Table 3

Nucleotide sequence of PCR primers used for the construction of genetically modified clone
Name Nucleotide Sequence(5′ → 3′) Nucleotide Position (nt)
HN2729F TCCTACACTTCGA
    C
GGTGACGTACCGTAC
2729–2752(E → D)
HN2729R GTACGGTACGTCACC
    G
TCGAAGTGTAGGA
2729–2752(E → D)
HN3341F GATTTGTGAAAGTCA
    A
ACCAAAAGACCAAAT
3341–3371(T → K)
HN3341R ATTTGGTCTTTTGGT
    T
TGACTTTCACAAATC
3341–3371(T → K)
HN3356F CACCAAAAGACCAA
    G
TCAATGTGCTGGACC
3356–3385(I → V)
HN3356R GGTCCAGCACATTGA
    C
TTGGTCTTTTGGTG
3356–3385(I → V)
ZP1F CAACCTACACTTCATGTTCACAGG 2883–2906
ZP2R AGACGGTCGCTACAACGGAAGT
    A
GTAAG
3610–3659(C → S,S → G,A → T,
TAC
    G
GTGAC
    A
CC
    A
GC
    AC
GA
    A
C
R → S,V → T,S → N)
ZP3F G
    T
TC
    GT
GC
    T
GG
    T
GTCAC
    C
GTACTTAC
    T
A
3610–3659(C → S,S → G,A → T,
CTTCCGTTGTAGCGACCGTCT R → S,V → T,S → N)
ZP4R TGCTTGTGTCTAGCGTCACTCG 3815–3836

Mutated nucleotides are underlined and in bold and the codon of the mutation effects are indicated in bold. Amino acid changes are shown in brackets.

Li et al.

Li et al. BMC Veterinary Research 2012 8:57   doi:10.1186/1746-6148-8-57

Open Data