Table 3

Primer pairs for qPCR

Binding site

Sequence 5'-3'


PdhRop

CACAGTTTCATGATTTC

+

GAGAGTGCCTTCGAG

-

GlcDop

CGGACCTCGTGCACAG

+

GTGCCATCAGTACCG

-

MraZop

AACGGTGATGACGATG

+

GGTAGGCACTGATAAG

-

MetBop

GTGTAATGCACCTGTC

+

AACCCGCTACGCACTG

-

YnfMop

ATGCAGCTCTTCCGC

+

TTCTCAGTGTCGCTTG

-

PtsGop

GTCGGTAAATCGCTGATGCTGCC

+

CAACAACTGCGGCCAGCGC

-


Göhler et al. BMC Systems Biology 2011 5:197   doi:10.1186/1752-0509-5-197

Open Data