Table 1

Primer sequences of the diagnostic genes

Gene Symbol

Forward

Reverse


IGFBP2

GCACATCCCCAACTGTGACA

TTCAGAGACATCTTGCACTGTTTG

VMP1

TGTCTTCTGTTGGGCTTGGAA

TGAGGCTATATGTGGACCCAGATA

MSN

GCCCCGGACTTCGTCTTC

AGGCCAAGATCCGCTTGTTA

TIMP1

CACAGACGGCCTTCTGCAAT

TGGTGTCCCCACGAACTTG

LGALS1

CTCCTGACGCTAAGAGCTTCGT

GAAGTGCAGGCACAGGTTGTT

CD63

CCCGAAAAACAACCACACTGC

GATGAGGAGGCTGAGGAGACC

NES

CAACAGCGACGGAGGTCTC

CCTCTACGCTCTCTTCTTTGAGT

CLIC1

TGTTCATGGTACTGTGGCTCAAG

GTCCGCCTTTTGGTGTCAAC

TNC

ACCACAATGGCAGATCCTTC

GCCTGCCTTCAAGATTTCTG

TAGLN2

CCTCTGGGAAGGAAAGAACATG

AGCCCACCCAGATTCATCAG

HES6

GACCAATGCCAGCCAGAG

GCAAGCCATCCATCAGAGG

VEGF

CCAAGGCCAGCACATAGGA

TCTTTGGTCTGCATTCACATTTG

VIM

TCCAAACTTTTCCTCCCTGAAC

GGGTATCAACCAGAGGGAGTGA

LDHA

CTGGGAGTTCACCCATTAAGCT

CAGGCACACTGGAATCTCCAT

RPIP8

CCCCCGTGGTCATCGA

GGTAGTCGTAGCTCTGCGTGAA

IFITM3

GGCTTCATAGCATTCGCCTACT

TCACGTCGCCAACCATCTT

PPIB

GGAGAGAAAGGATTTGGCTACAAA

CCTGGATCATGAAGTCCTTGATT

ALDOC

CGTCCGAACCATCCAGGAT

CCACACCCTTGTCAACCTTGAT

ZYX

CAGCAGCTAATGCAGGACATG

CAGAGTTCGTTGACAGCCACAT

UPAR

GTGTGTGGGTTAGACTTGTGCAA

AGGTAACGGCTTCGGGAATAG

LAMB2

CCACTGAAGGCGAGGTCATC

CCCGTAGGTTGGTGATCTTCAA

RTN1

CCGCATCTACAAGTCTGTTTTACAA

AAGCTCCAAGTAGGCCTTGAAAG

HMOX1

GGCAGAGAATGCTGAGTTCATG

AGGCCATCACCAGCTTGAAG

GM2A

GTCCCCCTGAGTTCTCCTCT

GCTCTTGGGCAGTGAGTAGG

S100A10

TGGAAAAGGAGTTCCCTGGAT

TACACTGGTCCAGGTCCTTCATT

BRSK2

GGAGGAGATGTCCAACCTGACA

AAGTTCCCAAACCAGGACTTCTT

MRCL3

AACAGAGATGGTTTCATCGACAAG

GTTGGATTCTTCCCCAATGAAG

GPX1

GCGGGGCAAGGTACTACTTA

CTCTTCGTTCTTGGCGTTCT

SOD2

AATCAGGATCCACTGCAAGGA

CGTGCTCCCACACATCAATC

RHOC

AATAAGAAGGACCTGAGGCAAGAC

ACGGGCTCCTGCTTCATCT

UBL5

AGCTGATTGCAGCCCAAACT

TCGTGTACCACTTCTTCAGGACAA


Kawarazaki et al. BMC Medical Genomics 2010 3:52   doi:10.1186/1755-8794-3-52

Open Data