Table 1

PCR Primers used for semi-quantitative real time PCR validation.

Systematic Name

Gene Name

Primer Sequence (5'→3')


NM_005185.2

CALML3

Fwd: AGGCCTTCTCCCTGTTTGAC

Rev: CCGGTCGATCTCACTCATC

NM_018403.4

DCP1A

Fwd: AGCATCACCAGCAGATCCTT

Rev: TATTCCACAGCCTTGCTCCT

NM_145301.2

FAM18B2

Fwd: AAGAGCCATTGGGTGTTTGA

Rev: AGGCAATAAGTCCCAACCAA

NM_005336.3

HDLBP

Fwd: CAGGACCTGCTCCACTGTTT

Rev: AGGCCAGAGTGCTGACTGAC

XR_038543.2

LOC644604

Fwd: TGCCTGGGTCTTGGATAAAC

Rev: GGGCATCAACGATAGTCACA

NM_018222.3

PARVA

Fwd: TTTGAGCTCATGCAAGATGG

Rev: CGGTACTTGGTGAAGAGGTTG

NM_001135771.1

RPN2

Fwd: GCTTCTGCTCTTCGCTCTGT

Rev: CCAGCATAGCAGCATGTCC

NM_003133.5

SRP9

Fwd: CAGACCTGGGAGGAGTTCAG

Rev: CACAAGTTCCCATCAGAATGC

NM_006082.2

TUBA1B

Fwd: ACGTGGTTCCCAAAGATGTC

Rev: CACAGTGGGAGGCTGGTAGT


NM_002046.3

GAPDH

Fwd: CCACATCGCTCAGACACCAT

Rev: CCAGGCGCCCAATACG

NM_000194.1

HPRT1

Fwd: TGACACTGGCAAAACAATGCA

Rev: GGTCCTTTTCACCAGCAAGCT

NM_003406.2

YWHAZ

Fwd: ACTTTTGGTACATTGTGGCTTCAA

Rev: CCGCCAGGACAAACCAGTAT


Opitz et al. BMC Medical Genomics 2010 3:36   doi:10.1186/1755-8794-3-36

Open Data