Email updates

Keep up to date with the latest news and content from BMC Research Notes and BioMed Central.

Open Access Highly Accessed Short Report

Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua

Pål A Olsvik*, Liv Søfteland and Kai K Lie

BMC Research Notes 2008, 1:47  doi:10.1186/1756-0500-1-47

PubMed Commons is an experimental system of commenting on PubMed abstracts, introduced in October 2013. Comments are displayed on the abstract page, but during the initial closed pilot, only registered users can read or post comments. Any researcher who is listed as an author of an article indexed by PubMed is entitled to participate in the pilot. If you would like to participate and need an invitation, please email info@biomedcentral.com, giving the PubMed ID of an article on which you are an author. For more information, see the PubMed Commons FAQ.

Wrong accession number for EF1A

Pal A. Olsvik   (2013-03-08 16:46)  NIFES email

Due to a copy-paste error, the wrong accession number and primer sequences were provided for the EF1A assay in Table 2.

The correct GenBank accession number is: EX722124
Forward primer: CGGTATCCTCAAGCCCAACA
Reverse primer: GTCAGAGACTCGTGGTGCATCT

Competing interests

No

top

Post a comment