HT1080 cells were transiently transfected with a FUS-DDIT3-GFP construct and colocalization between the ectopically expressed fusion oncoprotein and endogenous cyclin D1, cyclin E, CDK2 and CDK4 was investigated by immunofluorescence. Cyclin E and CDK2 showed prominent colocalization with the FUS-DDIT3 protein and were detected in FUS-DDIT3 containing granules in the majority of cells (Figure 1). We found no signs of colocalization between FUS-DDIT3 and CDK4 (Figure 1) or cyclin D1 (not shown). Cells transfected with the empty GFP vector showed no granules and a smooth nuclear distribution of CDK2 and cyclin E (Figure 1).

Cells were transfected with FUS-DDIT3-GFP and cellular proteins were immunoprecipitated with GFP antibodies and further analyzed by western blot. In pilot experiments, we used HT1080 cells stably expressing FUS-DDIT3-GFP and could weakly detect endogenous CDK2 in immunoprecipitates while cyclin E was not found (data not shown). To further confirm a possible interaction between FUS-DDIT3 and CDK2, we instead transiently transfected cells using cloned CDK2 cDNA expressed in frame with the fluorescent protein DsRed1. Cells co-transfected with CDK2-DsRed1 and either of FUS-DDIT3 or DDIT3 expressing constructs showed presence of CDK2-DsRed1 in anti-GFP immunoprecipitates from both FUS-DDIT3 and DDIT3 transfected cells (Figure 2a). In contrast, CDK2-DsRed1 was not found in immunoprecipitates of cells transfected with the N-terminal part of FUS present in the FUS-DDIT3 protein or in GFP-transfected control cells (Figure 2a). In a reverse experiment, HT1080 cells were transfected with FUS-DDIT3, FUS-DDIT3ΔLZ, DDIT3 and GFP constructs and cellular proteins in extracts were immunoprecipitated with anti CDK2 antibodies (Figure 2b). We found that endogenous CDK2 co-immunoprecipitated with DDIT3, FUS-DDIT3 and FUS-DDIT3 lacking a leucine zipper domain. These results indicate that the region binding CDK2 is located N-terminally of the leucine zipper part of DDIT3. ClustalW alignment performed between DDIT3 and the related C/EBPα showed conservation of several amino acids in distinct regions shared by the two proteins but that DDIT3 lacks a region similar to the one that binds CDK2 in C/EBPα 26 (Figure 2c).

The CDK2 expression in HT1080 cells after 42 hours of transfection with FUS-DDIT3-GFP or GFP was investigated by western blot analysis (Figure 3). In addition, the phosphorylation status of CDK2 was analyzed using CDK2 antibodies targeting either the two inhibitory phosphorylations at threonine 14 and tyrosine 15 or the activating phosphorylation at threonine 160 (Figure 3). No apparent difference in CDK2 phosphorylation between cells expressing FUS-DDIT3-GFP or GFP was detected and the amount of CDK2 between the two transfected cell populations was equivalent (Figure 3). The CDK2 protein half-life did not differ between stably transfected FUS-DDIT3 cells and HT1080 control cells upon a six hour cycloheximide chase assay (not shown).

HT1080 cells were transfected with either of FUS-DDIT3, DDIT3 or GFP and CDK2 was immunoprecipitated from lysates with CDK2 specific antibodies (Figure 4). Precipitates were analyzed by SDS polyacrylamide gel electrophoresis and stained with Coomassie Blue. Several bands were present in the FUS-DDIT3 and DDIT3 precipitates that were absent in precipitates from GFP expressing cells (Figure 4). Bands from three regions were cut as indicated in the figure and analyzed by LC-MS/MS. The cytoskeletal cross-linker plectin (Figure 4, region 1), the actin motor-protein myosin (Figure 4, region 2) and the intermediary filament protein vimentin (Figure 4, region 3) were enriched in immunoprecipitates of FUS-DDIT3 and DDIT3 cells. The thicker bands with similar abundance in all three lanes in region 3 were identified by mass spectrometry as rabbit heavy chain immunoglobulin molecules.

Human HT1080 fibrosarcoma cells were grown in RPMI 1640 medium (Sigma-Aldrich) supplied with 10% fetal bovine serum, penicillin (50 U/ml) and streptomycin (50 μg/ml) at 37°C in 5% CO₂. Cells were transiently transfected at 50-70% confluence using the FuGENE 6 transfection reagent (Roche) with a 3:1 FuGENE:DNA ratio, according to the instructions supplied by the manufacturer.

Cells were fixed 24 hours after transfection in 3.7% formaldehyde in PBS for 10 min, rinsed in PBS and stained with rabbit polyclonal antibodies for CDK2 (C5223, Sigma-Aldrich), CDK4 (C8218, Sigma-Aldrich), cyclin D1 (M7155, Dako) or cyclin E (C4976, Sigma-Aldrich) that were detected using Cy3 conjugated secondary antibodies (Fluorolink, Amersham Biosciences). Finally, slides were mounted using DAPI/DABCO solution (Sigma-Aldrich), incubated over night at room temperature and then imaged using a Zeiss LSM510 META confocal microscope system.

For cloning of CDK2 the following primers were used: CDK2 forward GATCTCGAGCCACCATGGAGAACTTCCAAAAG, CDK2 reverse CAAGGATCCCGGAGTCGAAGATGGGGTACT. The CDK2 fragment was cloned into the pDsRed1-N1 vector (Clontech Laboratories) in frame with the DsRed1 sequence. All constructs were sequenced to exclude mutant clones. FUS-DDIT3-GFP, DDIT3-GFP and FUSA-GFP were previously described 2429. The FUS-DDIT3ΔLZ-GFP construct, expressing a protein lacking the 38 most C-terminal amino acids (including the leucine zipper region), is described elsewhere 30. Stably transfected FUS-DDIT3 cells has been described previously 31.

HT1080 cells were co-transfected with CDK2-DsRed and/or FUS-DDIT3-GFP/FUS-DDIT3-ΔLZ/DDIT3-GFP/FUSA-GFP/GFP constructs at 50-70% confluence. Twenty-four hours post transfection, cells were washed in PBS, scraped and lysed in NP-40 buffer (150 mM NaCl, 1% NP-40, 50 mM Tris pH 8.0) containing protease inhibitor (Complete Mini, Roche). Debris was removed by centrifugation at 14,000 g and supernatants were used for co-immunoprecipitations. Two microgram of antibodies specific for GFP (8372-2, BD Pharmingen) or CDK2 (C5223, Sigma-Aldrich) were prebound to protein A agarose beads (Millipore) blocked with 5% bovine serum albumin in NP-40 buffer overnight. Cell lysates were incubated with antibody-beads mixtures for 4 h at room temperature. Beads were washed 5 times with NP-40 buffer and proteins were released from beads by addition of 4× NuPAGE LDS sample buffer (Invitrogen) and incubation at 95°C. Supernatants were subsequently analyzed with western blot or with SYPRO Ruby gel staining (Sigma-Aldrich) according to the instructions supplied by the manufacturer. SYPRO stained gels were analyzed by liquid chromatography-mass spectrometry (LC-MS/MS) at the Proteomics Core Facility at University of Gothenburg. For experiments with phospho-CDK2 antibodies (see below), transfected cells were lysed in RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton x-100, 1% Sodium deoxycholate, 0.1% SDS) containing protease inhibitors and phosphatase inhibitors (NaF 10 mM, Na₃VO₄ 1 mM).

Proteins were separated using NuPAGE 4-12% Bis-Tris gels (Invitrogen), blotted onto PVDF membranes (Millipore) and probed with the following primary antibodies: CDK2 (sc-6248, Santa Cruz Biotechnology), p-CDK2 Thr14/Tyr15 (Santa Cruz Biotechnology), p-CDK2 Thr160 (Cell Signaling), cyclin E (C4976, Sigma-Aldrich), β-actin (mAbcam8226, Abcam) and GFP (8371-2, BD Pharmingen). Primary antibodies were detected with alkaline phosphatase conjugated secondary antibodies (Dako) and bands were visualized with BCIP/NBT Alkaline Phosphatase Substrate (Sigma-Aldrich).

The amino acid sequences of DDIT3 and C/EBPα were aligned using the ClustalW algorithm available at the Universal protein resource (UniProt) 32.