Table 1

Genomic and cDNA primers and their locations forPKLRin domestic cats
gDNA Primer 5'-3' Sequence gDNA Primer 5'-3' Sequence
PKLRex2F CGGTACTTGCTCCACAGGAT (chrF1:88325815–34)* PKLRex2R GTGGCGATGATGCAGGTACT (chrF1:88326141–60)
PKLRex5F CGAACACCGTGTGGGTAGACTA (derived from cDNA) PKLRex6R GGAGGCAAACACGATGTCTACC (chrF1:88327517–38)
PKLRex6F TCGTGTTTGCCTCCTTTG (chrF1:88327525–42) PKLRex10R AGACCTCTCGGAACAGGTG (chrF1:88329412–30)
PKLRex9F TCAAGTGCTGTGCTGCTG (chrF1:88328580–97) PKLR3utrR TGGCCAGTGCTTAATTGG (chrF1:88330288–305)
cDNA Primer 5'-3' Sequence cDNA Primer 5'-3' Sequence
PKLR_cD_Ex2F GGGTACCTACGGCGGGTCAG (chrF1:88325991–6010) PKLR_cD_Ex7R CTTCTCAGGTGGGATCTCGAT (chrF1:88327825–45)
PKLR_cD_Ex6F TCGTGTTTGCCTCCTTTGTGCG (chrF1:88327525–42) PKLR_cD_Ex10R AGACCTCTCGGAACAGGTG (chrF1:88329412–30)
PKLR_cD_Ex8F GAGACGAGCGATGTAGCG (chrF1:88328256–73) PKLR_3UTR CGTGAAATGGAGCAGGGAAGG (chrF1:88330247–67)
5' Race primer 5'-3' Sequence 5' Race primer 5'-3' Sequence
AUAP GGCCACGCGTCGACTAGTAC PKLR_5'_ex2/3R CCGGCCCAATGGTGGCG

* locations defined by feline assembly Dec. 2008 NHGRI/GTB V17e/felCat4.

Grahn et al.

Grahn et al. BMC Veterinary Research 2012 8:207   doi:10.1186/1746-6148-8-207

Open Data