Table 2

Sequences of primers for real-time RT-PCR assays.

sense

antisense



Genes selected for validation in CD34+ cells


MY5OC

5'CGTGGCAGAAGAGGCATACA3'

5'AGCGAGCCGACACTGTCTTT3'

GCDH_ncRNA

5'aaggagctttgggtttttgt3'

5'cgccttagtgacagtctccag3'

HCK

5'GAGTTCATGGCCAAAGGAAG3'

5'GGAGGTCTCGGTGGATGTAG3'

PPIF_ncRNA

5'atcgagctttgggggtagat3'

5'agcaacagtgtagcgcaatg3'

NR4A2

5'ACTCCAACCCGGCTATGAC3'

5'CATGGAGCCAGTCAGGAGAT3'

NR4A2_ncRNA

5'cttccgggtgtctgagaaag3'

5'tttgcatgtgctaggagctg3'

NR4A3

5'TCCAGATACTGTCCCACTGACC3'

5'TCTGGATACATCAATGGAGGCT3'

NR4A3_ncRNA

5'ccgttaagcacctggttttc3'

5'aggcgctgagaattattgga3'

Genes selected for validation in stromal cells


SPINT2

5'TCTGTTTCTCTGGGAGGTAGGA3'

5'CGATCAGCGAGGAAACAACT3'

HLA-E

5'ATCGTGGGCATCATTGCT3'

5'GAGTAGCTCCCTCCTTTTCCA3'

SEMA3A

5'AGGGACCGAAAACAACGTC3'

5'CGTGGGTCCTCCTGTTTCTA3'

TBCD_ncRNA

5'TCTTGCCTGGTGAGTGTGAG3'

5'AAGGTGTTGGAAGGGAGGAG3'

SOLH_ncRNA

5'AGTCTCCAGAGTGGCATGTG3'

5'AAAGGTAGGCAGGGGAGGTA3'

Endogenous gene


HPRT

5'TCCAGCAGGTCAGCAAAGAA3'

5'GAACGTCTTGCTCGAGATGT3'


Baratti et al. BMC Medical Genomics 2010 3:30   doi:10.1186/1755-8794-3-30

Open Data