Table 1

Sequences of the primers used for Q-PCR analysis
Gene Sequence forward primer Sequence reverse primer
INFγ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC
IF44 AACTGACTGCTCGCAATAATGT GTAACACAGCAATGCCTCTTGT
IF47 AGCAGATGAATCCGCTGATGT CGTGGAAATTGGGTGTCCC
TNFα CAACCTCCTCTCTGCCGTCAA CGTGGAAATTGGGTGTCCC
IL1β TGGTGTGTGACGTTCCCATT CAGCACGAGGCTTTTTGTTG
IL6 CTTCCATCCAGTTGCCTTCTTG AATTAAGCCTCCGACTTGTGAAG
Cubn GAATGTGGCTCCAAGTCCCAT ACGGCTAATGAAGGATGCAGA
36B4 AGCGCGTCCTGGCATTGTGTGG GGGCAGCAGTGGTGGCAGCAGC

Steegenga et al.

Steegenga et al. BMC Medical Genomics 2012 5:38   doi:10.1186/1755-8794-5-38

Open Data