Table 1

Primer and probe sequences for qPCR used in the present study
Gene GenBank # Primer forward 5'-3' Primer reverse 5'-3' Hydrolysis probe 5'-3' Amplicon size (bp)* Reference
EF1AA AF321836 CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA 6-FAM-ATCGGTGGTATTGGAAC-MGB 57 [34]
HSP70 BG933934 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT 6-FAM-CGCTGGAGGTGTCATG-MGB 121 [52]
GR BG934480 CCAGTGATGGCTTTTTTGAACTT CCGGCCCCCACTATGAC 6-FAM-AGCCTTCCTAAGCGCAG-MGB 61 [52]
Cu/Zn SOD BG936553 CCACGTCCATGCCTTTGG TCAGCTGCTGCAGTCACGTT 6-FAM-ACAACACCAACGGCT-MGB 140 [55]
Mn SOD DY718412 GTTTCTCTCCAGCCTGCTCTAAG CCGCTCTCCTTGTCGAAGC 6-FAM-CACATCAACCACACCATCTTCTGGACAAAC-TAMRA 209 [53]
GP BG934453 GATTCGTTCCAAACTTCCTGCTA GCTCCCAGAACAGCCTGTTG 6-FAM-TGAATGGAGACACAGAAC-MGB 140 [55]
IGF-1 M81904 GTGTGCGGAGAGAGAGGCTTT TGTGACCGCCGTGAACTG 6-FAM-TTTCAGTAAACCAACGGGCTATGG-TAMRA 68 [54]
IGF-1R AY049954 TGAAGAGCCACCTGAGGTCACT TCAGAGGTGGGAGGTTGAGACT 6-FAM-CGGGCTAAAGACCCGTCCCAGTCC-TAMRA 72 [54]

*bp = base pair.

Solberg et al.

Solberg et al. BMC Research Notes 2012 5:672   doi:10.1186/1756-0500-5-672

Open Data