Table 4

Fluorescence labeled primers for gel shift assays

Binding site

Sequence 5'-3'

Label


PdhRop

GCCGAAGTCAATTGGTCTTACCAATTTCATGTCTGTG

5'DY682

CACAGACATGAAATTGGAAGACCAATTGACTTCGGC

5'DY782

GlcDop

CTATCTCTTTAGCTACCGGTCAGACCATTTTTTTTCCAGCTCT

5'DY682

AGAGCTGGAAAAAAAATGGTCTGACCGGTAGCTAAAGAGATAG

5'DY782

MraZop

TCGGTATGCCTTGTGACTGGCTTGACAAGCTTTTCCTCAGCTCC

5'DY682

GGAGCTGAGGAAAAGCTTGTCAAGCCAGTCACAAGGCATACCGA

5'DY782

MetBop

AACGGCTATTTGGGATTTGCTCAATCTATACGCAAAGAAGTTT

5'DY682

AAACTTCTTTGCGTATAGATTGAGCAAATCCCAAATAGCCGTT

5'DY782


Göhler et al. BMC Systems Biology 2011 5:197   doi:10.1186/1752-0509-5-197

Open Data