Table 1

Primers and probes used in the rRT-PCR assays
rRT-PCR Assay Name Target Genes (GenBank Accession Number) Primer or Probe Namesa Sequence 5' to 3' and Nucleotide Location Length of Fragment (bp)
ERAV 5'-UTR of ERAV (L43052) ERAV F AGCGGCKdTGCTGGATTTTC (397-415) 60
ERAV R CATYeTGYCAGCTTGGTGACA (438-457)
ERAV Pr FAMb-CGGTGCCATTGCT-MGBc (417-429)
ERBV1 5'-UTR of ERBV1 (NC_003983) ERBV1 F CCCCTTfCCCTGAAGATTGCT (148-167) 61
ERBV1 R GGCAAACGACCAACACATCA (190-209)
ERBV1 Pr FAM-TTCTTCCAACTAAACCC-MGB (169-185)
ERBV2 5'-UTR of ERBV2 (NC_003077) ERBV2 F CCCCAACCCTTGAGATTGCT (148-167)

aF = Forward primer. R = Reverse primer. Pr = Probe.

bReporter dye (FAM; 6-carboxyfluorescein) labeled nucleotide.

cNonfluorescent quencher dye (MGB™; minor groove binding) labeled nucleotide.

dK represents G or T.

eY represents C or T.

f Nucleotide difference between the forward primers of ERBV1 and ERBV2 are in bold.

Lu et al.

Lu et al. BMC Veterinary Research 2012 8:120   doi:10.1186/1746-6148-8-120

Open Data