Table 4

Guinea pig reference and target gene information
Gene symbol Name Primer sequences 5’ to 3’ Exons Amplicon size (bp) Function Ensembl or GenBank accession no.
Sense and antisense
ACTB β-Actin tgcgttacaccctttcttgaca 5 73 Cytoskeletal protein From ref. [31]
acaaagccatgccaatctcat
ATP5B ATP synthase, F1 complex β subunit gatcaatttaaaagatgctacctcgaa 5 and 6 68 ATP synthesis DQ403103
caccaggcggttcattcatt
ATP6 Adenosine triphosphatase 6 cccactatgagcagcaactgtaa 1 67 ATP metabolism NC_000884
gaagtgggctagggatgcttt
B2M β2-Microglobulin tggtgcatgctgcctttaca 2 64 Cell surface molecule component NM_001172856
gtgatgtgtgaaactctgcaagaa
CFL1 Cofilin 1 ttccaaggatgccatcaaaaa 3 and 4 65 Actin modification ENSCPOT00000008138
cgtagcaatttgcctgtaattcg
CLTC Clathrin caattcgttttcaggagcatctc 1 and 2 64 Coated vesicle formation protein ENSCPOT00000005567
aagccaatgtttgctgggtta
CTBP1 C-terminal binding protein 1 tctcatcaacgacttcactgtcaa 4 and 5 61 Transcriptional repressor phosphoprotein ENSCPOT00000019529
ggccgtgttcaccaggaa
GAPDH Glyceraldehyde-3-phosphate dehydrogenase tcagagggctccctcaaag 2 70 Glycolytic enzyme From ref. [30]
cgctgttgaagtcacaggac
HMBS Hydroxymethyl-bilane synthase cctgggttggcagaacaga 9 and 10 66 Heme biosynthesis ENSCPOT00000006534
tggcccacagcatacatacag
PPIB Cyclophilin B gggcctaaagtcaccgtcaa 1 and 2 63 Protein folding catalyst ENSCPOT00000000258
ccggcccacatcttcatct
RPLP0 Ribosomal protein, large, P0 atgctgctggccaataaggt 3 and 4 64 Protein synthesis ENSCPOT00000019555
tgacttcacatggtgcaatgg
SDHA Succinate dehydrogenase, subunit A gatgccatccattacatgacaga 4 and 5 67 Citric acid cycle enzyme DQ402978
gcatgccataattttctagctcaa
TBP TATA-binding protein acttgacctaaagacaattgcacttc 5 and 6 65 Transcription factor ENSCPOT00000001200
cagcaaaccgcttgggatta
TFRC Transferrin receptor gaccttccagtcttcggtcatg 8 and 9 68 Iron transport S81327
aaagaagggaacccaggtgtataa
TPT1 Tumor protein, translationally controlled 1 ccttgctaatttcaaaaactatcagttc 4 and 5 67 EU330893
agcaaccatgccatctggat
PTGS2 Cyclooxygenase-2 ctgcgcaatgcaatcatga 3 and 4 67 Prostaglandin synthesis Y07896
agttggtggactgtcgatcaga

Lindqvist et al.

Lindqvist et al. BMC Research Notes 2013 6:34   doi:10.1186/1756-0500-6-34

Open Data