompassing the predicted Lef1 binding site in foxP2-enhancerA.1 (Figure 7A), showed minimal enrichment (Figure 7B). Further, a deletion construct of foxP2-enhancerA:GFP, removing the region containing FP300, did not cause loss of GFP expression (data not shown). This suggests that maximal Lef1 binding for foxP2-enhancerA.1 is centered around FP2700. For foxP2-enhancerB, we found that FPb2600 had significant enrichment compared to controls (Figure 7C). This PCR amplicon contains a predicted Lef1 binding site 25 (Figure 7A). We therefore conclude that Lef1 directly interacts with regulatory regions of foxP2 in 30 hpf zebrafish embryos.

Adult fish were bred according to standard methods. Embryos were raised at 28.5°C in E3 embryo medium with 0.003% phenylthiourea to inhibit pigment formation and staged by time and morphology 46. For in situ staining, embryos were fixed in 4% paraformaldehyde (PFA) (in PBS) for 3 h at room temperature (RT) or overnight (O/N) at 4°C, washed briefly in PBS, dehydrated, and stored in 100% MeOH at -20°C until use.

Transgenic fish lines and alleles used were as follows: Df(LG01)^x8 29; Tg(hsp70l:Δtcf-GFP)^w26 30; Tg(foxP2-enhancerA:EGFP)^zc42; Tg(foxP2-enhancerA.1:EGFP)^zc44; Tg(foxP2-enhancerA.2:EGFP)^zc46; Tg(foxP2-enhancerB:EGFP)^zc41; Tg(foxP2-enhancerD:EGFP)^zc47; Tg(pax2a:GFP)^e1 36; Tg(elavl3:EGFP)^zf8 35. Df(LG01)^x8 homozygotes were identified by their smaller forebrain and flattened hindbrain phenotype (J.E.L. and R.I.D., unpublished). Tg(hsp70l:Δtcf-GFP)^w26 embryos were identified by GFP expression after heat shock.

Heat shock was performed by incubation of 32 hpf embryos for 1 hour at 37°C, then collecting 3 hours after the end of the heat shock.

Whole-mount in situ labeling for foxP2, gfp, and lef1 was performed as previously described 72747; the mbx RNA probe derived from full-length mbx cDNA cloned into pBluescript 31. Double in situs were performed using a DNP-labeled probe for foxP2 and digoxigenin-labeled probe for lef1. Following standard hybridization and washes, DNP probe was detected using an anti-DNP HRP conjugate diluted 1:200 in TNTB block at 4°C overnight (PerkinElmer; 48), followed by detection using Alexa Fluor 488 Tyramide diluted 1:250 (Molecular Probes) with 0.0015% hydrogen peroxide for 1 hour. Embryos were washed in TNT, blocked in TNTB, incubated with anti-digoxigenin alkaline phosphatase diluted 1:5000 in TNTB at 4°C overnight, and then detected with a standard BM Purple color reaction.

PCR primers to clone foxP2 genomic fragments were as follows (forward and reverse primers, sequences 5' to 3'; size in kb listed immediately following the enhancer name): foxP2-enhancerA (9.7 kb): FP2.12L GTCGTAATTGCTCGGTGAC, FP2.3R GTGTGAATGCCAGCGATAGA; foxP2-enhancerA.1 (6.8 kb): FP2.12L, FP2.16R CGTCTCGACTGAGCAGAGTT; foxP2-enhancerA.2 (5.1 kb): FP2.12L, FP2.46R ACAACTGGCGTGTAAGGTGT; foxP2-fragment A.3 (4.7 kb): FP2.41L GACACCTTACACGCCAGTTG, FP2.3R; foxP2-fragment A.4 (2.3 kb): FP2.41L, FP2.40R CAGGGTGTGTTATAAACATGCAT; foxP2-enhancerB (4.6 kb): FP2.39L GACACTCTGGAGGAACTATG, FP2.38R GGAAACGGTGCAGTATGTGT; foxP2-fragment C (1.6 kb): F.FP1 GGCGGGTACCTGGTCATATT, F.RP2 TTTCCACCCAACCATAAATCA; foxP2-enhancerD (1.2 kb): H.FP1 CCAGCTATCCGAGAGGTTCA, H.RP2 CCGCCTGTTCAAATCAGAAT; foxP2-fragment E (0.69 kb): G.FP1 TGACCTCTGTGTAGCCTTGC, G.RP2 CATTGCTAGGGGAACGTGAT.

PCR was performed using standard conditions (TaKaRa LA PCR amplification kit 2.1, Millipore) from total genomic DNA, and PCR fragments gel purified prior to cloning (Qiagen gel purification kit). BP and LR reactions (Gateway cloning system, Invitrogen) were performed to clone the DNA fragments upstream of an adenovirus E1b minimal promoter and carp β-actin transcriptional start fused to EGFP (pENTRbasEgfp) in a Tol2 plasmid backbone (pTolR4-R2) 323349. BP reactions were performed by adding attB4 sequence to the 5' primer (5'-GGGGACAACTTTGTATAGAAAAGTTG-gene specific primer-3'), and attB1 sequence to the 3' primer (5'-GGGGACTGCTTTTTTGTACAAACTTG-gene specific primer-3'). The identity of the genomic fragments was confirmed by restriction enzyme digests and partial sequencing.

Injection of DNA constructs and raising of stable transgenic lines was performed essentially as described 3349. 20 pg of each enhancer:EGFP-Tol2 construct was co-injected with 20 pg of Tol2 transposase RNA in a total volume of 1 nL at the 1-cell stage. Embryos were screened for GFP expression from 12 hpf through 96 hpf. Patterns of enhancer expression were confirmed by multiple independent transient injections of the plasmid (> 5 injections for all constructs, > 100 embryos per injection), as well as isolation of 2 or more independent stable transgenic lines (in cases where stable transgenics were isolated).

The lef1 and tcf3b splice-blocking morpholinos (MO) were synthesized by Gene Tools (Philomath, OR); efficacy and use were as previously described 27285051. For lef1, 2 ng of morpholino E7I7 was injected; for tcf3b, 5 ng was injected.

Whole-mount images were taken using brightfield microscopy with embryos mounted in 80% glycerol. Confocal microscope images of live embryos were taken after mounting embryos anesthetized using tricaine (0.004%) in 1.5% low melt agarose dissolved in 0.33× PBS/7.3% glycerol. Image acquisition and analysis were performed as described previously 52. Confocal images of double in situs were taken on an Olympus FV1000 after mounting embryos in 80% glycerol. BM Purple fluorescence was imaged with 633 nm excitation, collecting emission from 700–800 nm 53.

We used coordinate conversion ("convert" function) in the UCSC genome web server http://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#Convert54 to identify conserved lef1 binding sites in the foxP2 region of zebrafish, based on predicted Tcf4 binding sites positions in the human genome (since Tcf4 and Lef1 bind to a shared motif) 25. The genomic upstream sequence of foxP2 was obtained by performing a BLAST search against unfinished sequences in the Sanger Centre Danio rerio sequencing project (sequence for foxP2-enhancerA is contained in BAC DKEY-116L11; GenBank accession CU468733). To identify the sixth potential Lef1 binding site in the foxP2-enhancerA region predicted by Hallikas et al. 25, we used the enhancer element locator algorithm (available at http://www.cs.helsinki.fi/u/kpalin/EEL/, and compared the 9 kb regions upstream of the first coding exon of human and zebrafish FOXP2 using the Tcf4 consensus binding motif.

ChIP was performed as previously described 2755 with the following modifications. 80–120 embryos of each genotype (wild type or homozygous Df(LG01)^x8) were collected between 28 hpf and 30 hpf, dechorionated, and fixed in 2.2% formaldehyde for 15 minutes at room temperature. Embryos were rinsed in 0.125 M glycine, followed by PBS, and then lysed. The Df(LG01)^x8 lysate was checked by genomic PCR for the lef1 gene to confirm that no PCR product was obtained. PCR products were visualized on ethidium bromide-stained agarose gels. Primers used for ChIP analysis of the foxP2-enhancerA.1 genomic region were the following (forward and reverse primers, sequences 5' to 3'): FP300, CGACTCTCCGCGAAACAC, CATTGCCATTATCACCAGCA; FP900, CCTATCAAAGGCAGGCAGA, TTATCGCACTAAACAAGCTATTACAC; FP1800, CACAGAGTGAAGTCATGGAGAAA, AGCGCACGCACAACTAATC; FP2700, AGAGAAACGGATAAACAGTGAGAAG, CCCTCTCGAACCCTCAAAA; B3end, TGATTAACGCCGTCTTTTCC, AGCGCACGCACAATAAAATA. Primers used for ChIP analysis of the foxP2-enhancerB genomic region were (forward and reverse primers, sequences 5' to 3'): FPb200, AGCTGGAAGGAAGTGTCTGG, TTTTGGCATGTGCAAAGAAG; FPb1500, GCGTATGTATGCTTGTCAGGTT, TGCGTGGTGTTTTACTTGGA; FPb2600, CAGATCGACGGATGATACACA, TTCCGCCAATTATCATGTCA; FPb3800, GACCCCTTCGCAATGTCTAAT, TTCGAGAAATGCTTGCACAC.