Table 5

The primers designed for end point PCR analysis of DYZ1 repeat region.

Primer

Sequence

Location

Orientation

Tm(°C)


DYZ1A

TTTCCTTTCGCTTGCATTCCAT

25-47

5'-3'

65


DYZ1B

TTTTGAGTCCGTTCCATAACAC

1347-1367

5'-3'

64


DYZ1C

GAGTCCATTCACTTCCAGAACA

3128-3149

5'-3'

63


DYZ1D

CCATGCCATTTTATTGCGTTGC

1791-1821

5'-3'

63


DYZ1E

GACTGGAAAGGCTGGGTGTCGA

3380-3402

3'-5'

63


DYZ1F

TGAAATGGACTGGAAAGGAATG

268-290

3'-5'

64


DYZ1G

TGGAATGGACTGCAATAGAAAG

1566-1588

3'-5'

64


DYZ1H

TGGAATGGACTCGAACAGAGTG

2097-2119

3'-5'

64


Ali and Ali BMC Medical Genomics 2010 3:35   doi:10.1186/1755-8794-3-35

Open Data