Table 1

Primer pairs used to amplify the 3 target genes tilled in both EMS-mutant populations

Gene

Forward (*LabelledIRD700)

Reverse (*LabelledIRD800)


Cm-eIF4E

1st amplicon

GACTCAAACGCCTAACAGAAAATC

CTATCTCACCAAGTTTCCTAAATT


*GAGGGCGGTGCCATTCTTCTTCGG

*TCCCTAAATCGAACCAAGAAACGCC


Cm-eIF4E

2nd amplicon

TTGTTTCGTGTTGACATGTCCATC

AGCATGCATTTCACCTCATTGGCT


*TGCTTGGCTGTTAATTTATCTCTGC

*GTCAAGTACAGAACAAGAATCTGAG


Cm-eIF(iso)4E

GATCGATAATTTCCCTTTTC

TGACAGGCTTAAGCACTATG


*ACCCCAATTCATTCTAGGG

*TGTGCAAGCGCAACAAGGTAC


Cm-PDS

CAATGGGATGCTTAGATCAAC

TCCTTCCAAAATTACCCTAG


*GGATTTCTCGGAGTGACTCGG

*GCTCTCGAGCAACTAGCACT


Nested PCR was used in all cases with labeled primers in the second PCR.

Gonz├ílez et al. BMC Research Notes 2011 4:289   doi:10.1186/1756-0500-4-289

Open Data