Table 4

Primers of genes in Real-time PCR assay
Gene Forward primer Backward primer Size (bp)
GAPDH GGTCGTATTGGGCGCCTGGTC TGACGGTGCCATGGAATTTGCCA 148
KIFC1 TCTCTGGGTGGTAGTGCTAAGA TAAGTCACTTCCTGTTGGCCTG 148
SOX4 GACCGGGACCTGGATTTTAACT TGAAAACCAGGTTGGAGATGCT 133
PBX2 AAGTTCCAAGAGGAGGCAAACA TCCTGAGAGATTGAAAGAGCCG 132
ESRRG GCTATCCTGCAGCTGGTAAAGA GCTATCCTGCAGCTGGTAAAGA 133
KDM5B CCCTCAGACACATCCTATTCCG CAGTCCACCTCATCTCCTTCTG 101
PTGS2 TGTATCCTGCCCTTCTGGTAGA AAGGAGAATGGTGCTCCAACTT 85
EFNA1 GTGGCAAAATCACTCACAGTCC CTATGTAGAACCCGCACCTCTG 91
BCL2 AGGATTGTGGCCTTCTTTGAGT CGGTTCAGGTACTCAGTCATCC 113
SMAD4 TGTTGATGACCTTCGTCGCTTA ATGCTCTGTCTTGGGTAATCCG 81
PHACTR3 TATGACAGGAGGGCAGACAAAC GCTTGCTTGATGCATGTACCTC 118
C13orf27 TCAGGCTCAGCAGATGAAATGT TCCAGTGGATTTTATGGGGAGC 85
PMEPA CTGAGCCACTACAAGCTGTCTG CTTCTGAGGACAGGGCATCTTC 85
OXGR1 ATCTTGAGGGTCATTCGGATCG TGTCGCTGACCACCACATATAG 148
GPNMB GTCACTGTGATCTCCCTCTTGG TTTGCACGGTTGAGAAAGACAC 116

Shi et al.

Shi et al. BMC Medical Genomics 2012 5:52   doi:10.1186/1755-8794-5-52

Open Data