Purified B lymphocytes were treated in culture with 32 different ligands over a timecourse of 30 min, 1 hr, 2 hr, and 4 hr. A detailed description of the data set has been published 8. Following filtering, normalization and SAM analysis, genes that were differentially expressed by each ligand in comparison with time-matched, untreated controls were identified. Of the 32 ligands, CD40L, LPS, and AIG caused the most gene expression changes, especially at the 4 hr timepoint (Figure 1B). Further analysis focuses on these three immunologically-important ligands. Categorical values of 1, -1, and 0 (representing significantly upregulated, downregulated, or unchanged) were used to group genes together based on their expression response patterns (Table 1). Genes not differentially expressed under at least one treatment condition were omitted from further analysis. Based on 3 ligand combinations and a possibility of 3 outcomes for each ligand (1, -1, 0), there are a possible 3³ or 27 gene clusters, with the (0, 0, 0) outcome excluded since only genes that were differentially expressed under at least one treatment condition were selected (26 possible gene clusters). In our dataset, we only observe 19 of these possible 26. A variety of different expression patterns were observed. For example, Gene Cluster #1 contains genes that are upregulated by all three ligands, whereas Gene Cluster #14 contains genes that are only upregulated in response to LPS.

Microarray expression data can be full of experimental and biological noise, and many microarray probes are not well characterized. We developed a gene cluster classification method that circumvents these limitations and links biological function with gene expression patterns derived from microarray experiments. This method, termed CLASSIFI, uses Gene Ontology™ annotation to identify significant co-clustering of genes with similar biological properties, based on the postulate that genes involved in the same biological process would be coordinately expressed.

CLASSIFI utilizes the gene description database developed by the Gene Ontology™ (GO) Consortium 9 to reveal co-clustering of genes with similar biological properties. The GO annotates gene products with GO terms based upon their molecular function, biological process, and cellular component. These descriptive terms are structured in a directed acyclic graph of parent-child relationships, allowing a term to have multiple parents 1011. GO gene annotation has also been used by other groups as a tool for identifying biological processes relevant to gene expression profiling experiments 111213.

CLASSIFI measures the probability of co-clustering for every gene ontology term designated to every gene in each gene cluster. Gene expression data clustering and gene cluster membership assignment generates the CLASSIFI input file (See Additional file 1). CLASSIFI captures all of the GO terms annotated to every probe and then calculates the probability of chance co-clustering of GO terms. The final CLASSIFI output is a list of every GO term, ranked within each gene cluster from lowest to highest probability (See Additional file 2).

The filtered data set contained 2545 probes, which led to the calculation of 5036 probabilities (See Additional file 3). The GO term with the lowest probability for each gene cluster is shown in Table 1. A significance cutoff of 1 × 10^-5 was established using a Bonferroni correction with an alpha of 0.05 and an n of 5036 (see 14 and references therein). Six gene clusters give rise to GO terms with significant probabilities: Gene Cluster #1, 6, 7, 8, 14, and 18. Gene clusters identified by CLASSIFI to give significant probabilities exhibit predictable expression patterns that could be explained biologically, including gene clusters characterized by ligand-specific expression induction. Experimental noise may contribute to gene clusters with insignificant probabilities that show unusual expression patterns.

CLASSIFI results for some gene clusters are expected based on our current understanding of B cell physiology. For example, the GO term giving the lowest probability in Gene Cluster #1 is "nucleus". This gene cluster represents genes which are upregulated in response to all three ligands: AIG, CD40L, and LPS, and includes genes involved in transcription, replication and RNA processing. All three of these ligands induce cellular activation 1215 and proliferation (data not shown), so we would expect these kinds of nuclear genes to be highly expressed in B cells stimulated with all three ligands. The GO term giving the lowest probability in Gene Cluster #6 is "oxidoreductase activity, acting on NADH or NADPH". It has recently been shown that stimulation through CD40 and other TNF family members results in the production of reactive oxygen species through NADPH 16. Importantly, many of the GO terms giving the low probabilities in a given gene cluster are functionally related, e.g. monovalent inorganic ion transport, ion transport, transporter activity, and cation transport in Gene Cluster #18 (Table 2).

CLASSIFI analysis should be viewed as a hypothesis-generating tool. While the statistical analysis is compelling, predictions that derive from the hypotheses should be verified experimentally. We were particularly interested in the AIG-specific Gene Cluster #18 because these genes represent biological processes that are unique to antigenic stimulation rather than the general activation responses induced by all three ligands. The GO term giving the lowest probability in Gene Cluster #18 is "monovalent inorganic cation transport" (GO:0015672). An examination of the genes annotated with this GO term revealed multiple components of the vacuolar ATPase H+ pump (Table 3). Since stimulation through the BCR induces internalization of the receptor-antigen complex and trafficking through the endocytic system, "monovalent inorganic cation transport" could reflect the acidification of vesicles as they progress from endosomes to lysosomes during endocytosis. This AIG-specific cluster also contained an overrepresentation of genes involved in general "transporter activity" (GO:0005215), which includes genes like Rab9, sorting nexin 5 (Snx5) and N-ethylmaleimide sensitive fusion protein attachment protein alpha (Napa) that are involved in endosome trafficking and vesicle fusion. These observations led us to consider the hypothesis that AIG might induce the expression of various components of the endocytic and vesicle transport pathways in a manner that is independent of its effects on the general metabolic activation and proliferation of B cells, and that this might be part of a B cell-specific antigen processing and presentation function.

To ensure that the genes identified through the CLASSIFI analysis were meaningful, we first sought to verify their differential expression patterns. The microarray expression pattern of nine probes recognizing "transporter activity" genes in unstimulated and ligand-stimulated samples were evaluated (Figure 2A). In every case, expression of these genes was similar in all treatment conditions at 0.5 and 1 hr, but was higher in the AIG-treated samples at 2 hr and 4 hr. Examples in which the same gene is represented by two different probes show closely similar expression patterns, indicating the high quality of this microarray data set. To verify the ligand-specificity of expression, RT-PCR was used to examine the expression of a subset of these genes in independently-generated samples. Again, AIG induced enhanced expression of each of these genes compared to LPS and anti-CD40 (Figure 2B). RT-PCR results consistently confirm microarray expression data in this data set 8.

CLASSIFI analysis is based on the postulate that genes involved in the same biological process are coordinately expressed. Thus, one prediction of this analysis is that other genes involved in the same biological process that were not included in the microarray probe data set would show the same expression pattern. We evaluated 4 such genes that encode ATPase H+ pump complex subunits by RT-PCR. All of these genes demonstrated a preferential upregulation in response to AIG (Figure 2C). These data not only provide experimental validation of the CLASSIFI approach to microarray data analysis, but also further supports the hypothesis that AIG induces vesicle processing and transport as a biological process.

In order to further test predictions that follow from the CLASSIFI analysis we sought to determine if the process of endocytosis is activated in a ligand/receptor-specific manner. An internalization assay was performed in which the BCR is fluorescently labeled with a non-stimulating anti-IgM-FITC antibody prior to AIG treatment. After allowing time for internalization, the cells are subjected to an acid wash to remove surface-bound label. Label that has been internalized is protected from the acid wash and can therefore be detected using flow cytometry. Using this method, we found that BCR internalization (arrow, Figure 3D) occurs with AIG stimulation, but not CD40L or LPS stimulation in WEHI-231 cells (Figure 3A, G). Substantial internalization was found as early as 15 minutes post-stimulation and continued past 4 hours. Using fluorescence microscopy, internalized BCR can be seen in AIG-treated cells by 10 minutes. No internalization of the BCR is detected with anti-CD40 or LPS treatment (Figure 3J). Ligand-specific internalization of the BCR was also detected in primary B cells (data not shown).

To test whether receptor internalization following AIG stimulation is specific to the BCR and not other cell surface receptors, we performed internalization assays in which TLR4 (Toll-Like Receptor 4 – the LPS receptor) or CD40 was labeled prior to AIG treatment. In both cases, no internalization of the labeled receptor was detected (Figure 3E, F), demonstrating that AIG induces specific internalization of the BCR. (The slight shift in CD40 staining probably results from the upregulation of CD40 in response to AIG treatment.) Finally, to test whether stimulation of TLR4 with LPS or CD40 with anti-CD40 induces TLR4 or CD40 internalization, we fluorescently labeled TLR4 or CD40, then treated cells with the corresponding ligands. In the case of TLR4 stimulation with LPS, no internalization is detected (Figure 3B). Anti-CD40 stimulation induces a rapid receptor shedding phenomenon 17 and so it is difficult to directly compare the results of these samples with the other treatment conditions. However, no evidence for internalization was found (Figure 3I). Thus, AIG induces a ligand-specific, receptor-specific endocytic process that is likely designed to capture specific antigen for processing and presentation.

Finally, MHC class II expression would be expected to be high in B cells undergoing antigen processing and presentation. We found that following overnight stimulation with anti-IgM, CD40L, and LPS, Class II expression on anti-IgM treated cells is sustained, while in CD40L and LPS treated cells Class II expression is significantly downregulated (Figure 4). This ligand-specificity for maintenance of Class II on the surface of anti-IgM-treated cells is interesting because it suggests that B cells constitutively express a high level of Class II on the cell surface in anticipation of antigen presentation, which is then down-regulated in stimulated cells unless they are stimulated through the BCR. This idea that B cells are primed to undergo antigen processing and presentation supports observations in the literature that antigen processing and presentation is accelerated with BCR stimulation. Further, our preliminary data indicate that B cells show enhanced stimulation of antigen-specific T cell clones in response to BCR stimulation (data not shown).

In this paper we report the analysis of gene expression responses of B lymphocytes to a panel of extracellular ligands using CLASSIFI, a statistical approach that uses GO annotation to identify significant co-clustering of related genes, thus linking biological function with gene expression patterns derived from microarray experiments. CLASSIFI circumvents two traditional limitations associated with microarray expression analysis – the effects of experimental and biological noise, and the variable depth of knowledge of individual genes in the probe set. A well-characterized gene has relatively precise annotations that reach deep into the GO hierarchy, while a poorly-characterized gene is only annotated with high level terms. By capturing the entire ontology parentage of each gene, CLASSIFI overcomes limitations associated with variable depth-of-knowledge associated with most gene sets. In addition, the probability calculation used in CLASSIFI is relatively robust to the addition of experimental noise, allowing the use of less stringent data filtering approaches, which reduces the false negative discovery rate without the usual associated increase in false positives. Indeed, increasing the SAM FDR followed by CLASSIFI analysis increase the number of endocytosis-related genes while maintaining similar gene cluster classifications (data not shown).

Our analysis focused on the AIG-specific Gene Cluster #18, which was statistically classified as an intracellular transport-related gene cluster. Inspection of the entire gene list leads to the hypothesis that Gene Cluster #18 classification reflects the broader biological process of BCR-mediated endocytosis, vesicle acidification and trafficking, and antigen processing and presentation. CLASSIFI should be considered a hypothesis-generating tool that requires experimental validation. Several predictions of our hypothesis were confirmed experimentally, including ligand-specific endocytosis induction and MHC class II expression.

It should be noted that although we have used gene ontology annotation as a means of gene classification, any gene description scheme of interest could be used with the CLASSIFI approach to link experimental variables with legacy knowledge through gene expression microarray data.

Based on the genes responsible for Gene Cluster #18 classification (Table 3), we hypothesized that BCR engagement activates receptor-mediated endocytosis, vesicle acidification, vesicle trafficking, and antigen processing and presentation. We manually curated the AIG-specific cluster gene list and found a total of 38 genes, including those identified using CLASSIFI, that might be involved based on the molecular functions defined in other cell systems and biological processes from the literature (Table 4A). Figure 5 shows a schematic representation of the B cell antigen processing and presentation pathway indicating the putative roles played by these genes.

Several genes known to be involved in signal transduction were found in Gene Cluster #18; some have been demonstrated to play a role in BCR signaling while others are involved in signaling pathways in other cell types and are candidates for new BCR signaling components that stimulate the endocytic process (Table 4A). Activation of protein kinases, including members of the MAP kinase family, in response to BCR engagement is well documented; thus Strap, Map4k1 (Hpk1) and Map2k3 may also play a role in BCR signaling. Indeed, Map4k1 is expressed in hematopoietic cells and is required for activation-induced T cell death following TCR stimulation, and Map2k3 is required for IL-12 production by macrophages and dendritic cells, and antigen-mediated activation of T cells. CD72 has been found to regulate the cellular response to BCR signaling either through the recruitment of the SHP-1 phosphatase thereby dampening BCR signaling, or by cooperating with BCR signaling to prevent apoptosis in immature B cells. The Dusp14 dual specificity phosphatase has been found to associate with the CD28 co-receptor and dampen TCR-mediated signaling in T cells by inactivation of MAP kinases, suggesting that it may regulate BCR signaling in a similar fashion. Daam1 is involved in Wnt signaling in Xenopus embryogenesis. Strap binds to the TGF beta type I receptor and inhibits downstream signaling. Whether these proteins might play a role in regulating BCR signaling remains to be determined. The NF-ATc2 isoform has been found to participate in the BCR-induced apoptosis in B-cell-derived Burkitt's lymphoma cell lines, thus the presence of Nfatc2ip and Fkbp1 suggests that these interacting proteins may also be important in regulating Ca⁺⁺/calmodulin/calcineurin/NFAT signaling in B cells.

A large proportion of genes in Gene Cluster #18 encode proteins with roles in endocytosis, vesicle trafficking, vesicle acidification, molecular processing and protein secretion. In most cases these roles have been defined in other cell systems. Since little is known about the molecular details of these processes in receptor-mediated antigen capture and MHC class II-dependent antigen processing and presentation in B cells, the possibility that Gene Cluster #18 has produced a putative list of proteins that coordinate these activities is intriguing.

Snx5, a member of the sorting nexin family, has been found to interact with clathrin in skeletal muscle. Clathrin has been implicated in facilitating membrane invagination during receptor-mediated endocytosis in B cells. The presence of Snx5 in this cluster suggests that it may help mediate this process. The Als2 protein acts as a guanine nucleotide exchange factor for Rab5 and Rac1, and stimulates early endosome fusion. Rab proteins are small GTPases with homology to Ras that play key roles in vesicle transport: Rab18 has been found to localize near the apical and basolateral plasma membrane in epithelial cells of the kidney and intestine and Rab22a has been found to localize to the plasma membrane and early endosomes. Iqgap1 is a scaffolding protein with multiple protein-protein interaction domains and a GTPase activation protein (Gap) domain that stimulates the hydrolytic activity of Ras family members. Iqgap1 has also been found to localize to areas of membrane ruffling and newly formed vesicles in astrocytoma cells.

Genes encoding homologs to several components of the vesicle-type proton pump were found in Gene Cluster #18, including Atp6v0b, Atp6v1g1, Atp6v1c1, and Atp6v1f and the proton pump accessory protein Atp6ap2. Additional proton pump components were also found to be induced in an AIG-specific manner by RT-PCR (Atp6v0c, Atp6va1, Atp6v1h and Atp6v1a1). Together with the vesicle-specific chloride channel Clcn7, these proteins are likely to play a role in the acidification of the endocytic vesicles in preparation for their fusion with lysosomes to facilitate antigen hydrolysis. Proton pump components can serve as a membrane anchor point for SNARE proteins. Napa appears to mediate the tethering of these vesicles in preparation for fusion. Rab9 also appears to play a role in vesicle fusion since mutations in Rab9 lead to the accumulation of lipid-rich vesicles.

Several proteins involved in lysosome formation and antigen processing were found in Gene Cluster #18. Dysbindin binds to dystobrevins and is a component of the biogenesis of lysosome-related organelles complex 1 in mouse liver, which regulates trafficking to lysosomal organelles. Mutations in the Cln3 gene leads to a lysosomal storage disorder associated with the accumulation of lipopigment-laden vesicles. Hexosaminidase A is a pH-sensitive hydrolase. A variety of cathepsins are involved in MHC Class II antigen processing and presentation. None of the probes for these genes passed our data filtering process, however the cathepsin inhibitor Cystatin B was found in Gene Cluster #18, suggesting that it might play a role in regulating cleavage site selection by modifying the relative activities of proteases involved in antigen processing and peptide loading. Hspbp1 may facilitate antigen processing by regulating the chaperone function of Hsp70, which has been associated with the presentation of myelin basic protein though MHC class II in multiple sclerosis.

Several genes involved in MHC class II expression were found in the AIG-specific gene cluster. Atf1 is a transcription factor that activates the promoter of the class II trans-activator (CIITA). Translocation of nascent MHC class II peptide chains into the lumen of the endoplasmic reticulum involves the function of the Sec61 translocation complex, the signal sequence receptor Ssr1 (a.k.a. TRAP alpha) and the signal peptidase SPC22. Calmegin (Clgn) is a Ca⁺⁺ binding chaperone protein with significant homology to calreticulin and calnexin, an ER chaperone protein that regulates the assembly of MHC class II with the Ii invariant chain.

Vesicles containing peptide-loaded MHC class II are transported to the plasma membrane for fusion and exposure on the cell surface, perhaps by traveling back through the TGN into the secretory pathway. The Vsp29 protein has been found to facilitate this kind of retrograde TGN transport in yeast. In neurons, reticulon 3 is associated with synaptophysin in tubulovesicular structures and may play a role in the process of vesicle secretion. CD63, an MHC class II co-receptor, may play a role in regulating MHC receptor compartmentalization.

38 genes found in Gene Cluster #18 encode proteins that have some connection with signaling, antigen capture, vesicle transport, vesicle acidification or MHC class II expression, suggesting that activation of B cells through the BCR is inducing the expression of genes involved in MHC class II antigen processing and presentation. The activation of class II presentation by antigen receptor engagement in B cells has been described extensively. The findings reported here are novel in that microarray results combined with CLASSIFI analysis have provided a list of genes that may be involved in this important immunological process.

Finally, it is intriguing to note the presence of genes involved in the regulation of apoptosis and autoimmunity (Table 4C and 4D) in Gene Cluster #18, given the known function of the BCR in negative selection and the induction of autoimmunity.

The changes in mRNA levels for these genes involved in vesicle trafficking might be necessary to stimulate this biological process in AIG-stimulated B cells. However, the kinetics of the mRNA changes compared with the rapid induction of endocytosis suggests that this may not be the case. Elevated mRNA levels for these genes was found at 2 and 4 hr, but not at 0.5 or 1 hr post-stimulation. However, BCR endocytosis was maximally stimulated by 15 minutes. The rapid induction of endocytosis suggests that at least the initiation of this process is activated through post-transcriptional mechanisms. This finding suggests that the AIG-specific transcriptional reprogramming observed in response to BCR stimulation may reflect positive feedback regulation in which expression of proteins that have already been activated is increased either as a means to amplify or sustain the process. Perhaps components of this important biological process are present at low levels in resting cells, and levels increase in response to appropriate environmental cues. This kind of regulatory process might allow cells to respond rapidly to a broad set of variables in their changing environment while conserving energy and materials while in a resting state.

Isolation of primary splenic murine B cells was performed as described in the Alliance for Cellular Signaling (AfCS)/Nature Signaling Gateway website 18. Briefly, splenocytes from 6–10 week old C57BL/6 mice were subjected to a magnetic bead negative selection procedure (Miltenyi Biotech, Auburn, CA) to remove CD43+ and Mac-1+ cells, resulting in an enriched population of resting B cells that was an average of 96% B220+, as determined by flow cytometry 19. Purified B cells were cultured in supplemented Iscove's Modified Dulbecco's Medium 20 with 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA) at 37°C under 5% CO₂. For microarray and internalization experiments, cells were treated for 0.5 hr, 1 hr, 2 hr, and 4 hr with media alone, or with mu chain specific Goat anti-mouse immunoglobulin, (AIG) (Jackson Immunoresearch) at 45 μg/ml, hamster anti-mouse CD40 monoclonal antibody, clone HM40-3 (BD Pharmingen) at 9.73 μg/ml, or lipopolysaccharide (LPS) (Sigma-Aldrich) at 40 μg/ml. For real-time PCR experiments, cells were treated with anti-IgM at 20 μg/ml or anti-CD40 at 625 ng/ml.

Microarray-related experimental protocols can be found at the AfCS/Nature website at 21; protocol IDs are: PP00000009-RNA extraction, PP00000019-sample preparation and hybridization. Briefly, RNA samples isolated from B cells treated with a panel of 32 ligands were compared with untreated samples using a microarray chip containing 15,494 cDNA probes printed on 15,832 spots representing 10,615 unique MGI gene matches (as of 12/31/03). 38% of the probes have not been assigned a gene name, 96% come from the RIKEN FANTOM collection, 3% from the Minoro Ko National Institute of Aging collection, and the rest from the Research Genetics and Genome Systems collections. RNA samples were used to generate Cy5- and Cy3-labeled cDNA targets (from sample RNAs and RBC-depleted total splenocyte RNA, respectively) and were hybridized together. All samples were run in triplicate except for 1 hr and 4 hr untreated controls, which were run in quadruplicate. Arrays were scanned using the Agilent Scanner G2505A (Agilent Technologies, Palo Alto, CA). Image files were analyzed using the Agilent G2566AA Feature Extraction software version A.6.1.1. The raw data from these experiments is available at 22. Spot features on each array were filtered to remove those values that were saturated, non-uniform, or below background. Statistical filtering was accomplished using Significance Analysis of Microarrays (SAM) 23. Features found by SAM to be differentially expressed between samples and time-matched untreated controls at a false discovery rate (FDR) of 1% were included for further analysis. Input for SAM were background-subtracted, dye bias- and interarray variance-normalized Cy5 fluorescence intensity values, which represent expression level of array features. Only features with more than two replicates were used in the SAM analysis. 100 random permutations were done for each comparison of treated to time-matched control samples. Values of +1, -1, or 0 were given to genes that were found by SAM to be significantly upregulated, downregulated, or unchanged (respectively) compared to time-matched untreated controls. These values were used to categorically group genes together based on their expression response patterns.

Cluster Assignment for Biological Inference (CLASSIFI) was developed as a method for statistical evaluation of Gene Ontology™ (GO) term co-clustering (Figure 1A). CLASSIFI is predicated on the postulate that genes involved in the same biological process are coordinately expressed; examples of coordinate expression of interacting proteins in eukaryotes has been described 24252627. Following data transformation, filtering, normalization, standard expression clustering approaches and gene cluster membership assignment, the following steps are performed in the CLASSIFI analysis: 1) remove duplicate probe IDs, 2) extract the primary GO annotations for each gene from a probe database, 3) capture the full GO ancestry for each primary GO annotation from the Gene Ontology™ database, and 4) calculate the solution for the cumulative hypergeometric distribution equation for every GO term in every gene cluster:

P = 1 − ∑ i = 0 n − 1 ( f i ) ( g − f c − i ) ( g c ) MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaacqWGqbaucqGH9aqpcqaIXaqmcqGHsisldaaeWbqaamaalaaabaWaaeWaaeaafaqabeGabaaabaGaemOzaygabaGaemyAaKgaaaGaayjkaiaawMcaamaabmaabaqbaeqabiqaaaqaaiabdEgaNjabgkHiTiabdAgaMbqaaiabdogaJjabgkHiTiabdMgaPbaaaiaawIcacaGLPaaaaeaadaqadaqaauaabeqaceaaaeaacqWGNbWzaeaacqWGJbWyaaaacaGLOaGaayzkaaaaaaWcbaGaemyAaKMaeyypa0JaeGimaadabaGaemOBa4MaeyOeI0IaeGymaedaniabggHiLdaaaa@4AE3@

where g = number of probes in the data set, c = number of probes in the gene cluster, f = number of probes with a given ontology in the data set, n = number of probes with a given ontology in the gene cluster. The hypergeometric distribution calculates the probability (P) that genes with a particular GO term would co-cluster by chance given the proportion of genes annotated with this GO term in the entire data set. A web interface for use of the CLASSIFI method with data derived from cDNA, oligonucleotide and Affymetrix microarrays, along with detailed information about CLASSIFI input and output files can be found at the CLASSIFI website 28.

Total RNA was extracted as for the microarray experiments. 1 μg of total RNA was treated with DNaseI (Invitrogen), then reverse transcribed at 42°C for one hour in a 20 μl volume containing 1 μl MMLV reverse transcriptase (Invitrogen), 4 μl 5X buffer (Invitrogen), 0.5 mM dNTPs (Invitrogen), and 5 ng/μl pd(N)₆ (Amersham). Following inactivation at 70°C for 20 min, PCR reactions were set up in a 20 μl volume using Sybr Green Master Maker (Applied Biosystems). Thermal cycling began with a denaturation step of 10 minutes at 95°C, followed by 40 cycles of 95°C for 15 seconds (denaturation) and 60°C for 1 minute (annealing and extension). PCR reactions were performed in the ABI Prism 7700 Sequence Detector (PE Biosystems, Foster City, CA), and data collected and analyzed with the Sequence Detector software (PE Biosystems). Standard curves were generated using RNA isolated from RBC-depleted mouse splenocytes. RT-PCR of mouse 18S rRNA levels was used for normalization. Data from treated samples were compared to untreated samples, giving values representing the fold change in gene expression relative to untreated samples. PCR primers were designed using Primer3 software 29: ATP6v0Bc" forward (f) 5'gaaccccagcctctttgtaa3', reverse (r) 5'cccatcttcactctggaggt3'; ATP6v1c1 (f) 5'tgcttgccaaagaggtaaca3', (r) 5'tcgctgcatgtagtttctcc3'; sorting nexin V (f) 5'gggagaaggggaaggatcta3', (r) 5'catgggtggacacagtcttc3'; vacuolar protein 29S (f) 5'ctgcagaggcagtttgatgt3', (r) 5'ggcagaacctgggttaatgt3'; ATP6v0c (f) 5'atgtcagtcatgaggccaga3', (r) 5'agcgataagtactgccacca3'; ATP6v0a1 (f) 5'tccacccagtctgtaggtga3'. (r) 5'atcatgatcagggtgcagaa3'; ATP6v1h (f) 5'gatgctgctgtcccaactaa3', (r) 5'agaaatcatctgcccctgaa3'; ATP6v1a1 (f) 5'gaattatgatgcgtccgatg3', (r) 5'cgcctgggatagcagtagtt3'. Mouse 18S PCR primers sequences are from 30: (f) 5'gtaacccgttgaaccccatt3', (r) 5'ccatccaatcggtagtagcg3'.

1 × 10⁶ WEHI-231 cells (a mouse B cell lymphoma line) were pre-stained for 10 min at 4°C with monoclonal antibodies to cell surface receptors: Rat anti-IgM-FITC clone R6-60.2 or clone II/40 (BD Pharmingen), Rat anti-CD40-FITC clone 3/23 (BD Pharmingen), or Rat anti-TLR4/MD2-PE clone MTS510 (eBiosciences). Following 2 washes in PBS/2% FBS/2 mM EDTA, cells were cultured and stimulated using the aforementioned ligand concentrations in RPMI supplemented with 10% FBS (Hyclone), 100 U/ml penicillin, 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA), sodium pyruvate, HEPES, and 2-ME (Invitrogen). Following incubation at 37°C with 5% CO₂ for various time periods, cells were harvested and incubated at 4°C for 5 minutes in 0.2 M Acetic acid/0.5 M NaCl to strip off staining antibodies 31, or in PBS/2% FBS/2 mM EDTA (control). Following 2 washes in 0.2 M Acetic acid/0.5 M NaCl or PBS/2% FBS/2 mM EDTA, respectively, samples were fixed in 1% paraformaldehyde. Data were acquired using a FACSCalibur™ flow cytometer and analyzed using CellQuest™ software (Becton Dickinson Immunocytometry Systems).

MHC class II expression was measured by flow cytometric analysis using FITC-conjugated antibody against I-A^d clone 39-10-8 (BD Pharmingen).

1 × 10⁶ WEHI-231 cells were harvested and resuspended in 100 μl PBS containing 2% FBS. 2 μl of rat anti-IgM-FITC clone R6-60.2 antibody was added, and cells incubated on ice for 10 minutes to allow BCR staining. R6-60.2 was determined to be non-stimulating because it did not flux calcium or induce detectable tyrosine phosphorylation in these cells (data not shown). Following one wash in PBS/2%FBS, cells were resuspended in 100 ul phenol-red free growth medium (Invitrogen) and kept on ice prior to stimulation. Cells were stimulated by addition of ligands at the following concentrations: AIG, 20 μg/ml; HM40-3, 9.73 μg/ml; or LPS, 40 μg/ml. Images were captured at room temperature immediately following ligand stimulation for up to 10 min. Using the Zeiss Axioplan 2 upright fluorescence microscope (Carl Zeiss, Inc, Thornwood, NY), images were captured with the 60X objective under oil immersion using the OpenLab™ software, version 4.0.1 (Improvision, Boston, MA). 2 images were captured for each field of view: one for detection of FITC fluorescence, and one for differential interference contrast (DIC) imaging of cells. Images were processed using OpenLab™.