Table 1

Primers used for semi-quantitative RT-PCR and RACE
Primer Sequence (5′ to 3′) Application
291-F1 ATGTGGGTGATAGTTGGTTTACAAT Expression study
291-R1 GTAATTTCAGAAGCACAGTTGAGAG Expression study
357-F1 CTATCGCATGATTGCCTACTCAGACT Expression study
357-R1 ACAACATTTTCCATCTCAATCTCAG Expression study
788-F1 GGTCTTAACGGAGAGAAGTGCGA Expression study
788-R1 GACTCTTCCGGCACGTAACT Expression study
153-F1 CCAGCATCACAGTGTTCAGGCAG Expression study
153-R1 AGTGTGTAGTTGTGTTCACCCTCC Expression study
β-actin-F CAGATCATGTTTGAGACC Expression study
β-actin-R ATTGCCAATGGTGATGAC Expression study
291-F2 CTCTCAACTGTGCTTCTGAAATTAC 3’ RACE PCR
291-R2 ATTGTAAACCAACTATCACCCACAT 5’ RACE PCR
357-F2 GGTATGATTATGACTAAAGCAGGAC 3’ RACE PCR
357-R2 GTCCTGCTTTAGTCATAATCATACC 5’ RACE PCR
788-F2 AGTTACGTGCCGGAAGAGTC 3’ RACE PCR
788-R2 TCGCACTTCTCTCCGTTAAGAC 5’ RACE PCR
153-F2 GGAGGGTGAACACAACTACACACT 3’ RACE PCR
153-R2 CTGCCTGAACACTGTGATGCTGG 5’ RACE PCR

Chen et al.

Chen et al. BMC Veterinary Research 2012 8:108   doi:10.1186/1746-6148-8-108

Open Data