Table 1

List of the primers used for RT-qPCR
Genes Primers Sequences 5'- > 3' Length Tm %GC
Mcptl Fwd TTCTGGACGCGGAAATGC 18 59 56
Rev CTGTTAATCCAGGGCACATGTG 22 59 50
Runx1 Fwd GCCATTTTGGGTCTGCTTTC 20 58 50
Rev TTGTCTGCGCAGGACGTTT 19 59 53
Plcb2 Fwd ACCGCATTGATGTGGTGGTA 20 58 50
Rev TGCGTACACTGCGCTCTGA 19 59 58
Ccdc130 Fwd GGTGAAAGGAAAGGCCAGAAC 21 59 52
Rev ATCGGTTGAGAGAGCCATGCT 21 60 52
Chfr Fwd AAGGAAGCCATGCCATATGC 20 59 50
Rev GGATCCTGCTCCCGTTCA 18 58 61
Ints1 Fwd GGACTGCCTGCGATCCTTTA 20 59 55
Rev GCCCACGTACTTGTGGATGA 20 58 55
Pip4k2b Fwd CCGATTCTCAGCGTCCTGAT 20 59 55
Rev CATCCGGCATTAGCATGACA 20 59 50
Isg20l2 Fwd CCAGGGAGACACATGCAGTAGAC 23 60 57
Rev CCTCTCCCCAGTGATTCTAGCTT 23 59 52
Ckm Fwd GCTGACCCCTGACCTCTACAATA 23 58 52
Rev CACCCCAGTCTGGATGACATC 21 59 57
Eno3 Fwd GCAATTGCCTGCTCCTGAAG 20 60 55
Rev GTGCAAGTTTACAGGCCTGGAT 22 59 50
Serpinb2 Fwd CAGGCACAAGCAGGAGATAAAA 22 58 45
Rev CCCCTGTGGTGTGTTGATTG 20 58 55
Hspb7 Fwd AGCTGATGGCACAGTCATGAAC 22 59 50
Rev GCCGAGGTCACCGATGTT 18 58 61
Chac1 Fwd GGTCATTGCCACACAGATCCT 21 58 52
Rev CTGCCAAACGCAATAAGTACTCA 23 58 43
Nrap Fwd GCTTTCTGTTAATAACTTCGTGAGTCA 27 58 37
Rev GACGCTAGTGAACGTGTTGTTCTT 24 59 46
Zp2 Fwd TGACTGCTGGGCAACTTCTTC 21 59 52
Rev TCACAGCCATCCATGACAATCT 22 59 45
Atp1a2 Fwd CATAAGGCTCAGGAGTCACAGAAG 24 58 50
Rev CACAGGGAGAAGTGGCAGCTA 21 59 57
Ctsd Fwd GGCGTCTTGCTGCTCATTCT 20 59 55
Rev ACTTGCGCAGAGGGATTCTG 20 59 55
Socs3 Fwd GCCACCTGGACTCCTATGAGAA 22 59 55
Rev GGAGCATCATACTGATCCAGGAA 23 59 48
Cish2 (endogenous Fwd TCCAGATGTGCAAGGATAAACG 22 59 45
gene) Rev GGTTTGGTCAGGTACAGGTGAAC 23 58 52
Erk1 Fwd CCTGCTGGACCGGATGTTA 19 58 58
Rev TGAGCCAGCGCTTCCTCTA 19 58 58
Epor Fwd TTGGTGTGTTTCTGGGAGGAA 21 59 48
Rev ACCCTCGAGCTGGTATGAGAAG 22 58 55
Hif1a Fwd TGCATCTCCATCTTCTACCCAAGT 24 60 46
Rev CCGACTGTGAGTGCCACTGTAT 22 59 55
Vegf Fwd GCAGGCTGCTGTAACGATGA 20 59 55
Rev CATGATCTGCATGGTGATGTTG 22 58 45

Mille-Hamard et al.

Mille-Hamard et al. BMC Medical Genomics 2012 5:29   doi:10.1186/1755-8794-5-29

Open Data