Exposure of chicken embryonic fibroblasts to SSW smoke solutions resulted in a change in appearance of the cultures, from the cells being flattened and contact inhibited in the control to becoming more elongated and well separated from each other in the smoke treated cells (Fig. 1A,1B). These effects were observed with smoke concentrations similar to those found in tissues (1:9; SSW:media), whereas at higher doses (1:4), the cells rounded up, underwent cell death and floated into the culture medium (Fig. 1C). In order to confirm that the 1:9 concentration of SSW smoke components does not cause cell death, we performed several assays. We removed the smoke-containing medium and added fresh medium to the cultures to see if the cells recovered from the smoke exposure; within a few hours, the cells flattened and contacted each other again, and by 18 hours, the cultures returned to a normal state (Fig. 1D). We also performed a cell viability test by measuring the concentration of cellular ATP in cells treated with concentrations of 1:9 (SSW:media). Although SSW-treated cells produced less ATP than the control cells, the levels remained high (Fig. 1E), indicating that the doses of smoke we use in our studies do not result in severe metabolic alterations. Further, we performed flow cytometric analysis and found that untreated and SSW-treated cells showed high forward scattering properties (Fig. 2A,2B) with very few cells having low forward scattering properties, indicating a healthy morphology. On the other hand, staurosporine treatment (positive control), resulted in the majority of the cells showing much lower forward scattering properties (Fig. 2C), an indication that the cells were more fragmented or had a rough surface which is usually indicative of membrane blebbing and cell death. These findings were confirmed by staining the cells with acridine-orange/ethidium bromide to ascertain that the nucleus and the plasma membrane did not show blebbing (Fig. 2D). Taken together these data show that doses of SSW smoke approximating those found in tissues in vivo do not cause death of fibroblasts. Therefore, we tested a number of processes that can potentially be affected by these doses of SSW smoke, and might contribute to the abnormal healing observed in people that are exposed to this type of smoke.

To test whether cell proliferation was affected by SSW smoke solutions, fibroblasts were treated as above and cultured in the presence or absence of BrdU (Bromo-deoxyUridine). At the end of the experiment, the cells cultured in the absence of BrdU were counted using a Coulter counter. We observed that the smoke treatment did not significantly affect cell number (Fig. 3A). Cultures treated with BrdU were assayed for BrdU incorporation and showed that SSW inhibits cell division (Fig. 3B). This apparently conflicting result led us to hypothesize that these concentrations of SSW stimulate fibroblasts to survive by stimulating these cells to express and/or activate stress-response and/or survival proteins. To test this possibility, we examined the expression and activation of proteins that are known to be involved in cell survival or stress responses, such as the early stress response protein, interleukin-8 (cIL-8), the survival protein, protein kinase B (PKB/Akt), the ER stress response protein, glucose-regulated protein 78 (grp78), and the cell cycle control and survival proteins, p53 and p21. Cells responded to the smoke exposure by stimulating cIL-8 in a dose dependent manner (Fig. 4A); PKB/Akt was rapidly activated, peaking 5 minutes after initiation of smoke treatment (Fig. 4B); grp78 (Fig. 4C), p53 (Fig. 4D), and p21 (Fig. 4E) were also stimulated, albeit to different levels. These results coupled with those described in figure 3 suggest that the cells exposed to these doses of SSW smoke may be surviving better than the untreated cells. To test this possibility, we treated the cultures with SSW smoke for 18 hours, followed by replacement of the treatment with fresh medium for 24 hours, a time period that is sufficient to allow these cells to undergo at least one round of cell division. During this time, the cells recovered well from the stress caused by cigarette smoke and acquired a healthy morphology much like those of the control. The cells were then treated again with SSW for 18 hours to determine whether they would survive well after multiple rounds of SSW treatment. At the end of the experiments the cells were counted; the number of cells in the control and SSW-treated cultures were virtually the same (Fig 4F). Because the cells exposed to SSW replicate poorly (see Fig. 3B), the results taken together suggest that SSW increases cell survival.

Figure 1B shows that SSW-treatment induces a change in cell shape, leading us to examine whether alterations occur in major cytoskeletal elements involved in cell shape changes such as microfilaments. To perform these studies, we used rhodamine phalloidin to label F-actin. SSW-treatment increased stress fiber formation, as observed both by fluorescent labeling (Fig. 5A,5B) and by quantification of F-actin (Fig. 5C). Because stress fibers are known to associate with proteins in focal adhesion plaques to anchor cells to the substratum, we treated the cells with SSW, then visualized focal adhesion plaques by immunolabeling for vinculin. Smoke treatment increased focal adhesion plaque formation (Fig. 5D,5B). Furthermore, immunoblot analysis to quantify the levels of vinculin in treated cells showed that this protein is increased (Fig. 5F). GAPDH was used to control for loading (see Fig. 4C). These findings raise the possibility that SSW affects cell motility by increasing cell adhesion to the substratum. We used the cloning ring migration assay to test the possibility that cell migration is affected. In this assay, cells were seeded inside a cloning ring and allowed to adhere to the plate to form a "circle of cells" with a defined edge. After application of the treatment for the indicated time point, the distance migrated by the cells was measured from the edge of the original "circle of cells" to the fibroblasts that were furthest from the edge. SSW-treated cells (Fig. 5H,5I) were unable to migrate to the same extent as the control cells (Fig. 5G). Taken together, these data suggest that doses of SSW smoke comparable to those found in tissues in vivo adversely affect the cytoskeleton of fibroblasts, resulting in functional alterations, such as increased cell adhesion, leading to a decrease in cell migration.

In addition to the findings described above, we also observed that SSW treatment causes the appearance of numerous vacuoles in the cytosol within 3–4 hours after treatment was initiated (Fig. 6A). To determine the origin of vacuolation, we prepared the cells for analysis by transmission electron microscopy. Early times after exposure to SSW were used because at these time points the organelles are still clearly identified. Four hours after treatment with SSW, we observed that the cells were still morphologically unaffected (Fig. 6B); the mitochondria (Fig. 6C) and the nucleus (Fig. 6D) were morphologically normal whereas the endomembrane system was dilated and irregularly shaped (Fig. 6E). For comparison the endomembrane system of untreated cells is also shown (Fig. 6F). We further analyzed the integrity of the endomembrane system by staining with DIOC₆, a dye commonly used to label the endoplasmic reticulum (ER). The control cells showed that the ER was well developed, concentrated around the nucleus but also spread throughout the cytosol (Fig. 7A), whereas SSW-treated cells showed punctated staining, indicating fragmentation and coalescence of this membranous system around the nucleus (Fig. 7B). This effect is specific for SSW; cells treated with MainStream-Whole smoke (MSW), a solution that mimics "first-hand" smoke 10, did not affect the ER and looked very much like the control (Fig. 7C). To further examine the SSW-induced alteration in the endomembrane system, we stained the cells with an antibody to β-COP, a protein present in the Golgi network and vesicles. Again, in the control and MSW treated cells, the staining showed well-distributed Golgi vesicles in the Golgi network, whereas after SSW treatment, the staining was much less abundant suggesting breakdown of the network (Fig. 7D,7E,7F). In addition, we investigated the specific effects of SSW treatment on the endomembrane system, by examining the pattern of secretion of the chemokine, cIL-8, a protein that goes through the ER and Golgi before leaving the cell. Because cIL-8 is an inducible chemokine and is stimulated by stress-inducing agents, it is not produced under normal conditions (Fig. 7G). However, SSW-treated fibroblasts showed virtually no perinuclear staining where it would be expected; rather cIL-8 was dispersed throughout the cytoplasm suggesting a disruption of the endomembrane system (Fig. 7H). MSW-treated cells, on the other hand, showed perinuclear staining indicating that the cells have been stimulated by the smoke to produce cIL-8 and synthesis of the protein is occurring in close association with the nuclear membrane (Fig. 7I).

Second-hand smoke is very rich in nicotine, 2–3 times higher than in MSW (first-hand) smoke 2, and nicotine has been reported to cause vacuolation in cells. We found that nicotine is able to cause the vacuolation in fibroblasts to the same extent as SSW (compare Figs. 6A and 8B), suggesting that nicotine is at least a partially responsible for the effects of SSW on the endomembrane system. As mentioned above, grp78 is an intracellular molecule that is stimulated/activated when cells are under stress 15161718 and has also been shown to be specifically stimulated by agents that induce ER stress 192021. We found that nicotine stimulates grp78 to levels similar to those stimulated by SSW, both for the protein (Fig. 8C) and the mRNA (Fig. 8D). This suggests that nicotine is a major player in the effects of SSW on the changes we observe in the endomembrane system.

It is well established that the endomembrane system is intricately connected to microtubules for its distribution and function. We investigated the possibility that the microtubule network was altered in the smoke treated cells. In the control cells, the microtubules emanate from the perinuclear region, where the centrosome or microtubule organizing center (MTOC) is located, with clear, organized extension of the microtubules throughout the cytoplasm in all directions (Fig. 9A). In SSW-treated cells, the MTOC was disorganized and much less localized than in the control cells, and the microtubules did not project out from the MTOC into the cytosol in an organized manner, suggesting disruption of the tubulin arrays (Fig. 9B). To determine whether the levels of tubulin in the cells treated with SSW were altered, we performed immunoblot analysis and found that the SSW treated cells contained a higher level of tubulin than those of the untreated cells (Fig. 9C). Equal loading was confirmed using GAPDH as an internal control (see Fig. 4C; the same membrane was used to reprobe for the protein shown in this figure).

During granulation tissue formation, it is necessary for fibroblasts to migrate to the wound area in order to perform their many functions. Indeed, if migration is inhibited, as shown above, granulation tissue formation would be defective, resulting in slow or partial wound closure. In order to test this possibility, we performed wound healing assays in mice (C57BL/6J) that had been smoking for six months. The wounds were made with a 5 mm biopsy punch to the back of the mice and pictures were taken at the same magnification at day zero and day seven. The areas of the wounds were measured using Scion Image (NIH Image) and percent of the original wound area was calculated. At seven days, the area of the wounds of mice not exposed to smoke was 95% closed whereas the wounds of the SSW-exposed mice were only 85% closed (Fig. 10), showing that wound closure is significantly delayed by smoking. Cross-sections through the wounds of these mice showed that the granulation tissue of the smoking mice have abnormal cellularity and matrix deposition.

Tissue culture supplies and TRIzol reagent were purchased from Gibco-BRL.

Sidestream whole (SSW) smoke and mainstream whole (MSW) smoke solutions were made from 2R1 research-grade cigarettes (University of Kentucky, Louisville, KY). MSW and SSW smoke were bubbled into 199 serum free media as previously described by Knoll et al., 10 using a puffer box built by the University of Kentucky. SSW smoke was collected from the burning end of the cigarette and MSW smoke from the opposite end. The pH of the smoke solutions was adjusted to 7.4. The solution is aliquoted and kept frozen (this solution is stable for up to one and a half month at -20°C).

The smoke solution was quantified according to a previously described protocol. Briefly, 300 μl of each type of smoke solution was used to extract the nicotine after the pH was raised to 10 in order to partition the nicotine into the organic solvent. 1 ml of pentane containing 4 μg/ml of 2-benzylaminopyridine was added as an internal standard. The organic phase was removed and the aqueous phase was extracted again with 1 ml of pure pentane (without internal standard). The extracts were pooled and then evaporated to dryness under a stream of dry nitrogen gas and redissolved in 100 μl of dichloromethane. A 1 μl aliquot was analyzed by gas chromatography using fused-silica DB-1 column (J & W Scientific). Eluted compounds from the column were monitored by flame ionization detection (FID), and the signal was processed by an integrator. Nicotine contents were determined by calculating the ratio between the peak areas for nicotine and the 2-benzylaminopyridine internal standard, and comparing to a standard curve prepared with known amounts of nicotine and internal standard. The correlation coefficient of the standard curve was 0.9995.

Primary embryonic fibroblasts were prepared from 10-day-old chicken embryos as described previously 47. Briefly, on day four, primary cultures were trypsinized and plated at a density of 0.3 × 10⁶/35 mm plates in 199 medium (Gibco BRL) containing 0.3% tryptose phosphate broth and 2% donor calf serum, and were allowed to grow for 3 days to become confluent (this density of cells was used for the experiments except where indicated). The fibroblasts were exposed to the smoke solutions at 37°C, 5% CO₂ for varying periods of time.

ATP was measured using the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega, Inc.). The assay was performed according to the manufacturer's protocol with small modifications as briefly detailed below. 3 × 10⁴ cells/well was seeded into a 96 well plate (Costar, Inc.). Fibroblasts were treated with SSW for 18 hours. Half an hour before the end of the treatment, the cells were allowed to equilibrate to room temperature. The substrate was then added and the samples were read in a BMG LUMIstar Galaxy Luminometer.

Fibroblasts were plated at 1.2 × 10⁶ cells per 60 mm plate, allowed to grow to confluency and treated for the indicated times. Cells were then trypsinized, centrifuged, and stained with 50 nM DiOC6 (Molecular Probes, Inc.) in warm 1X PBS. They were then rinsed once and resuspended in 1X PBS. Samples were loaded into a FACS machine (Becton Dickinson Immunocytometry Systems) and counted. Excitation was done at 488 nm and emission detected at 530 nm.

BrdU incorporation assay was performed according to manufacturer's instruction (Oncogene, Inc.). Cells were seeded in a 96 well plate and allowed to grow to confluency. BrdU was added along with the SSW treatment and allowed to incubate for the appropriate time points. The cells were fixed and denatured with manufacturer's Fixative/Denaturing Solution and incubated for 30 minutes at room temperature. The samples were then incubated with anti-BrdU antibody for 1 hour at room temperature and washed 3 times. Peroxidase Goat anti-mouse IgG HRP was added and allowed to incubate for 30 minutes followed by the TMB substrate addition and incubation in the dark for 15 minutes and stopping the reaction and reading the samples at a dual wavelength of 450–570 nm.

Fibroblasts were treated with SSW smoke solution for 18 hours. For the cell growth studies, cells were then trypsinized, resuspended in isoton solution (Coulter Electronics Ltd) and counted in a Coulter counter (Model Z2; Coulter Electronics Ltd.). For survival studies, at the end of the treatment period, fresh media was added and cells were allowed to recover for 24 hours. The next day, the cells were treated again with SSW for 18 hours more. Cells were then typsinized, resuspended in isoton solution (Coulter Electronics Ltd) and counted in a Coulter counter.

This procedure was described previously by us 47.

The detection of PKB was done according to manufacturer's protocol (Upstate, Inc.). 2 × 10⁶ cells were seeded in a 35 mm plate until confluency. Cells were incubated in serum-free medium overnight to reduce basal levels of phosphorylation. The following day the cells were incubated with SSW in fresh serum-free medium for the appropriate times. At the end of the treatments cells were washed with 1X PBS, then lysed by adding 1X SDS Sample Buffer containing protease and phosphatase inhibitors, immediately scraped off the plates and transferred to a microcentrifuge tube and kept on ice. The samples were sonicated to shear DNA and reduce sample viscosity, then heated and cooled on ice. After centrifugation, the samples were loaded onto 10% SDS-PAGE gel.

Vinculin, β-COP protein, cIL-8, and microtubules were detected by labeling with specific antibodies. Fibroblasts were treated with SSW as described above. The cells were rinsed and fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 in 1X PBS, and incubated with PBS containing 0.1 M glycine. Cells were blocked with 10% goat or sheep serum in PBS, incubated with mouse anti-β-COP Protein (1:20), anti-cIL-8 (1:200), anti-vinculin (1:50) or anti-tubulin (1:200) in 1% BSA/PBS and washed three times with 0.1% BSA/PBS. The cells were then incubated in goat anti-mouse FITC or sheep anti-mouse Texas Red (1:100) in 1% BSA/PBS, washed 3 times, 10 minutes each, with 0.1% BSA in PBS, and mounted with Vectashield.

Fibroblasts were plated in cloning rings (Fisher Scientific, Inc.). Cells were allowed to adhere for 3 hours then treated with the SSW. Migration was measured at 24 hours using a micrometer. We measured the distance from the edge of the cloning ring to where the cells migrated. Six different measurements were made, averages and standard mean error were determined using Sigma Plot.

Samples were prepared as described previously 4849. Briefly, cells were fixed in 3% gluteraldehyde in a 0.1 M sodium cacodylate buffer, pH 7.4, and postfixed in a 2% aqueous solution of osmium tetroxide at RT. Dehydration was performed using ascending ethanol series and samples were embedded in Spurs epoxy resin. Thin sections were cut and stained with uranyl acetate in 70% ethanol, followed by lead citrate. Microscopy was performed in a CM 300 transmission electron microscope.

Cells were plated as described above, and treated for 4 hours, then washed with 1X PBS and fixed in 4% paraformaldehyde for 20 minutes. At the end of this period, cells were washed in 1X PBS, incubated with 1X PBS containing 0.1% Triton-X-100 for 10 minutes. After another round of washes, cells were incubated with either DIOC6 or Rhodamine Phalloidin at RT for 20 minutes and then washed and mounted in Vectashield. Quantification of filamentous actin: cells were incubated in 0.2% Triton-X-100 for 10 minutes after fixing in 4% paraformaldehyde. 0.1 M NaOH was used to extract the Rhodamine Phalloidin stained F-actin. Fluorescence was measured using a fluorimeter at 550–580 nm.

Total RNA was extracted using TRIzol reagent from untreated fibroblasts and fibroblasts treated with 1.5 mM nicotine for 1, 3, 6, 12, 18, and 24 hours. RT-PCR was performed using grp78 specific primers and the Promega Access RT-PCR System following the recommended protocol. The reaction conditions included: 5 ng of total RNA, first strand synthesis at 48°C for 45 min, then 95°C for 4 min to inactivate the reverse transcriptase and allow for denaturation of RNA/cDNA/primer. This was followed by second strand synthesis and PCR amplification at 95°C, 60 s; 55°C, 60 s for annealing, 72°C, 90 s for extension at 35 cycles and finally, 72°C for 10 minutes to extend the strands. 3 μl of Quantum mRNA classic 18S primers (Ambion, Inc.) were added to the reaction to produce a control product. Primers used for the amplification of grp78 were: sense primer 5'GAGATCATCGCCAACGATCAG and antisense primer 5'ACTTGATGTCCTGCTGCACAG. 18SrRNA sequence is proprietary information that belongs to Ambion. RT-PCR products were analyzed by electrophoresis in 1.5% agarose.

Microdensitometry analysis was performed using Scion Image analyzer. All data were expressed as mean ± SEM. Significance was determined using Student's t test for comparison between two means. Means were considered significantly different when P ≤ 0.05.