The C. elegans Y87G2A.14 gene encodes a 234 amino acid protein with an expected molecular weight of 26,601 Da. It was amplified by PCR from a C. elegans cDNA library. The PCR fragment was inserted into the pET-32b(+) expression vector and the nucleotide sequence of the insert was determined to be exactly the same as that submitted to GenBank under accession no. CAB54476. The recombinant plasmid pETY87G2A.14 was then used to transform E. coli BL21 (DE3) cells to generate a His-tagged thioredoxin fusion protein with an expected molecular mass of 43,731 Da. When the Trx-Y87G2A.14 fusion protein was expressed at 37°C, it was confined to inclusion bodies, so the induction temperature was decreased to 25°C to enhance protein solubility. As the expression level was low at this temperature, the induction time was increased to 8 h. These conditions markedly increased the solubility of Trx-Y87G2A.14 which was then purified from the soluble fraction (Fig 1, lane 2) to apparent homogeneity on NiCAM™-HC resin (Fig 1, lane 3). To determine the molecular weight of the Y87G2A.14 protein itself, the Trx-Y87G2A.14 fusion was cleaved with thrombin, which generated Y87G2A.14 with an apparent molecular weight of 27 kDa (expected molecular weight, 29,807 Da) and thioredoxin (15 kDa, Fig 1, lane 4).

Purified Trx-Y87G2A.14 was inactive towards the following nucleotides when assayed at a fixed concentration of 0.5 mM: NADH, NAD⁺, NDP-sugars, 5'-(d)NTPs, 5'-NDPs, 5'-NMPs and diadenosine polyphosphates. High activity was found with CoA and its derivatives. HPLC analysis of CoA hydrolysis by Trx-Y87G2A.14 showed that the enzyme was a CoA diphosphatase, cleaving the diphosphate linkage in CoA to yield adenosine 3',5'-bisphosphate (3',5'-ADP) and 4'-phosphopantetheine (Fig 2).

Trx-Y87G2A.14 displayed optimal activity with 0.5 mM CoA as a substrate at pH 9.5. A divalent metal ion was absolutely required for activity, with optimal activity at 5 mM MgCl₂. In common with all other Nudix hydrolases tested, fluoride was a strong inhibitor with a K_i value of approximately 3 μM (results not shown). K_m, and k_cat values for CoA, CoA esters and oxidized CoA were calculated by non-linear regression from data obtained by HPLC analysis (Table 1). A graphical example of the data for CoA in the form of a hyperbolic plot (Fig 3a) and double reciprocal plot (Fig 3b) show that the enzyme obeys simple Michaelis-Menten kinetics. The k_cat / K_m ratios show that the enzyme prefers reduced forms of CoA to oxidized CoA (Table 1) with CoA itself the best substrate of those tested.

Y87G2A.14 has the C-terminal tripeptide sequence SKI. This conforms to the pattern typical of PTS1 peroxisomal targeting signals found in many peroxisomal matrix proteins, suggesting that Y87G2A.14 may be targeted to these organelles 1819. However, possession of a potential PTS1 sequence is not always sufficient on its own to result in peroxisomal targeting and other elements of the protein sequence may also be involved. Since targeting of animal peroxisomal proteins expressed in yeast has often been observed, yeast cells were transformed with expression plasmids encoding C-terminal or N-terminal fusions of Y87G2A.14 to yeast-enhanced green fluorescent protein (yEGFP) in order to determine the subcellular location of Y87G2A.14. The cells were then examined by confocal microscopy. Cells transformed with pY87G2A.14-yEGFP, in which the C-terminus of Y87G2A.14 is fused to the N-terminus of yEGFP, showed a diffuse, cytoplasmic fluorescence with no clear subcellular localization (Fig 4a). In contrast, cells transformed with pyEGFP-Y87G2A.14, in which the C-terminal tripeptide SKI is free to act as a targeting signal showed the clear punctate fluorescence that is indicative of yeast peroxisomes 16 (Fig 4b). The identity of SKI as the targeting signal was confirmed by transformation of cells with pyEGFP-Y87G2A.14Δ SKI, in which the C-terminal tripeptide was deleted during construction. This again showed a diffuse, cytoplasmic, fluorescence (Fig 4c). Together, these results strongly suggest that Y87G2A.14 is targeted to peroxisomes by its C-terminal tripeptide, SKI.

A cDNA corresponding to the C. elegans Y87G2A.14 gene on chromosome 1 (GenBank accession no. CAB54476) was amplified from a cDNA library by PCR using as forward and reverse primers 5' GCAAATCATGAAGTGTGTGGTTAGCCGAGCTG 3' and 5' TAAATGAATTCACTAAATTTTGGATTTCGGTTC 3' respectively. These primers provided a BspH1 restriction site at the start of the amplified gene and an EcoR1 site at the end. After amplification with Pfu DNA polymerase, the DNA was recovered by phenol/chloroform extraction and digested with BspH1 and EcoR1. The digest was gel-purified and the restriction fragment ligated into the Nco1 and EcoR1 restriction sites of pET-32b(+) as both BspH1 and Nco1 form compatible ends with each other. The resulting construct, pETY87G2A.14, yielded Y87G2A.14 downstream of the 109-amino acid thioredoxin (Trx) fusion and His-tag and S-tag sequences under the control of an IPTG-inducible promoter. The structure of the insert was confirmed by sequencing. The construct was propagated by transformation of E. coli XL1-Blue cells.

E. coli strain BL21(DE3) was transformed with pETY87G2A.14. A single colony was picked from an LB agar plate containing 50 μg/ml ampicillin and inoculated into 10 ml LB medium containing 50 μg/ml ampicillin and incubated at 37°C. When the cells reached an A₆₀₀ of 0.5, they were transferred to 1 litre of fresh LB medium containing 50 μg/ml ampicillin and grown to an A₆₀₀ of 0.3 at 37°C, then transferred to an incubator at 25°C. Isopropyl-1-thio-β-D-galactopyranoside (IPTG) was added to 1 mM at an A₆₀₀ of 0.8, and the cells induced for 8 h. The induced cells (4 g) were harvested, washed and resuspended in 20 ml breakage buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM DTT). The cell suspension was sonicated and the cell lysate was then cleared by centrifugation at 10,000 × g at 4°C for 15 min. The supernatant was applied to a 15 × 50 mm column of NiCAM™-HC resin (Sigma) equilibrated with 50 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 1 mM 2-mercaptoethanol at a flow rate of 0.5 ml/min. After eluting the unbound proteins, a linear gradient of 0–40 mM histidine in the same equilibration buffer was applied at flow rate of 1 ml/min and 1 ml fractions collected and analysed by SDS-PAGE. Those containing pure Trx-Y87G2A.14 fusion protein were collected, dialysed overnight at 4°C against 1 litre of 20 mM Tris-HCl, pH 8.0, 50 mM NaCl, ImM DTT and then concentrated by ultraflltration (Amicon) and stored at -20°C in 50% glycerol.

Potential substrates were screened by measuring the Pi released after nucleotide hydrolysis in presence of inorganic pyrophosphatase or alkaline phosphatase 9. The standard assay (200 μl) for phosphodiester substrates was incubated at 37°C for 30 min and contained 50 mM l,3-bis [tris(hydroxymethyl)-methylamino]propane-HCl (BisTrisPropane-HCl), pH 8.0, 5 mM MgCl₂, 1 mM DTT, 0.5 mM substrate, 0.1 μg of Trx-Y87G2A.14 fusion protein and 0.5 μg (1 unit) alkaline phosphatase. Assays with phosphomonoester substrates were as above, except 0.5 μg (100 mU) inorganic pyrophosphatase was used instead of alkaline phosphatase. The Pi released in each case was measured colorimetrically.

Kinetic parameters and reaction products generated from hydrolysis of CoA and its derivatives were measured by high performance anion-exchange chromatography. The reaction mixtures (100 μl) contained 50 mM BisTrisPropane-HCl, pH 9.5, 5 mM MgCl₂, 1 mM DTT (in cases of substrates requiring reducing conditions), substrate in the range of 0.05–0.7 mM, (0.1–1 mM in the case of oxidized CoA) and were incubated at 37°C for up to 20 min (during which time the reaction rates remained linear) with 0.1 μg Trx-Y87G2A.14 fusion protein. A 90 μl sample of each reaction mixture was applied to a 1 ml Resource-Q column (Amersham Pharmacia Biotech) equilibrated with 0.045 M CH₃COONH₄ (pH 4.6, adjusted with H₃PO₄), and eluted with a linear gradient from 0 to 0.45 M NaH₂PO₄ (pH 2.7 adjusted with CH₃COOH) for 10 min at a flow rate of 2 ml/min 28. Elution was monitored at 259 nm and peaks identified with the aid of standards and quantified by area integration.

Expression plasmids encoding C-terminal and N-terminal fusions of Y87G2A.14 to yeast-enhanced green fluorescent protein (yEGFP) 29 were constructed by amplification of the coding region of Y87G2A.14 from C. elegans cDNA by PCR using the same forward primer 5' CGACGGATCCATGAAGTGTGT 3' and one of the reverse primers 5' TAAATGAATTCACTAAATTTTGGATTTCGGTTC 3', 5' CACTAAGAATTCTATTTCGGTTCAAATTTCCTACTTGC 3', or 5' GCTCGAATGAATTCAATTTTGGATTTCGGTTC 3' to give PCR products "C", "CΔSKI" or "N" respectively. These primers provided a BamH1 restriction site at the start of the amplified gene and EcoR1 sites at the end. PCR products "C" and "CΔSKI" were cloned as C-terminal fusion proteins to yEGFP, while PCR product "N" with a deletion of the Y87G2A.14 termination codon was cloned as an N-terminal fusion to yEGFP. After amplification with Pfu DNA polymerase, the DNA products were recovered by phenol/chloroform extraction and digested with BamH1 and EcoR1. The digested PCR products "C", and "CΔSKI" were gel purified and the restriction fragments ligated between the BamH1 and EcoR1 restriction sites of pUG36 (yEGFP-C-fusion) to give pyEGFP-Y87G2A.14 and pyEGFP-Y87G2A.14ΔSKI respectively. The digested PCR product "N" was gel purified and the restriction fragment ligated between the BamH1 and EcoR1 restriction sites of pUG35 (yEGFP-N-fusion) to give pY87G2A.14-yEGFP. The structures of the inserts were confirmed by sequencing. The plasmids were propagated by transformation of E. coli XL 1-Blue cells. For microscopy, S. cerevisiae strain BY4741 was transformed with pyEGFP-Y87G2A.14, pyEGFP-Y87G2A.14ΔSKI or pY87G2A.14-yEGFP and grown on solid SC-Ura medium containing 2% glucose. Cells were viewed by conventional and confocal fluorescent microscopy on a Zeiss LSM510 confocal microscope with a 100 × 1.4 NA objective.

Protein concentrations were estimated by the Coomassie blue binding dye-based colorimetric method using equal weights of bovine serum albumin, conalbumin, cytochrome c and myoglobin as standards 30.