Protein sequence alignment of nine PiT family members representing all kingdoms was made using the ClustalW alignment program version 2.0.12 available at the European Bioinformatics Institute server (URL: http://www.ebi.ac.uk/clustalw2/) 32. The Swiss-Prot protein sequences were retrieved from the NCBI Protein server (URL: http://www.ncbi.nlm.nih.gov/protein/). Accession numbers are: Homo sapiens (H. sapiens) PiT2 [Swiss-Prot:Q08357], H. sapiens PiT1 [Swiss-Prot:Q08344], Caenhorabditis elegans (C. elegans) putative phosphate permease [Swiss-Prot:Q17455], Drosophila melanogaster (D. melanogaster) putative phosphate permease [Swiss-Prot:Q9VTG0], N. crassa Pho-4⁺ [Swiss-Prot:P15710], Trypanosoma brucei (T. brucei) putative phosphate permease [Swiss-Prot:Q9N930], A. fulgidus putative phosphate permease [Swiss-Prot:O29467], A. thaliana Pht2_1 [Swiss-Prot:Q38954], and E. coli PiTA [Swiss-Prot:P37308]. All sequences encompass two 12-amino-acid-long sequences, which based on comparison of 109 sequences, were identified in PiT proteins and related proteins and suggested to be PiT family signature sequences 18. We, however, observed that the C-terminal PiT family signature sequence of E. coli PiTA did not group together with the C-terminal PiT family signature sequences of the eight other species in the alignment (data not shown). In order to group all the C-terminal PiT family signature sequences together, the alignment was adjusted manually after an alignment of H. sapiens PiT2 amino acids S₄₂₂-V₆₅₂ [Swiss-Prot:Q08357], A. fulgidus putative phosphate permease [Swiss-Prot:O29467], and E. coli PiTA [Swiss-Prot:P37308]. For the adjusted protein sequence alignment of the PiT family members, see Additional File 1 Figure A.

Putative TM domains were predicted using the TMHMM Server v. 2.0 available at the Center for Biological Sequence Analysis, Technical University of Denmark (URL: http://www.cbs.dtu.dk/services/TMHMM/), and the Dense Alignment Surface (DAS) Transmembrane Prediction server available at the Stockholm Bioinformatics Center, Stockholm University (URL: http://www.sbc.su.se/~miklos/DAS/). TMHMM is based on a hidden Markov model (HMM) that is cyclic with seven types of states for helix core, helix caps on either side, loop on the cytoplasmic side, two loops for the non-cytoplasmic side, and a globular domain state in the middle of each loop 33, and DAS is based on low-stringency dot-plots of the query sequence against a collection of non-homologous membrane proteins using a previously derived special scoring matrix 34.

In general, the predictions using both servers correspond well to each other when compared (data not shown), however, the DAS server tends to predict shorter TM domains in agreement with the tendency for prokaryotic TM domains to be shorter in length when compared to the length of eukaryotic TM domains 35. Therefore, we chose to use the DAS server over the TMHMM server when predicting TM domains in the prokaryotic protein sequences for E. coli PiTA and A. fulgidus putative phosphate permease. The predicted TM domains are shown in Additional File 1 Figure A.

The SPIDEY mRNA-to-genome DNA alignment program version 1.40 available from the NCBI homepage (URL: http://www.ncbi.nlm.nih.gov/spidey/index.html) 36 was used to determine the location of intron-exon borders in the human PiT genes. SPIDEY takes as input an mRNA sequence and the corresponding genomic sequence, and it generates an alignment that establishes the gene structure. The GenBank mRNA sequences were retrieved from the NCBI nucleotide server (http://www.ncbi.nlm.nih.gov/nuccore/). Accession numbers are: H. sapiens PiT1 mRNA [GenBank:NM_005415] and H. sapiens PiT2 mRNA [GenBank:NM_006749]. The genomic GenBank sequences were retrieved from the NCBI human genome server (http://www.ncbi.nlm.nih.gov/projects/genome/guide/human/). Accession numbers are: H. sapiens chromosome 2 (SLC20A1) [GenBank:NC_000002] and H. sapiens chromosome 8 (SLC20A2) [GenBank:NC_000008]. The intron-exon borders are shown in Additional File 1 Figure A on the protein sequence alignment of nine PiT family members.

The pcDNA1A^RtkpA-derived expression plasmids pOJ74 and pOJ75 (Wyeth-Ayerst Research, Pearl River N.Y., USA) encoding human PiT2 and PiT1, respectively, have been described 37.

The plasmid encoding the human PiT2 H₅₀₂A mutant was made by using the QuickChange^® XL site-directed mutagenesis kit (Stratagene, La Jolla CA, USA) according to the manufacturer's instructions. Besides the mutations creating H₅₀₂A, the forward primer 5'-TTCGGGTCCTTTGCTGCCGGCGGCAATGACGT-3' and reverse primer 5'-ACGTCATTGCCGCCGGCAGCAAAGGACCCGAA-3' also generated, by introduction of a silent mutation, an NgoM IV restriction enzyme cleavage site in pOJ74, which was used for screening. The plasmid encoding the human PiT1 E₇₀K mutant was made by using the Altered sites II kit (Promega, Madison WI, USA) according to the manufacturer's instructions. A mutation creating E₇₀K as well as a Dra I restriction enzyme cleavage site was introduced into a pAlter-1 vector (Promega) harboring the Pst 1 - Hind III fragment of pOJ75 (the nucleotide sequence encoding the N-terminal part of the human PiT1 protein) using the primer 5'-GACAGAGCCCACTGTTTTAAAGATGCTAGCTAG-3'. Finally, this construct was digested with Kpn I and Hind III generating a fragment, which was used to replace the corresponding fragment in pOJ75 resulting in the desired plasmid.

The plasmid encoding the human PiT2ΔL₁₈₃-V₄₈₃ mutant has previously been described 31. The plasmid encoding the human PiT2ΔR₂₅₄-V₄₈₃ mutant was made using a pAlter-1 vector harboring the Pst I - Hind III fragment of pOJ74 (the nucleotide sequence encoding the N-terminal part of the human PiT2 protein) as template in a polymerase chain reaction (PCR) with the forward primer 5'CTATAGGGAGACCCAAGCTTTGTTTATTTAA3' and the reverse primer 5'GAGGACCTGGAGGAAATGGAACAGGAGGTGTGATAAAGCACCTTCTTTTTG3'; the latter primer was used to create the link between the 5' sequence encoding KEGALS₂₅₃ and the 3' sequence encoding H₄₈₄LLFH (Figure 1). The amplification product was digested with Sse 8387 I and Hind III and used to replace the corresponding fragment in pOJ74 resulting in the desired plasmid.

The authenticities of all the nucleotide sequences were confirmed.

The plasmids were purified using either cesium chloride (CsCl) according to the protocol described by Maniatis and coworkers 38, or using Nucleobond (Macherey-Nagel, Düren, Germany) or Qiagen maxiprep (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions.

Chinese hamster ovary K1 cells, CHO K1 (ATCC CCL-61) and dog osteosarcoma cells, D17 (ATCC CCL-183), were cultivated as described 37; Mus dunni tail fibroblasts, MDTF (ATCC CCL-2017) were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 100IU per mL of penicillin (P), and 100 μg of streptomycin (S) per mL (D-MEM/FBS/PS). A-MLV (4070A isolate), 10A1 MLV, and Gibbon ape leukemia virus (GALV, SEATO) pseudotypes of the β-galactosidase-encoding transfer vector G1BgSvN 39 were obtained from the producer cell lines PA317GBN, PT67GBN, and PG13GBN, respectively 404142. PT67GBN was established as described 28. All packaging cells were cultivated in DMEM supplemented with 10% newborn calf serum (NCS) and PS (D-MEM/NCS/PS). Feline leukemia virus subgroup B (FeLV-B) vector pseudotypes carrying the G1BgSvN transfer vector were made essentially as described 43. Vectors were harvested as supernatants from confluent producer cells, and the vector containing supernatants were filtered (0.45-μm pore size) and stored at -80°C.

Transient transfection-infection assays were performed essentially as described 37. Briefly, CHO K1 cells seeded in 60-mm-diameter dishes at 8 × 10⁴ cells per dish were transfected with 2 μg per dish of plasmid DNA encoding human PiT2 (pOJ74), human PiT1 (pOJ75), human PiT2 H₅₀₂A, human PiT1 E₇₀K, or equimolar amounts to human PiT2 of human PiT2ΔR₂₅₄-V₄₈₃ or human PiT2ΔL₁₈₃-V₄₈₃. Mock treated cells were transfected with empty vector DNA (pcDNA1A^RtkpA). Three independent precipitates were made per construct. Forty-eight hours after transfection, approx. 4 to 8 × 10⁴ 10A1 MLV or A-MLV pseudotypes carrying the G1BgSvN transfer vector were added per dish in the presence of Polybrene. Forty-eight hours later, the dishes were stained and evaluated. Infection was analyzed by counting the number of β-galactosidase-positive (infected) cells per dish. Analyses for FeLV-B and GALV receptor functions were performed on MDTF cells using 1.5 × 10⁴ cells and approx. 1.5 to 3.0 × 10⁴ vector pseudotypes per dish. Numbers of vector pseudotypes used in the experiments were calculated from the number of β-galactosidase-positive colonies per mL obtained on D17 cells as described 37.

Female Xenopus laevis (X. laevis) frogs were obtained from Nasco (Nasco, Modesto CA, USA) and kept and handled according to guidelines from the Danish Animal Experiments Inspectorate. Oocytes were isolated from frogs anesthetized in a 0.1-0.2% MS.222 (3-aminobenzoic acid ethyl ester) (Sigma, St. Louis MO, USA) solution for 10-30 minutes. A 1-1.5 centimeters incision was made in the abdomen and several ovaries were removed surgically by authorized personnel. The oocytes were manually dissected and subsequently collagenase (Sigma, St. Louis MO, USA) treated and maintained in modified Barth's solution [88 mM NaCl, 1 mM KCl, 0.82 mM MgSO₄, 0.4 mM CaCl₂, 0.33 mM Ca(NO₃)₂, 2.4 mM NaHCO₃, 10 mM HEPES-KOH, pH 7.5, 100 IU per mL penicillin, 100 μg per mL streptomycin] at 18°C as described 28. The following day, the oocytes were used for cRNA injection and subsequent analyses of ³²P_i uptake essentially as described previously 28. Briefly, cRNAs were prepared from Apa 1 (Figure 3A) or Bln 1 (Figures 3B and 6) linearized plasmid preparations applying the mMESSAGE mMACHINE kit (Ambion, Austin TX, USA). Stage V-VI oocytes were microinjected with 12.5 ng of cRNA (or H₂O as negative control) and incubated at 18°C. After two to three days, the oocytes were washed in phosphate-free uptake solution [100 mM NaCl, 2 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, 10 mM HEPES-Tris pH 7.5], and hereafter incubated in uptake solution containing 0.1 mM KH₂³²PO₄ (2 mCi per mL, New England Nuclear, Boston MA, USA) at RT for 1 hour. The oocytes were washed in ice-cold uptake solution containing 5 mM KH₂PO₄ and the ³²P_i uptake of each oocyte measured in a liquid scintillation counter as described previously 28. It should be noted that factors coupled to the health and husbandry of the female X. laevis frogs can influence the oocyte batches. These factors include nutrition, season of the year (light cycle), water temperature, salinity and hardness of the water, water contaminants or toxins, and diseases 44, and the impact is that different batches of oocytes injected with cRNAs encoding the same proteins exhibit different average transport capacities.

The null hypothesis that two mean values are identical was tested by a two-tailed Student's t-test. The test compares the actual difference between two mean values in relation to the variation in the data (expressed as the standard error of the difference between the mean values). The null hypothesis was rejected, e.g., the mean values were considered different when P<0.05.

In a former study, we identified the putative 2^nd-TM domain-positioned human PiT2 E₅₅ as being critical for PiT2 P_i transport function (Figure 1) 28. The human PiT2 paralog, human PiT1, harbors a corresponding glutamate in position 70, E₇₀. To investigate whether this conserved residue was important for PiT1 P_i transport function, it was mutated to a lysine generating the mutant human PiT1 E₇₀K. In the experiment shown in Figure 3A, oocytes injected with cRNA encoding human PiT1 supported a ³²P_i uptake of 119.86 ±28.16 pmol/oocyte-hour at pH 7.5 in agreement with previous results obtained addressing the Na³²P_i uptake function of human PiT1 in X. laevis oocytes 45. The P_i transport function of human PiT1 E₇₀K was severely impaired when compared to that of wildtype PiT1 (P = 0.002, 2.78 ±0.74 pmol/oocyte-hour (PiT1 E₇₀K)) (Figure 3A); see Additional File 2 for data and statistics to Figure 3.

Besides being P_i-transporting proteins, the mammalian PiT proteins also serve as gamma-retroviral receptors, and this dual-function allows for analyzing whether a mutated PiT protein is properly processed, folded and translocated to the cell surface 1828. The human PiT1 E₇₀K mutant was therefore analyzed for gamma-retroviral receptor function using a transient transfection-infection assay 37. For the infection assay, retroviral vectors harboring a β-galactosidase encoding transfer vector and carrying viral surface proteins responsible for receptor recognition were used; vectors carrying, e.g., 10A1 MLV surface proteins are referred to as 10A1 MLV vector pseudotypes. Eukaryotic expression plasmids encoding human PiT1 and human PiT1 E₇₀K mutant protein were transfected into CHO K1 cells non-permissive for infection by 10A1 MLV vector pseudotypes (Figure 3C) 28. The abilities of these proteins to support infection by 10A1 MLV vector pseudotypes were analyzed; the infection levels were evaluated as the number of β-galactosidase positive (blue) cells per 60-mm-diameter dish. CHO K1 cells expressing human PiT1 were permissive for infection by 10A1 MLV vector pseudotypes (Figure 3C) in agreement with PiT1's well-described receptor function for 10A1 MLV 10. Moreover, the human PiT1 E₇₀K mutant supported wildtype PiT1 levels of 10A1 MLV infection (884 ±146 blue cells per dish (PiT1), 767 ±42 blue cells per dish (PiT1 E₇₀K), P = 0.48) (Figure 3C). Besides being a receptor for 10A1 MLV, PiT1 is also a receptor for GALV 7 and for FeLV-B 13. The human PiT1 E₇₀K protein was analyzed in parallel for receptor function for vector psedotypes of these two viruses in non-permissive Mus dunni tail fibroblasts and found to sustain wildtype PiT1 infection levels of GALV (2087 ±780 blue cells per dish (PiT1), 1992 ±273 blue cells per dish (PiT1 E₇₀K), P = 0.91) and FeLV-B (1424 ±346 blue cells per dish (PiT1), 1715 ±527 blue cells per dish (PiT1 E₇₀K), P = 0.67). The wildtype receptor functions of PiT1 E₇₀K confirm that the overall membrane topology is preserved and that the processing to the cell surface was unaffected by the E₇₀K-mutation.

The glutamate E₇₀ in human PiT1 is conserved in eukaryotic PiT family members as are the other two human PiT1 residues (S₁₂₈ and S₆₂₁) (Additional File 1 Figure A) previously shown to be critical for P_i transport function 29. Since the corresponding glutamate and serine residues in human PiT2 have already been identified as being critical for P_i transport function 2728, this demonstrate that equivalent glutamate or serine residues in the human PiT paralogs both are critical for their P_i transport functions. These observations illustrate that it is highly likely that the other conserved amino acids identified in human PiT2 as being critical for P_i transport function also are important for the transport function of human PiT1 and other PiT family members.

The histidine residue, human PiT2 H₅₀₂ is positioned in the 7^th TM domain according to the Johann topology model (Figure 1) 20. It is, moreover, located in the C-terminal PiT family signature sequence and conserved in eukaryotic PiT family members 18 (Additional File 1 Figure A). Moreover, analysis of 60 sequences of bacterial PiT family members revealed only 5 sequences without the histidine residue illustrating that this residue is also highly preserved in the C-terminal PiT family signature sequence of PiT family members belonging to this kingdom 18 (Additional File 1 Figure A). Since the conserved aspartic acid in the C-terminal PiT family signature sequence, that is human PiT2 D₅₀₆, is critical for P_i transport of PiT2 18, we hypothesized that other conserved amino acids in this motif might be critically involved in P_i transport function of human PiT2 and other members of the PiT family as well. Mutation of human PiT2 H₅₀₂ to alanine created the mutant denoted PiT2 H₅₀₂A. This mutant was analyzed for ³²P_i transport function in X. laevis oocytes (Figure 3B) and 10A1 MLV and A-MLV receptor functions in CHO K1 cells (Figures 3D-E).

In the experiment shown in Figure 3B, oocytes injected with cRNA encoding human PiT2 supported a ³²P_i uptake of 44.96 ±0.46 pmol/oocyte-hour at pH 7.5 in agreement with former studies addressing the Na³²P_i uptake function of human PiT2 in X. laevis oocytes 182845. The Pi transport function of human PiT2 H₅₀₂A was severely impaired when compared to that of wildtype PiT2 (P = 0.002, 2.36 ±0.56 pmol/oocyte-hour (PiT2 H₅₀₂A)) (Figure 3B).

To analyze whether the human PiT2 H₅₀₂A mutant is properly folded and processed to the cell surface, it was also analyzed for gamma-retroviral receptor function using the transient transfection-infection assay 37. Eukaryotic expression plasmids encoding human PiT2 and human PiT2 H₅₀₂A mutant protein were transfected into CHO K1 cells non-permissive for infection by A-MLV and 10A1 MLV vector pseudotypes (Figures 3D-E) 2837. CHO K1 cells expressing human PiT2 were permissive for infection by both A-MLV and 10A1 MLV vector pseudotypes (Figures 3D-E) in agreement with PiT2's well-described receptor function for A-MLV and 10A1 MLV 81037. Moreover, the human PiT2 H₅₀₂A mutant supported wildtype PiT2 levels of 10A1 MLV infection (63,940 ±8076 blue cells per dish (PiT2), 50,408 ±4005 blue cells per dish (PiT2 H₅₀₂A), P = 0.23) (Figure 3D) and A-MLV infection (13,624 ±862 blue cells per dish (PiT2), 12,235 ±1189 blue cells per dish (PiT2 H₅₀₂A), P = 0.48) (Figure 3E). These results demonstrate that the overall membrane topology of human PiT2 H₅₀₂A is preserved, and that the processing of human PiT2 H₅₀₂A to the membrane surface is unaffected by the mutation. Thus, histidine 502 in the 7^th TM domain is the second amino acid - besides D₅₀₆ - in the C-terminal PiT family signature sequence [HGANDVQNAIGP], which has been shown to be essential for human PiT2 P_i transport function. While the exact role of the histidine residue in the C-terminal signature sequence still needs to be revealed, its critical role for human PiT2 P_i transport function emphasizes the importance of the C-terminal PiT family signature sequence in the physiological function of the PiT proteins.

Besides human PiT1 E₇₀ and human PiT2 H₅₀₂, six conserved amino acids in human PiT2 and two corresponding positions in human PiT1 have previously been identified as being critical for P_i transport function 18272829. All these amino acids are located in the ProDom domains (PD001131) suggested in 2004 to define members of the PiT family (Figure 1) 27. Therefore it is likely that sequences outside these two domains might be dispensable for the P_i transport function of the PiT proteins, and that a minimal P_i-transporting unit of the PiT proteins can be identified.

A previously published alignment of human PiT1 and human PiT2 protein sequences shows that the L6 loop - the large intracellular domain - is the region where these sequences diverge the most 8 (Additional File 1 Figure A). Moreover, alignment of human PiT1 and N. crassa Pho-4⁺ shows that the large intracellular domain (L6) is smaller in Pho-4⁺, whereas the rest of the Pho-4⁺ protein sequence aligns well with the protein sequence of human PiT1 20 (Additional File 1 Figure A). To further address this, we counted the number of amino acids in the large intracellular domain (L6) of nine different PiT family members and plotted the lengths according to their phylogenetic relationship in Figure 4A. The figure shows that PiT family members from archaea and bacteria harbor the shortest L6 loops whereas the PiT-proteins from chordates harbor the longest L6 loops (Figure 4A, see also Additional File 1 Figure A). Note that the L6 loop of the C. elegans putative phosphate permease is unexpectedly short (73 amino acids), and according to the plot we would have expected a L6 loop length for this protein in the interval between 175 and 232 amino acids (Figure 4A). The observed differences in the L6 loop lengths of PiT family members from different species thus suggest that the L6 loop evolved from being a regular loop to become a regular domain during evolution. In order to address this issue, we counted the number of amino acids in all loops (L1 to L9) in the nine PiT family members and plotted the average loop lengths ±SEM in Figure 4B. The figure shows that the L6 loop in average is much larger than all other loops (L6: >131.7 ±32.8 amino acids, Figure 4B); see Additional File 2 for data to Figure 4B. The figure also shows that the variation in the L7 loop lengths is substantial (42.9 ±14.7 amino acids), see Figure 4B legend for discussion. Thus, with 95% confidence the longest regular loop is the L3 loop with a maximum length of 42 amino acids, see legend to Figure 4B for discussion. The definition of the maximum length of a loop also has the impact that the L7 of E. coli PiTA consisting of 160 amino acids (Additional File 1 Figure A) has to be considered a domain. In summary, analysis of the sizes of the loop sequences L1 to L9 in nine PiT family members from all kingdoms led to the determination of a limit of maximum 42 amino acids in a regular loop sequence - and sequences longer than 42 amino acids are highly likely domains. In support of our calculations of the maximum loop length for PiT-proteins is a previous study of 243 transmembrane domain-containing sequences, with 146 sequences being multi-transmembrane spanning, showing that ~90% of the loops are shorter than 40 amino acid residues 46. Another study supporting our finding is the analysis of loops in 79 existing 3D structures of transmembrane proteins showing that the majority of loops connecting transmembrane domains are shorter than 50 amino acid residues 47.

The proteins in Figure 4A with L6 loop sizes smaller than 42 amino acids are the archaeal putative phosphate permease and the bacterial PiTA protein, implying that single cell organisms without nuclei that rarely harbor membrane-bound organelles cope without the large intracellular domain, whereas single cell animals (protozoan's) with nuclei and membrane-bound organelles have distinct L6 domains as shown for the T. brucei putative phosphate permease (Figure 4A). Altogether this suggest a role(s) for the large intracellular domain, which is not directly related to P_i transport per se, and it also suggest that the large intracellular domain (L6) may have increased in length during the evolution from archaea to chordata as a consequence of adaptation to more complex environments.

Besides a difference in the lengths of L6, a difference in the number of TM domains in the PiT family members was observed (Additional File 1 Figures A and B). The illustration of TM domain conservedness (black boxes) and TM domains, which are suggested by us to be present but not predicted by protein sequence analysis using the TMHMM server (red boxes, see argumentation in legend to Additional File 1 Figure A), shows the following conservedness of TMs: TM 4, TM 8, TM 10 (fully conserved) > TM 5, TM 6 (fully conserved in eukaryotes) > TM 1, TM 2, TM 3 > TM 9 > TM 7 (least conserved) (Additional File 1 Figure B). The most prominent observation is that E. coli PiTA and A. fulgidus putative phosphate permease both lack the 5^th and 6^th TM domains (Additional File 1 Figures A and B). This in addition to the previous observation that these two proteins also lack the L6 domain (Figure 4A), suggest that the 5^th and 6^th TM domains and the L6 domain are dispensable for P_i transport function, and that a basic P_i-transporting unit of the PiT family members can be identified. This unit would consist of regions flanking the large intracellular domain (L6) but highly likely also be devoid of the 5^th and 6^th TM domains. Interestingly, in support of this theory, drawing of the putative topology models for human PiT2, E. coli PiTA, and A. fulgidus putative phosphate permease based on the alignment in Additional File 1 Figure A, shows that the bacterial and archaeal proteins have a predicted eight TM backbone where the N-terminal PiT-family signature sequence is placed in the 1^st extracellular loop (L1) and the C-terminal PiT family signature sequence is placed in the 3^rd extracellular loop (L7) (Figure 5). In comparison, the drawing of the putative topology model for human PiT2 shows a backbone of 10 TM domains where the N-terminal and C-terminal PiT-family signature sequences are placed in the 1^st extracellular loop (L1) and the 4^th extracellular loop (L7), respectively (Figure 5). An interpretation of these drawings could be that the intra-protein locations of the N-terminal and C-terminal PiT-family signature sequences are of importance, and that TM 1 to TM 4 and TM 7 to TM 10 constitute a core sustaining the P_i-transporting function whereas TM 5 and TM 6 and the large intracellular domain (L6) constitute a regulatory unit. Finally, the amino acids identified as being critical for P_i transport function are located in the ProDom domains suggested in 2004 (TM 1 to TM 4 and TM 7 to TM 10) 27 (Figure 1) in agreement with the 5^th and 6^th TM domains and the large intracellular domain (L6) might be dispensable for the P_i transport function.

To identify the minimal P_i-transporting unit, two human PiT2 truncation mutants were analyzed. They were designed to address the P_i transport function and the gamma-retroviral receptor functions of: 1) A human PiT2 mutant protein, which consists of the 10 TM domains and a L6 loop of 18 amino acids (human PiT2 P₂₃₆-S₂₅₃) creating the mutant human PiT2ΔR₂₅₄-V₄₈₃. The human PiT2ΔR₂₅₄-V₄₈₃ mutant does not resemble a naturally occurring homolog found in lower species, and it is merely designed to address if the large intracellular domain is dispensable for Na⁺-dependent P_i-uptake (Figure 1), and 2) A human PiT2 mutant protein that resembles an archaeal and bacterial homolog with respect to protein composition, i.e., lacking the 5^th and 6^th TM domains and the large intracellular domain (L₁₈₃-V₄₈₃) (human PiT2ΔL₁₈₃-V₄₈₃) (Figure 1). Note that in the Salaün model the 5^th and 6^th TM domains correspond to TMVI and TMVII (Figure 2).

The Na⁺-dependent ³²P_i transport function of wildtype human PiT2 and the human PiT2-derived truncation mutants PiT2ΔL₁₈₃-V₄₈₃ and PiT2ΔR₂₅₄-V₄₈₃ (Figure 1) were analyzed in X. laevis oocytes (Figure 6).

Oocytes injected with cRNA encoding human PiT2 supported a ³²P_i uptake of 79.61 ±17.74 pmol/oocyte-hour (Figure 6A) and 44.96 ±0.46 pmol/oocyte-hour (Figure 6B) at pH 7.5 in agreement with previous results 182845.

The ³²P_i transport activities of the PiT2 mutant lacking the major part of the large intracellular domain, human PiT2ΔR₂₅₄-V₄₈₃, (47.38 ±6.59 pmol/oocyte-hour (Figure 6A) and 38.74 ±3.73 pmol/oocyte-hour (Figure 6B)) were indistinguishable from those of PiT2 (P = 0.119) (Figure 6A) and P = 0.553 (Figure 6B)); see Additional File 2 for data and statistics to Figure 6. Thus, the large intracellular domain of human PiT2 but 18 amino acids (fragment R₂₅₄-V₄₈₃) is dispensable for its P_i transport function.

The ³²P_i transport activity of the human PiT2 mutant lacking the large intracellular domain as well as the 5^th and 6^th TM domains, PiT2ΔL₁₈₃-V₄₈₃ (Figure 1), was severely impaired (3.93 ±0.44 pmol/oocyte-hour (Figure 6A) and 8.33 ±2.85 pmol/oocyte-hour (Figure 6B)) when compared to the P_i transport function of wildtype PiT2 (P = 0.003 (Figure 6A) and P = 0.004 (Figure 6B)). However, interestingly the mutant did support low levels of P_i uptake significantly different from H₂O-injected oocytes (2.56 ±0.24 pmol/oocyte-hour (Figure 6A) and 3.24 ±0.17 pmol/oocyte-hour (Figure 6B)) (P = 0.011 (Figure 6A) and P = 0.008 (Figure 6B)).

Using the transient transfection-infection assay, we analyzed whether the deletions in human PiT2 affected their viral receptor functions for A-MLV and 10A1 MLV. Eukaryotic expression plasmids encoding human PiT2 and the mutant proteins were transfected into CHO K1 cells. As expected, human PiT2 transfected cells were permissive for infection by both 10A1 MLV and A-MLV vector pseudotypes (Table 1). While the human PiT2 truncation mutant lacking the large intracellular domain, human PiT2ΔR₂₅₄-V₄₈₃ (Figure 1) was a fully functional P_i transporter (Figure 6), it only supported low levels of PiT2 cognate gamma-retroviral infection (Table 1). Note that human PiT2ΔR₂₅₄-V₄₈₃ was tested once for A-MLV receptor function and twice for 10A1 MLV receptor function. The A-MLV study was done in parallel to a 10A1 MLV receptor function study using the same set of plasmid precipitates. Interestingly, the human PiT2 truncation mutant lacking the 5^th and 6^th TM domains in addition to the large intracellular domain, human PiT2ΔL₁₈₃-V₄₈₃ (Figure 1), supported substantial levels of PiT2 cognate gamma-retroviral infection (Table 1) 31 showing that its low levels of P_i transport function were not due to incorrect processing of this mutant to the cell surface.

PiT2 regions directly involved in receptor function for 10A1 MLV and A-MLV have also been identified by expression of chimeric proteins in CHO K1 cells and were found to be located in the putative extracellular loops 2 (L3) and 4 (L7) (Figure 1) 26374849. Both of the human PiT2 mutants, PiT2ΔR₂₅₄-V₄₈₃ and PiT2ΔL₁₈₃-V₄₈₃, harbor extracellular loops 2 (L3) and 4 (L7) according to the Johann PiT2 model (Figure 1). Based on their - here identified - P_i transport abilities, it is unlikely that PiT2ΔR₂₅₄-V₄₈₃ is less expressed at the cell surface than PiT2ΔL₁₈₃-V₄₈₃, and the observation that the less truncated human PiT2 mutant protein is a worse gamma-retroviral receptor than a more heavily truncated human PiT2 mutant protein might instead reflect a disturbance of the folding and/or conformation of the extracellular loops 2 (L3) and 4 (L7) due to the sole presence of the extracellular loop 3 (L5) without the large intracellular domain in PiT2ΔR₂₅₄-V₄₈₃.

The human PiT proteins are encoded by genes that localize to different chromosomes. The human gene, SLC20A1, encoding the PiT1 protein is located on chromosome 2 at position q13 5051, and the human gene, SLC20A2, encoding the PiT2 protein is located on chromosome 8 at position p11.2 85253.

To analyze the gene structure of SLC20A1 and SLC20A2, the intron-exon borders in each of the genes were determined using the SPIDEY mRNA-to-genome DNA alignment as described in "Methods". The intron-exon borders are marked with stars (✰) and vertical lines in the PiT1 and PiT2 protein sequences in the alignment of nine PiT family members in Additional File 1 Figure A.

Eight out of nine intron-exon borders (labeled ✰ a to e and ✰ g to i on PiT1 and PiT2 in Additional File 1 Figure A) in SLC20A1 and SLC20A2 are predicted to be homologous. One intron-exon border (labeled ✰ f¹ (SLC20A2) and f² (SLC20A1)) are displaced giving a gap corresponding to 12 amino acids (~36 nucleotides). These two borders are placed in the middle of the genome sequences, which encode the large intracellular domain (L6) of the human PiT proteins. As seen from Additional File 1 Figure A, the alignment between the human PiT proteins in this region is poor and the gap highly likely reflects this, and not a significant difference in intron-exon structure between SLC20A1 and SLC20A2.

Interestingly, in support of the theory that the 5^th and 6^th TM domains can be dispensable for P_i transport function, is the observation that these TM domains are encoded by two different exons, see Additional File 1 Figure A (✰ labeled c to d, and ✰ labeled d to e), and therefore the possibility exists that the sequences in these two exons have entered later in evolution.

Mammalian PiT proteins are expressed in all tissues investigated and due to their broad expression profiles, they have been suggested to accommodate house-keeping functions, i.e., supplying cells with P_i to maintain basic cellular functions 22054. However, in recent years additional specialized functions of the PiT proteins have been reported. These include roles for PiT2 in proximal tubule phosphate reabsorption 55, and for PiT1 in regulation of parathyroid gland PTH production 5657, cell proliferation 295859, and in tumor necrosis factor (TNF) induced apoptosis 60. Recent studies also indicate that both the PiT proteins function as P_i sensors 2756, reviewed in 61. Interestingly, some of these functions, that is, PiT2's suggested role in P_i sensing 27 and PiT1's role in cell proliferation and TNF-induced apoptosis 295960 have been shown to be independent of the P_i transport functions of the proteins.

PiT1 has also been implicated in normal chondroblastic and osteoblastic differentiation and mineralization processes 6263646566, as well as trans-differentiation of vascular smooth muscle cells to cells with characteristics of chondro-/osteoblasts in the pathologic process of vascular calcification at hyperphosphatemia 67. More rodent in vivo models have been used to study the role of PiT1 in normal bone formation and/or embryonic development. Rats with transgenic overexpression of PiT1 showed no major bone deformity during skeletal development 57. However, these rats displayed a slight but significant decrease in the bone mineral content of the whole skeleton together with a reduction albeit non-significant in the total bone area 57. The role of PiT1 during embryonic mouse development has been studied by two different groups employing early conditional excision of SLC20A1 Exons 3-4 68 and SLC20A1 Exon 5 59, which resulted in homozygous embryonic lethality. Both studies find that the embryos are anemic and do not survive past E12.5, at which stage the morphology shows reduced growth 5968; the anemia was found to be due to severe defects in liver development 59. Comparison of wildtype mice to mice with low (15%) expression of PiT1 mRNA showed that some of the latter mice displayed impaired bone mineralization at birth, while 15-days old mice showed no major differences in mineralization 59. Interestingly, in embryos (E11.5) lacking PiT1 expression Beck and coworkers found an upregulated PiT2 expression, which however could not rescue the embryos past E12.5, and the authors therefore suggest that the critical non-redundant role of PiT1 in development is not P_i-uptake 59. Altogether, the in vivo studies do not exclude a role for PiT1 in normal bone formation, although they imply that PiT1 is not critical for the early skeletal developmental processes.

The alignment and analyses of exon structure together with the observed P_i transport functions of the PiT2 deletion mutants presented here might suggest that the regions of the PiT proteins involved in the P_i-transport independent functions map to sequences in the 5^th and 6^th TM domains and/or in the large intracellular domain. In line with this, we are currently investigating the function of the large intracellular domain of the human PiT2 protein and our results support the hypothesis that the large intracellular domain has other functions than P_i transport.