Table 2

Primer and probe sequences for TaqMan® Custom CN assays
CNVchr7_CCHSNR9 Sequence hg18 hg19
Forward primer TTCTAGTTTTTAGCAGAAAGTATTTCCTTCTTCA 61,860,925 62,223,490
Reverse primer TTTCATTCAGCTGTTTGGAAACACTATTTT 61,861,034 62,223,599
FAM-dye labelled probe CATAGGCCTCAATGCGCTCCCAA 61,860,960 62,223,525
CNVchr16_CCD1S9P Sequence hg18 hg19
Forward primer CTCCCAAATGTCCATTCACCAAAT 32,453,256 32,545,755
Reverse primer TTTCTTATGTGTGCATTATTCTCACAGA 32,453,355 32,545,854
FAM-dye labelled probe ACCTTTCCTTTGATTCAGCAGTTTT 32,453,299 32,545,798

Talseth-Palmer et al.

Talseth-Palmer et al. BMC Medical Genomics 2013 6:10   doi:10.1186/1755-8794-6-10

Open Data